ID: 929479949

View in Genome Browser
Species Human (GRCh38)
Location 2:42296184-42296206
Sequence CCTACTCTGAAGGAAGTACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 124}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929479949_929479954 6 Left 929479949 2:42296184-42296206 CCATGTACTTCCTTCAGAGTAGG 0: 1
1: 0
2: 1
3: 6
4: 124
Right 929479954 2:42296213-42296235 TAAGAGAAAAATTGGAGACCTGG 0: 1
1: 1
2: 0
3: 34
4: 452
929479949_929479955 21 Left 929479949 2:42296184-42296206 CCATGTACTTCCTTCAGAGTAGG 0: 1
1: 0
2: 1
3: 6
4: 124
Right 929479955 2:42296228-42296250 AGACCTGGTTCTAAAACCAGTGG 0: 1
1: 0
2: 4
3: 15
4: 143
929479949_929479956 22 Left 929479949 2:42296184-42296206 CCATGTACTTCCTTCAGAGTAGG 0: 1
1: 0
2: 1
3: 6
4: 124
Right 929479956 2:42296229-42296251 GACCTGGTTCTAAAACCAGTGGG 0: 1
1: 0
2: 1
3: 5
4: 103
929479949_929479958 27 Left 929479949 2:42296184-42296206 CCATGTACTTCCTTCAGAGTAGG 0: 1
1: 0
2: 1
3: 6
4: 124
Right 929479958 2:42296234-42296256 GGTTCTAAAACCAGTGGGCCAGG 0: 1
1: 0
2: 0
3: 10
4: 143
929479949_929479953 -2 Left 929479949 2:42296184-42296206 CCATGTACTTCCTTCAGAGTAGG 0: 1
1: 0
2: 1
3: 6
4: 124
Right 929479953 2:42296205-42296227 GGAGGTTCTAAGAGAAAAATTGG 0: 1
1: 0
2: 1
3: 24
4: 299

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929479949 Original CRISPR CCTACTCTGAAGGAAGTACA TGG (reversed) Intronic
904312150 1:29635781-29635803 CCTACCCTGATGGAGGTGCAGGG + Intergenic
905777532 1:40678681-40678703 CCGACTCTGGAGCAAGCACAGGG - Intergenic
906928831 1:50148440-50148462 TCTACTCTGAAGGAAGACAAAGG - Intronic
907978249 1:59454694-59454716 AATACTCTGAAGGAAGTAGAGGG - Intronic
911683571 1:100746873-100746895 TCTACTGGGAAGGAAGTAAATGG + Intergenic
913126707 1:115797457-115797479 CCTACTTTGAATGAAGTTGAAGG + Intergenic
918198259 1:182242899-182242921 ACTACTTTGAGGGAAGTCCAGGG + Intergenic
921692080 1:218164056-218164078 CCTACATTTAAGGAAGTAGAAGG - Intergenic
922554283 1:226521155-226521177 TCAACTCTGCAGGAAGTTCATGG - Intergenic
922761576 1:228135355-228135377 CATACTCTGGAGGAAGGACGTGG - Intergenic
924126602 1:240860342-240860364 CAAACACTGAAAGAAGTACAAGG - Intronic
1063124362 10:3126160-3126182 TCAGCTCTGAAGGAAGTACCCGG - Intronic
1064311957 10:14219686-14219708 CCTTCTCTGAAGGTGTTACATGG - Intronic
1069708335 10:70473232-70473254 CCGACTCTGCAGGAAACACAGGG + Intergenic
1071479844 10:86056928-86056950 CCAGCTCTGCAGGAAGCACAAGG - Intronic
1072324970 10:94288761-94288783 CCTACACTGAAGGAGCCACATGG + Intronic
1078556703 11:12333014-12333036 GCCACTCTGTAGGAAGTCCATGG + Intronic
1079432607 11:20408464-20408486 CTTAATTTGAAGGAGGTACATGG - Intronic
