ID: 929480460

View in Genome Browser
Species Human (GRCh38)
Location 2:42302488-42302510
Sequence AATCACATGAAGAATGTGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 263}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929480460 Original CRISPR AATCACATGAAGAATGTGGT CGG (reversed) Intronic
900006897 1:63623-63645 AATCATTTGAGGAATGTCGTTGG - Intergenic
900840134 1:5042115-5042137 AATTACATAAAGAATGGGGTTGG - Intergenic
901512466 1:9724361-9724383 AATCACATGGACAAAGTCGTAGG - Exonic
902146571 1:14406083-14406105 AATAACATAAAGAATGTAATTGG + Intergenic
902590341 1:17469508-17469530 ACTAACATGAAGAAGGGGGTGGG + Intergenic
902746127 1:18475807-18475829 AATCTGATGAAGGAGGTGGTTGG - Intergenic
904183901 1:28687633-28687655 AATCACATGATTAATCTGGTGGG + Intronic
906738547 1:48156895-48156917 ATCCACATGAAGAATGAAGTTGG + Intergenic
907728593 1:57044057-57044079 AATCAGATGAAGAGTGTGCCAGG - Intronic
908046939 1:60180418-60180440 ACTAACATGATGAATGAGGTGGG + Intergenic
908415431 1:63908871-63908893 ACTCAGATGAAGAATGTGCCAGG + Intronic
910131534 1:83913369-83913391 TATCACATGAAGTATTAGGTTGG - Intronic
910848864 1:91631594-91631616 AATCAAATGACGCATGTGTTAGG + Intergenic
911459296 1:98169364-98169386 ATTTAGATGAAGAAGGTGGTGGG - Intergenic
911965340 1:104361644-104361666 AATAACATGAAGCATGTGTTGGG + Intergenic
912459805 1:109823031-109823053 AAGGACATGCAGAATGTGGTGGG + Intergenic
913548064 1:119889503-119889525 AATAACATAAAGTATGTGTTTGG + Intergenic
916197019 1:162234090-162234112 AAACACAGGCAGAATGTGATTGG + Intronic
918993074 1:191723631-191723653 AACTATATGAACAATGTGGTGGG - Intergenic
920452792 1:206072808-206072830 AGACACAGGAGGAATGTGGTGGG - Intronic
920968311 1:210720505-210720527 AGTCTCAGGAAGAATGTGGAAGG + Intronic
921261460 1:213388469-213388491 AATTGCATGAAGAATGTGGGAGG - Intergenic
921774427 1:219080752-219080774 AATCACAGCATGAAGGTGGTGGG + Intergenic
923796044 1:237156693-237156715 AGTAATATGTAGAATGTGGTGGG + Intronic
1063261224 10:4391743-4391765 AATGTTATGAAGACTGTGGTAGG + Intergenic
1063596254 10:7438462-7438484 AATTACGTGAGTAATGTGGTGGG + Intergenic
1064592211 10:16905810-16905832 AAGCATATGAAGAATATTGTAGG + Intronic
1066113210 10:32215844-32215866 AATGATATGAAGAACGTAGTAGG + Intergenic
1066596141 10:37052014-37052036 AATAGCATAAAGAGTGTGGTGGG + Intergenic
1067130730 10:43563016-43563038 AATAATATGAAGAATGAGGCCGG + Intronic
1067920361 10:50449559-50449581 AAGGACATGAAGAAAGTGGAGGG - Intronic
1068213702 10:53954968-53954990 AATCACATGTTTAATGTGCTAGG + Intronic
1070183259 10:74035070-74035092 CATTACATTAAAAATGTGGTAGG - Intronic
1071039649 10:81291306-81291328 AATTATATGAAGAATGTTATTGG - Intergenic
1071395590 10:85220204-85220226 AATTATGTGAAGAATGTTGTCGG - Intergenic
1073677818 10:105668934-105668956 TATTTGATGAAGAATGTGGTGGG + Intergenic
1074115310 10:110453535-110453557 AATCACTTAAAGAATGTAGCTGG + Intergenic