1080246561 11:30185625-30185647 CCTACTGTGATGGAAGAAAAGGG + Intergenic
1087664896 11:101032734-101032756 CTTATGCTGGAGGAAGTACAGGG - Exonic
1088091558 11:106046173-106046195 CCTAGTCTGTAGGAAGGACTTGG + Intergenic
1088353838 11:108920981-108921003 CCTACTCTGACTGAAGGACAGGG - Intronic
1088555887 11:111060165-111060187 ACTACTCTGTAGGAAGAACTTGG - Intergenic
1090828958 11:130407687-130407709 CTTACTCTGCAGGAAGTACATGG + Intronic
1091153603 11:133352630-133352652 CATACGCTGTAGTAAGTACAAGG - Intronic
1095176344 12:39096212-39096234 ACTACTCTGGTGGAAGTAGAAGG - Intergenic
1096882925 12:54687228-54687250 CCCACTCTGAAGGGAGCAGAAGG + Intergenic
1097644307 12:62217619-62217641 CCTACTTTGAAGGAAGGGCTGGG - Intronic
1097919944 12:65061045-65061067 CAGAGTCTGAAGTAAGTACAGGG + Intronic
1099272657 12:80530938-80530960 GCTACTCTGAAGGAAGGCTAAGG + Intronic
1099364755 12:81754397-81754419 CTTAGGCTGAAGGAAGTAAATGG - Intronic
1109761405 13:66834576-66834598 TTTGCTTTGAAGGAAGTACAAGG + Intronic
1110329666 13:74257109-74257131 CCTAGGCTGGAGGAGGTACATGG + Intergenic
1111142599 13:84140127-84140149 CCTATTTTGAAGGAAATAAAAGG - Intergenic
1111873830 13:93868052-93868074 CCTACTCTGCAGAAAATCCATGG - Intronic
1114043739 14:18703390-18703412 TGTACTCTGAAGTAAGGACACGG + Intergenic
1116622519 14:47224219-47224241 CCTAATCTGAAGAAACAACATGG + Intronic
1116996970 14:51334568-51334590 CCTACTCTGAAGAAAAAACGGGG - Intergenic
1117432409 14:55681025-55681047 GGTAACCTGAAGGAAGTACAAGG - Intronic
1119981468 14:79086392-79086414 CCTACTCTCAAGAAATTACAAGG - Intronic
1122104895 14:99445529-99445551 TCTACTCTCAAGGAAGAAAACGG - Intronic
1122926371 14:104904720-104904742 CCTCCTTTGAAGGAAGTCCTGGG + Intergenic
1127509085 15:59622548-59622570 CCTCCTCTGAAGGAGGTAGAAGG + Exonic
1129321487 15:74777455-74777477 CCTGCTCTGCAGGAAATAGAAGG + Intergenic
1133468610 16:6052210-6052232 CCTACTATGAAGGAAATGGAAGG - Intronic
1134886240 16:17794942-17794964 TCATCTCTGAAGGAAGTACTAGG + Intergenic
1136148454 16:28330310-28330332 CCTCCGCTGAAGGAAGGACTGGG - Intergenic
1141168129 16:81674154-81674176 CCTGATCAGAAGGAAGTGCAGGG + Intronic
1145885401 17:28378924-28378946 CCTACTCTGTAGGATTTGCAGGG - Intronic
1150787602 17:68175572-68175594 CCTCCTGTGAAGGAAGGAAAGGG - Intergenic
1153478771 18:5525873-5525895 TCTTCTCAGATGGAAGTACAAGG - Intronic
1153606190 18:6835974-6835996 CCTGCTCTGATGGAGCTACAGGG + Intronic
1156174522 18:34527500-34527522 CCTTCTCTGTAGGAGGCACAGGG - Intronic
1156972517 18:43173192-43173214 CCTACCCTGAAGGAAGAATCAGG + Intergenic
1158250782 18:55485177-55485199 CCTAGGATGAAGGCAGTACACGG + Intronic
1158266237 18:55663750-55663772 CATAACCTGAAGAAAGTACATGG + Intronic