1074206652 10:111288577-111288599 AAGCTCATGATGAATGAGGTAGG - Intergenic
1074921376 10:118017461-118017483 AATGACATGAAGGATATGTTTGG + Intronic
1074929342 10:118107808-118107830 AAACACATGTATAATGTGTTGGG - Intergenic
1075221846 10:120591900-120591922 AATAACATGAAGCTGGTGGTAGG + Intergenic
1078116530 11:8457924-8457946 AATAACATGGAGAACTTGGTAGG + Intronic
1078488623 11:11748054-11748076 AATTTCATGAAGAATGTCCTTGG + Intergenic
1079531340 11:21457917-21457939 AATGACAAGAAGAATCTGCTGGG + Intronic
1080146798 11:28995440-28995462 AATCACTTGAAAGATGTGGAGGG + Intergenic
1080175972 11:29363691-29363713 AATCATATGCAAAATGTTGTAGG - Intergenic
1080282553 11:30575057-30575079 ATTCAGTTCAAGAATGTGGTAGG - Intronic
1082176455 11:49065900-49065922 AATCAAATGAAGGAGGGGGTGGG - Intergenic
1082217766 11:49595502-49595524 CATCACATGACGAAAGTGTTTGG - Intergenic
1083120138 11:60504045-60504067 AATCACATGAACAATGGGGAAGG + Intronic
1083493042 11:63027191-63027213 ACTCACATCAAGAATGGTGTGGG - Intergenic
1085170982 11:74449743-74449765 AATCGCATGCAGAAGGTTGTTGG + Intergenic
1086631807 11:89028648-89028670 TATCACATGACGAAAGTGTTTGG + Intronic
1086716599 11:90069996-90070018 AATCAAATGAAGGAGGGGGTGGG - Intergenic
1087551374 11:99654521-99654543 AATCACATTAAAAATGATGTAGG + Intronic
1088515659 11:110630380-110630402 AATTCAATGAAGAATGTGATGGG - Intronic
1088785259 11:113175912-113175934 AATCACGGTAAGAATGTGGGTGG + Intronic
1088989636 11:114941101-114941123 GAGCAAATGAAGTATGTGGTGGG - Intergenic
1089617601 11:119703767-119703789 GATCTCATGAAGAGTGTGGGTGG - Intronic
1090575908 11:128103436-128103458 AGTCAAATGAAGAAAGTGCTTGG + Intergenic
1091619288 12:2074132-2074154 AATCAGTTGAAGTATGTGTTAGG + Intronic
1092069496 12:5621298-5621320 AATGACAGGAAAAATGTGTTTGG + Intronic
1099232998 12:80049525-80049547 AAACAGATGAGGAGTGTGGTAGG - Intergenic
1099418673 12:82425290-82425312 AAACACATGTATAAAGTGGTAGG - Intronic
1100449453 12:94691403-94691425 AATAACTTAAAGAATGTGATTGG - Intergenic
1102903474 12:116657001-116657023 AATCACTCCAAGAATGGGGTGGG - Intergenic
1111868372 13:93798328-93798350 AATGACATGAAGTATTTGATGGG + Intronic
1112333241 13:98493169-98493191 AATCCCAAGAAGAATGTTTTAGG - Intronic
1112870445 13:103964406-103964428 AATCACATGAAGATTGCAGTTGG + Intergenic
1114960159 14:27877231-27877253 AATCACTTAAAGAATGTAATTGG - Intergenic
1115555485 14:34542183-34542205 GATCACAAGAAGATTGAGGTTGG + Intergenic
1115558423 14:34560910-34560932 GATCACAAGAAGATTGAGGTTGG - Intergenic
1117747467 14:58885183-58885205 CCTCTCATGAAGAATGTGGGAGG - Intergenic
1119663306 14:76466292-76466314 AAACACAAGGAGAATGTGGCTGG - Intronic
1120456347 14:84735879-84735901 TAACAAATGCAGAATGTGGTGGG + Intergenic
1122281100 14:100622895-100622917 GATCAAATGCAGAATGTGGGTGG + Intergenic
1123708899 15:22972011-22972033 ATTTGCATGAAGAATATGGTAGG - Intronic
1127268615 15:57380776-57380798 AAGCTCATGGAGAATGTGGCTGG + Intronic