1161746912 19:6066031-6066053 CCCGCTCTGAATGAAGTTCAGGG + Intronic
1162210297 19:9086162-9086184 CCTACCCTAATGGATGTACATGG - Intergenic
1165561740 19:36686421-36686443 CATACTCAGATGGAAGTAAAAGG + Intergenic
1165808712 19:38597374-38597396 CCTATTCTCCAGGAAGAACATGG - Exonic
1167520060 19:49949344-49949366 CCTCTTCTGAAGGAAGAGCATGG + Exonic
925220057 2:2131844-2131866 CGTTCTCTGCAGGAGGTACATGG + Intronic
927130022 2:20051257-20051279 CCAACTCTGGATGAAGTCCAAGG - Intronic
928190638 2:29163172-29163194 CCTACTCTGAAGGAAATAACAGG - Intronic
928871534 2:35986825-35986847 CCTGCTCTGTAGGAAGCAAAGGG + Intergenic
929479949 2:42296184-42296206 CCTACTCTGAAGGAAGTACATGG - Intronic
929688819 2:44057824-44057846 GCTCCAATGAAGGAAGTACAAGG + Intergenic
933194349 2:79371626-79371648 CCTACTTTGCAGGAGGAACATGG + Intronic
933243214 2:79946045-79946067 TCTAGGCAGAAGGAAGTACATGG + Intronic
934040691 2:88125587-88125609 CCTAGACTGAAGGCAGTGCAGGG - Intronic
939600544 2:144184173-144184195 TTTACACTGAGGGAAGTACATGG + Intronic
943753899 2:191538430-191538452 CCTACTGTGGATGAGGTACAGGG - Intergenic
947870819 2:233436935-233436957 CCAACCCAGAAGCAAGTACATGG - Intronic
948861065 2:240752791-240752813 CCCACTCTGCAGGAAGCCCATGG + Intronic
1169512635 20:6280912-6280934 CTTACAGTGAAGGAAGTAGAAGG - Intergenic
1170522852 20:17206273-17206295 CCTCCTCTGAAGGCATTACTAGG + Intergenic
1173615403 20:44400272-44400294 CCCACTCTGAAGGTAGGAGACGG + Intronic
1173617827 20:44414362-44414384 CCAGCTCTGAAGGAAGCTCAGGG - Intronic
1176100026 20:63360647-63360669 CCTTTTCTGCAGGAAGGACAAGG - Intronic
1177141068 21:17358773-17358795 TCTAGTCTGAAGGAAGAAAAAGG + Intergenic
1178098062 21:29236759-29236781 CCTATTCTGAAATAAATACAAGG - Intronic
1181977956 22:26745336-26745358 CCCACTGAGCAGGAAGTACATGG - Intergenic
1184839700 22:47045469-47045491 TCTACTTTGGAGCAAGTACAAGG - Intronic
952393250 3:32898937-32898959 CCATTTCTGAAGGAAGTGCAGGG + Intergenic
953843745 3:46410415-46410437 CCTCCTGTGAAGGAAAGACAGGG - Intronic
954051954 3:47986641-47986663 CCTAGTCTGAAAGAAGAGCAGGG - Intronic
955272681 3:57517204-57517226 AGTACTGTGAAGGAAATACAGGG - Intronic
957297408 3:78350726-78350748 CCTACTTTAAAGGAAGAACAGGG + Intergenic
960052294 3:113250538-113250560 CCTCGTCTGGAGGAAGAACAGGG - Exonic
963855364 3:150247820-150247842 CCTACTCTGGGGCAAGTAGATGG - Intergenic
966055711 3:175686803-175686825 CCTAATTTGAAGGAAGCCCAAGG + Intronic
971029617 4:22621994-22622016 ACCACCATGAAGGAAGTACACGG - Intergenic
975972503 4:80058440-80058462 GTTACCCTGAAGGGAGTACAAGG - Intronic
976465100 4:85358128-85358150 CCTACTCTGGTGGAAGTAGCAGG + Intergenic