1128474248 15:67983617-67983639 AATAAAATAAAGAATGTGGCTGG + Intergenic
1129146665 15:73654125-73654147 AATCACAGGAAAAATATGGAAGG + Intergenic
1132035795 15:98483112-98483134 AATGCTATGAAGAATGTGGATGG - Intronic
1132446564 15:101927011-101927033 AATCATTTGAGGAATGTCGTTGG + Intergenic
1133484192 16:6202745-6202767 AATTACATAAAGAACGTGGGAGG - Intronic
1133634456 16:7652402-7652424 AATAAGAAGAAGAATGTGGGCGG - Intronic
1133978020 16:10613985-10614007 AATAACAGGAACAATGTGTTAGG + Intergenic
1135152625 16:20022209-20022231 AATAAAATGAAGAAATTGGTTGG - Intergenic
1138390197 16:56664806-56664828 AATGACATGAAGAATGGGAAAGG + Intronic
1140916706 16:79500304-79500326 CATCCCATGAAGAATGTTGGTGG - Intergenic
1142255739 16:89012987-89013009 AGTCACATAAAGAATGAGATGGG - Intergenic
1143934552 17:10469297-10469319 TATCAGATGAAGAAGGTGGCAGG + Exonic
1144410783 17:14999188-14999210 AATTCAAGGAAGAATGTGGTGGG + Intergenic
1146643904 17:34563653-34563675 AATTACATGGGGAATGTGGGAGG - Intergenic
1147323388 17:39659063-39659085 AATCAGATGAAGAAGTTGCTGGG + Exonic
1147731693 17:42607839-42607861 AAATAAATGAAGAACGTGGTAGG + Intronic
1150983845 17:70173118-70173140 AATCTCAGGAAAAATGTGTTGGG + Intronic
1153814557 18:8781432-8781454 TATCACATGAAGGATTTGGTTGG - Intronic
1154261935 18:12842633-12842655 AGGGACATGAAGAATGTGGCTGG + Intronic
1154335080 18:13458548-13458570 AATTGCATGAAAGATGTGGTAGG + Intronic
1155124326 18:22856552-22856574 AATCCTAAGAAGAATATGGTTGG - Intronic
1155949321 18:31892183-31892205 AATGACATGAAGCATGGGCTAGG - Intronic
1157094786 18:44678552-44678574 ACTCTCATGAAGAACGTGATAGG + Intergenic
1157982957 18:52403580-52403602 AACAATATAAAGAATGTGGTGGG - Intronic
1159448170 18:68565907-68565929 AATAACATGCAGGACGTGGTGGG + Intergenic
1160638654 19:105208-105230 AATCATTTGAGGAATGTCGTTGG - Intergenic
1164181778 19:22825576-22825598 AATCACATCACTAATGTGCTGGG - Intergenic
1165501109 19:36190175-36190197 AAATACATACAGAATGTGGTAGG + Intronic
1165682556 19:37790224-37790246 AATGTATTGAAGAATGTGGTGGG + Intronic
925360676 2:3278277-3278299 CACCACATGCAGACTGTGGTTGG + Intronic
927742250 2:25582016-25582038 CTTCACATTAAGAAAGTGGTGGG - Intronic
928444850 2:31324662-31324684 ACTCATATAAAGAATGAGGTGGG + Intergenic
929480460 2:42302488-42302510 AATCACATGAAGAATGTGGTCGG - Intronic
931090857 2:58884473-58884495 AATCCCTGGAAGAATCTGGTAGG - Intergenic
931252254 2:60543312-60543334 AATCTCTAGAAGAATGTGTTTGG - Intronic
931810705 2:65852198-65852220 GAGCACTTGAAGAATGTAGTAGG - Intergenic
933159305 2:79006889-79006911 TATTAAATGAAGAGTGTGGTTGG + Intergenic
933546896 2:83725605-83725627 AATCACTTAAAGAATGTAATTGG - Intergenic
935436621 2:103042461-103042483 AATTCCATGAAGAATGTTGGCGG - Intergenic
935491084 2:103721218-103721240 AATTCCATGAAGAATGTCATTGG - Intergenic
936050288 2:109217578-109217600 TAACACATGCAGGATGTGGTAGG - Intronic
936681019 2:114771407-114771429 AAGCAGATGATGAATCTGGTTGG - Intronic
938695400 2:133830620-133830642 AATCACTTAAAGAATGTAATTGG + Intergenic
939084395 2:137700589-137700611 AATTACATGAAGAAAGTCATTGG - Intergenic
939216266 2:139242563-139242585 AGTCACATGAAGACGGTGCTGGG - Intergenic
939438559 2:142211105-142211127 ATTGACATGAAGAGTGTGTTGGG + Intergenic
939584522 2:143990371-143990393 AATGACATGAAGAAGGTAATGGG + Intronic
939799375 2:146689274-146689296 AATCAAATGATGAATGAGATGGG + Intergenic
939905848 2:147913622-147913644 GATCACTTGAAGAATGAGGGAGG + Intronic
940595242 2:155783133-155783155 AGTTCCATGAAGAATGTGGATGG - Intergenic
940663754 2:156580500-156580522 GATCATATGAAGAATGTATTGGG + Intronic
941096386 2:161243279-161243301 AACCAAATGAAGTATTTGGTTGG - Intergenic
941704011 2:168638341-168638363 ATTCACATTAAGAAACTGGTTGG + Intronic
942691927 2:178594684-178594706 TGTCACATTAAGAATGTAGTAGG + Intronic
943553835 2:189376384-189376406 AAACATATCAAGAATATGGTAGG - Intergenic
944456189 2:199897288-199897310 AATAAAATGAAGAATTTGGAAGG - Intergenic
945049312 2:205808009-205808031 AATCACATGCGTAATATGGTTGG - Intergenic
946062147 2:216952108-216952130 AGTTACATGAAGAATGTTGTTGG + Intergenic
1170253851 20:14317656-14317678 AAAGACATGAAGATTATGGTTGG - Intronic
1170320110 20:15086664-15086686 AAACACATGAAGTATCTTGTAGG + Intronic
1173047188 20:39523804-39523826 AATGAGATGAAGAATGTTCTAGG - Intergenic
1176784607 21:13239849-13239871 TATAATATGAAAAATGTGGTTGG + Intergenic
1177306228 21:19320474-19320496 AATTAAATGCAGAATGTGGCTGG + Intergenic
1177982654 21:27933693-27933715 TATAATATGAAAAATGTGGTTGG + Intergenic
1178046618 21:28701797-28701819 AATTATATGAAGAATGTCATTGG - Intergenic
1179089652 21:38252908-38252930 AATCTTATGAAGATGGTGGTAGG - Intronic
1179907484 21:44431432-44431454 AATCAAATGAAGACTATGCTGGG - Intronic
1185095870 22:48805851-48805873 AATAACCTGAAGAGTGTAGTTGG + Intronic
949818589 3:8089952-8089974 AGTCACATGAAGAATGGAGGTGG + Intergenic
951134858 3:19093307-19093329 ATTCACATGAAGAATGGTGGAGG + Intergenic
954281710 3:49584633-49584655 AATAACTTAAAGAATGTGATTGG - Intronic
959039431 3:101404035-101404057 AATTCTATGAAGAATGTTGTTGG - Intronic
959879505 3:111427413-111427435 AATAATATGAAGAATGTTATTGG - Intronic
960226220 3:115172328-115172350 CATCACAGGGATAATGTGGTAGG + Intergenic
960677441 3:120209924-120209946 AAACAAATGAAGACTATGGTTGG + Intronic
960906441 3:122606459-122606481 AAACACAGGAAGAATGAGGAGGG + Intronic
961352965 3:126315744-126315766 AATCACTTCAAGAAGGAGGTGGG + Intergenic
961987796 3:131156425-131156447 AATGCCATTGAGAATGTGGTTGG + Intronic
962216970 3:133531097-133531119 AATCCCATGAGGAATTTGTTTGG - Intergenic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
964838858 3:160971759-160971781 AATAAAAAAAAGAATGTGGTAGG - Intronic
965244878 3:166254943-166254965 AATAACTTTAAGAATGTGATTGG + Intergenic
965677430 3:171212610-171212632 AATCAAATGATAAATGTGGGTGG - Intronic