976824598 4:89246967-89246989 CTTACCCTAGAGGAAGTACATGG - Exonic
979808948 4:125011744-125011766 CCCACTCTGCAGGAATAACAGGG + Intergenic
982869717 4:160563017-160563039 CCAAATCTGAAGATAGTACAGGG - Intergenic
985559223 5:574070-574092 CCTGCTCTGGAGGATGCACAGGG - Intergenic
987203143 5:15597663-15597685 TCTAGTCTAAAGGAAGAACAGGG - Intronic
991246609 5:64514805-64514827 CATACTCTGGAGCAAGGACAAGG + Intronic
992557766 5:77919986-77920008 TCTGCTCTGAAGGAAGTTCTAGG - Intergenic
996398525 5:123036152-123036174 GCCACGCTGAAGGAAGTACTTGG + Intronic
1001988891 5:176099595-176099617 ACTACTCTGAAGTAATCACATGG + Intronic
1002227974 5:177738541-177738563 ACTACTCTGAAGTAATCACATGG - Intronic
1002372967 5:178769413-178769435 CCTACTCTGAATGAAGGTGATGG + Intergenic
1003261028 6:4516294-4516316 CCTACTCTAAAAGCAGGACAAGG + Intergenic
1005662395 6:28012123-28012145 CCAAGTCTGAAGGAAGCAGAAGG + Intergenic
1011572053 6:88748226-88748248 CATACTCTGAGGGAAGTAGGAGG - Intronic
1012588703 6:100952825-100952847 CCTCCTCTGAAGCTAGGACAAGG + Intergenic
1012962678 6:105638926-105638948 CCTATTTTGATGGAAATACAGGG + Intergenic
1023547369 7:41332160-41332182 CTTACTCTGAATGAACTAGATGG - Intergenic
1028873260 7:95792389-95792411 CCTTCTCTGAAGCAAGTCAAAGG + Intronic
1037022629 8:13992788-13992810 CACACTCTGCAGGAAGTAGAAGG - Intergenic
1039971073 8:42322171-42322193 CCTGCTCTGGAGGAAGGACTGGG + Intronic
1045400941 8:101817191-101817213 CCTTCCCAGAAGGAAGAACAGGG - Intronic
1046077288 8:109328314-109328336 CCTTCTCTGAAGAAAGAAAAAGG + Intronic
1047766452 8:127993905-127993927 CTTTCTCTGAAGGAATCACAGGG + Intergenic
1048428327 8:134343199-134343221 CCTTCAATGTAGGAAGTACAGGG - Intergenic
1051305902 9:15708875-15708897 TCTACTCTGAATCAATTACATGG - Intronic
1051487354 9:17623166-17623188 CCCACTCCGATGGAAGGACAAGG - Intronic
1051848173 9:21476511-21476533 CCTACTTTGTAGTAAGGACATGG - Intergenic
1056900879 9:90598213-90598235 CCTACTCTAAAGACACTACAAGG + Intergenic
1057717141 9:97503669-97503691 CCTACCCTGAAGGAGGGAGAAGG - Intronic
1058205363 9:102099616-102099638 CTTACTCTGAAGAATGAACATGG - Intergenic
1058256024 9:102764912-102764934 CCTTTCCTGTAGGAAGTACAAGG + Intergenic
1060860135 9:126947284-126947306 CCTCCTGTGAAGTAGGTACAGGG + Intronic
1062680422 9:137776286-137776308 CCTACTCTGAAGGGCGGATAGGG - Intronic
1196068578 X:111493732-111493754 CCTCATATGAAGGAAATACAGGG + Intergenic
1197493852 X:127153411-127153433 CCTGCTCTGATGGACGTAGACGG + Intergenic
1198196103 X:134364140-134364162 CCTACTATGTATCAAGTACATGG - Intergenic
1201014192 Y:9581779-9581801 CCTATTATGAAGCAAGTATAGGG - Intergenic
1201610241 Y:15834966-15834988 CAGACTCTGAGGGAAGAACATGG - Intergenic