967173190 3:186840105-186840127 AATCACACCAAGACTGTGCTGGG - Intergenic
967567593 3:190990053-190990075 AATTCCATGAAGAATGTTGTTGG + Intergenic
968725404 4:2245661-2245683 AATCTCAGCAAAAATGTGGTGGG + Intergenic
969160293 4:5251602-5251624 AATTCCATGAAGAATGTCATTGG + Intronic
969505587 4:7585245-7585267 TATCACAGGAAGAATGAGTTGGG + Intronic
970488029 4:16544075-16544097 AAACACATGTAGAATGTGTTTGG + Intronic
971270969 4:25144883-25144905 AGTTACATTAAGACTGTGGTGGG + Intronic
971523484 4:27585674-27585696 AATCAGACGATGAATGTGTTCGG + Intergenic
975108399 4:70595555-70595577 ACTTACATGAAAAAGGTGGTGGG + Intronic
975189424 4:71442577-71442599 AATCCCACAAGGAATGTGGTAGG + Intronic
975431863 4:74302522-74302544 AAATACATGAAGAATGTGTTAGG + Exonic
975943604 4:79677746-79677768 AATCAAATGGTGAATCTGGTGGG + Intergenic
977266239 4:94858704-94858726 AATCAAATGAAAAATGGGGCAGG + Intronic
978155285 4:105482821-105482843 AATGACATGAAGAATATATTTGG - Intergenic
978315816 4:107435783-107435805 AATTTCATGAAGAATGTAATTGG - Intergenic
978833771 4:113121867-113121889 ATGAACAAGAAGAATGTGGTGGG - Intronic
979186476 4:117801535-117801557 AAACACAAGAAGACTGTGATGGG + Intergenic
979603663 4:122614373-122614395 AATCACATGTGGAATGTTTTTGG + Intronic
979874390 4:125869173-125869195 AATTCCATGAAGAATGTCATTGG - Intergenic
980484885 4:133443461-133443483 ATTCACTTGAAGGATGTTGTAGG - Intergenic
981362087 4:143858716-143858738 AATGACATGAAGAATTTGCTTGG - Intergenic
981715396 4:147746906-147746928 AACCAGAAAAAGAATGTGGTGGG - Intronic
984027797 4:174565738-174565760 AATTTCATGAAGAATGTCATTGG - Intergenic
984710183 4:182878456-182878478 AATCTCAAAAAGAATGTGGCTGG - Intergenic
984967677 4:185154696-185154718 AATTCCATGAAGAATGATGTTGG - Intergenic
987481441 5:18463666-18463688 AATAACATGAAGAATGTAACTGG + Intergenic
987838397 5:23190628-23190650 AATCTCATGAAGAAAGTCATTGG - Intergenic
987890632 5:23872441-23872463 AGTTCCATGAAGAATGTTGTTGG - Intergenic
988364573 5:30279782-30279804 AATAACTTGAAGAATGTAATTGG - Intergenic
988409013 5:30862177-30862199 AATCTCATGAAGAAAATGTTGGG + Intergenic
988641695 5:33047800-33047822 AGTCACATGAAGAATTTGTATGG + Intergenic
988932696 5:36052521-36052543 ACTCAGATGAAGCATGGGGTTGG - Intronic
991107082 5:62856154-62856176 ATTTCCATGAAGAATGTCGTTGG + Intergenic
992462342 5:76972884-76972906 TATCACAGAAAGAATGTGGGTGG + Intronic
992528394 5:77632683-77632705 AACCACAGGAAGAAAGTGGTAGG - Intronic
993247130 5:85465420-85465442 AAGGACAAGAAGAAGGTGGTAGG - Intergenic
993317510 5:86429310-86429332 AATCATAAGTAGAATGTTGTTGG + Intergenic
993451584 5:88077495-88077517 AGTTACATGAAGAATGTCCTTGG - Intergenic
994473139 5:100235331-100235353 AGTTACGTGAAGAATGTTGTTGG + Intergenic
994845204 5:104980082-104980104 AGTAACATAAAGAATGTGATTGG - Intergenic
995328684 5:110921681-110921703 AATCACTTGATTAAGGTGGTGGG + Intergenic
996828794 5:127716719-127716741 AATCCTATGAAGAAGGAGGTGGG - Intergenic
997631646 5:135373295-135373317 AAAGACCTGAAGAGTGTGGTTGG + Intronic
997780870 5:136657061-136657083 CATTACATGAGGAATGTGCTTGG - Intergenic
997798400 5:136834500-136834522 AATCACTTGAAGAATCTGGGTGG + Intergenic
997800504 5:136856199-136856221 CACCACATGAAGAATGGGGAGGG + Intergenic
998721506 5:144956658-144956680 AATCATATTAAGTATGTGGTTGG - Intergenic
998791457 5:145770042-145770064 AAACACATGAGGAATGTATTGGG - Intronic
999579229 5:153016389-153016411 AATAACATAAAGTGTGTGGTGGG + Intergenic
1002691087 5:181051099-181051121 AAAAACAAGAAGAAGGTGGTAGG + Intronic
1006560269 6:34905157-34905179 CATCACATGATGAATCTGGCTGG + Intronic
1006978732 6:38128302-38128324 AATCACAGGAAGAATCTATTAGG - Intronic
1007010537 6:38413054-38413076 AATCAAAAGAAGAGTTTGGTAGG - Intronic
1007278484 6:40692908-40692930 AATCACAGGGAGAAGGTGATGGG + Intergenic
1007840039 6:44708611-44708633 AAAGACAGGAAGAATGAGGTAGG - Intergenic
1008901967 6:56630680-56630702 AATTACATGCAAAATGTGGGAGG + Intronic
1009498121 6:64375585-64375607 AAGCACCTGAAGACTCTGGTAGG - Intronic
1010076723 6:71806830-71806852 AATCACTTGCAGAATTTGTTAGG + Intergenic
1010158108 6:72819307-72819329 AATAACTTAAAGAATGTAGTTGG - Intronic
1011706139 6:90003281-90003303 AATCACAAGGAGGCTGTGGTGGG - Intronic
1011984477 6:93425718-93425740 AATCAAATAGAGAATGTGGCAGG - Intergenic
1012188850 6:96256028-96256050 AATGCCATGAAGAATGAGGGTGG - Intergenic
1012777697 6:103519317-103519339 TATAATATGAAGACTGTGGTGGG - Intergenic
1013277139 6:108596290-108596312 AATCACATGCAAAATGTCTTAGG - Intronic
1013518860 6:110914496-110914518 ACTCACATAAAGGGTGTGGTAGG + Intergenic
1014072530 6:117199740-117199762 TATCACAGGAGGAATGTGTTGGG - Intergenic
1014145610 6:117994741-117994763 ACTGACATGAATAATTTGGTGGG + Intronic
1015955512 6:138594121-138594143 GATCACATTAATTATGTGGTTGG + Intronic
1016182609 6:141165730-141165752 AATCACATGGAGAATGATTTTGG - Intergenic
1017400077 6:154050747-154050769 AATAACATAAAGAATGTAATTGG + Intronic
1021925023 7:25525998-25526020 ACTCTCAAGAGGAATGTGGTAGG + Intergenic
1022117522 7:27275360-27275382 AATCATATAAAGAATGTTGCCGG + Intergenic
1022895043 7:34741436-34741458 AATCCTAGGAAGAATGAGGTTGG - Intronic
1024370375 7:48576398-48576420 CTTCACATGGAGAATCTGGTAGG - Intronic
1024866764 7:53912095-53912117 ACACACATGGAGAAGGTGGTGGG - Intergenic
1025125700 7:56343020-56343042 AATCACTTGAACAATCTGGGAGG + Intergenic
1026580227 7:71609688-71609710 AATAACTTGAAGAATGTAATTGG - Intronic
1027526208 7:79271880-79271902 AATCCTTTGAAGACTGTGGTGGG - Intronic
1033172093 7:139093359-139093381 AATCACATAAAGGGTGTGGTAGG + Intronic
1034023030 7:147666378-147666400 ACACACATGAGTAATGTGGTGGG - Intronic
1035814519 8:2524939-2524961 GATCATATGAAGAATGTGTAAGG - Intergenic
1036121054 8:6018221-6018243 ATTCAGATGAAGAAAGTGGCAGG + Intergenic
1037191536 8:16132013-16132035 AATTACGTGAAGAATGTCATTGG + Intronic
1038245117 8:25848185-25848207 AATCACCAGAGGAATGTGGAGGG + Intronic
1039026269 8:33261638-33261660 AAATACATGAAGAGGGTGGTAGG - Intergenic
1042376681 8:68060169-68060191 AACCACATGTACCATGTGGTAGG - Intronic
1044028771 8:87208997-87209019 AATCTCATGAAATATGTAGTGGG + Intronic
1044203530 8:89464511-89464533 AATCACATGAGGCATGTATTAGG + Intergenic
1044558876 8:93593152-93593174 AATCACATGAAGCATGCAGTAGG + Intergenic
1046255313 8:111689363-111689385 AATTCCATGAAGAATGTCATTGG + Intergenic
1046759310 8:118004759-118004781 TATTACATGGAGAATGTGGGTGG - Intronic
1046824779 8:118675764-118675786 AATCACATGAAAAATGTCACTGG - Intergenic
1047828227 8:128602375-128602397 TATCACATTAAGAATGAGTTGGG - Intergenic
1050017203 9:1246552-1246574 AAACACAAGAAGAAACTGGTAGG + Intergenic
1050328774 9:4523975-4523997 AATCACATGAAGCATTTTGAAGG - Intronic
1050383000 9:5050735-5050757 AAACACAGGAAGAATGTCTTGGG + Exonic
1051008610 9:12381567-12381589 AATCACTTTAAGAAGGTGATTGG - Intergenic
1051336435 9:16070383-16070405 AATCATATGATGTGTGTGGTGGG + Intergenic
1051736923 9:20209813-20209835 AACCACATCAAGATTGTGCTTGG + Intergenic
1055981959 9:82012739-82012761 ATTCACATGAAGAATTCTGTAGG + Intergenic
1056111866 9:83404172-83404194 AATCGCTTGAAGAAAGGGGTAGG - Intronic
1057287466 9:93770647-93770669 AATCACATGAAGTATGTTCTGGG + Intergenic
1058167717 9:101638990-101639012 AATGAGATGACGAATGTGGAGGG - Intronic
1060454273 9:123776192-123776214 AACTACATGAAGTATGTGTTAGG - Intronic
1062480176 9:136747481-136747503 AAGGACATGAAGAACGTCGTGGG - Exonic
1186102353 X:6170425-6170447 AATCACCTGGAGAATGTAATAGG - Intronic
1186213724 X:7277031-7277053 AATCTCATGCTGAATGAGGTAGG + Intronic
1186219283 X:7332403-7332425 TATCACATGATGAATTTTGTTGG + Intronic
1186568599 X:10690985-10691007 AATCACAAGGAGACAGTGGTAGG - Intronic
1186729259 X:12391190-12391212 AATCACATGAATAAGGAGATGGG - Intronic
1189070893 X:37862726-37862748 AATCACAATAAGAATGTTTTTGG + Intronic
1189438959 X:41017480-41017502 AATCAAAGGAAGAATGTGGGAGG - Intergenic
1190225391 X:48540837-48540859 AACCACGTGAAGAAAGTGGGAGG + Intronic
1190590856 X:51999176-51999198 AATCACATTGATAATTTGGTAGG + Intergenic
1193089730 X:77481581-77481603 AATCACATGCAGGATATGATTGG + Intergenic
1193261526 X:79412188-79412210 ATTCACATGAAGGATGTGGTAGG - Intergenic
1193763476 X:85495497-85495519 AATCACCTGAATAGTGTGGCAGG - Intergenic
1194018107 X:88651717-88651739 AATCCCTTTAAGAATCTGGTAGG - Intergenic
1194184747 X:90762008-90762030 AATCAAATTAAGAAAGAGGTTGG - Intergenic
1195831516 X:109064357-109064379 AGTCATAGGAAGAATGTAGTAGG - Intergenic
1196991840 X:121337922-121337944 AATCAAATGAAGAATATTTTTGG + Intergenic
1197127913 X:122969836-122969858 AATCCCATGGAGAATCTGTTTGG + Intergenic
1200531352 Y:4344015-4344037 AATCAAATTAAGAAAGAGGTTGG - Intergenic
1201015943 Y:9601485-9601507 AATGACATAAAGAATTAGGTAGG - Intergenic