ID: 929481781

View in Genome Browser
Species Human (GRCh38)
Location 2:42315092-42315114
Sequence ATGGACAATATGAAGGTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 177}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929481781 Original CRISPR ATGGACAATATGAAGGTGTG AGG (reversed) Intronic
902410936 1:16211202-16211224 ATGGGGAAGATGAAGGAGTGAGG + Intronic
902750069 1:18502004-18502026 ATGGACAATATGTAAGTGAACGG + Intergenic
904334061 1:29785665-29785687 ATTGACAATGTGAGGGTATGAGG - Intergenic
905012779 1:34758547-34758569 ATTGACACCATGAACGTGTGAGG - Intronic
905408590 1:37753523-37753545 ATGGGGGATAGGAAGGTGTGAGG + Intronic
910089627 1:83446743-83446765 ATGGAGACTATAAAGCTGTGTGG + Intergenic
911925330 1:103822807-103822829 ATGGAGAGTATGAAGATGAGGGG + Intergenic
913443503 1:118925014-118925036 ATGGACAAAAAGATGGAGTGGGG + Intronic
916020767 1:160790328-160790350 ATGGGCAATAGGAGGGTGTTAGG - Intergenic
916140272 1:161691105-161691127 TTGGACAAAATGGAGATGTGTGG + Intergenic
917130490 1:171737113-171737135 GTGGATAATATGAAGTTCTGAGG + Intronic
917670647 1:177270480-177270502 ATGAACAAGATGATGGTGGGGGG + Intronic
917670845 1:177272005-177272027 ATGGTGAATATGAAAGTGTAAGG - Intronic
920757326 1:208745708-208745730 ATGGAGATTATGCATGTGTGGGG + Intergenic
920810089 1:209276934-209276956 ATGGACAATCTGTAGTTGTTTGG - Intergenic
920872157 1:209803849-209803871 GTTTACAATATGAAGTTGTGGGG + Intronic
920905646 1:210164525-210164547 TTTGTCAATATGAAGATGTGTGG + Intronic
921364388 1:214359978-214360000 ATGGACATGGTGAAGGTGAGGGG - Intronic
924279716 1:242424157-242424179 ATGGACAATAAGAGGGAGTAAGG - Intronic
924411898 1:243814868-243814890 AAGGACAATTAGGAGGTGTGTGG + Intronic
924570906 1:245236907-245236929 ATCTACAAAATGAAGGTGTTGGG - Intronic
1063402868 10:5764438-5764460 ATGAAGAATATGAAGATGCGTGG + Intergenic
1064294897 10:14070122-14070144 AGGGGCAATATGACAGTGTGGGG - Intronic
1068138747 10:52977538-52977560 ATGGAAAAAATGCATGTGTGAGG - Intergenic
1068150593 10:53125767-53125789 AAGGACAAGATGAAGGTGAATGG + Intergenic
1068377654 10:56205270-56205292 ATGGAAAATTTGAAGGTTAGTGG + Intergenic
1068470523 10:57456734-57456756 AAGAACAATTTGAAGGTGTGAGG + Intergenic
1068905408 10:62316663-62316685 ATGTACAAAATAAAAGTGTGAGG - Intergenic
1069811065 10:71160083-71160105 ATGGATCATATGGTGGTGTGAGG - Intergenic
1071474187 10:86011080-86011102 ATGGTCAAAATGAAAATGTGAGG + Intronic
1073192870 10:101664451-101664473 ATGGAAAATATGAGGGGATGTGG - Intronic
1074601583 10:114919162-114919184 ATGAACAATATGGAGGTATAGGG + Intergenic
1076007594 10:126960254-126960276 ATGGAGAAGATGCAGGTGTGAGG + Intronic
1079138377 11:17789637-17789659 ATGGACAATATGGATGTGTAAGG + Intronic
1079536590 11:21522548-21522570 ATGGAGACTCTGAAGGTGTGCGG + Intronic
1083274517 11:61589006-61589028 ATGGACAGTAATTAGGTGTGGGG - Intergenic
1084830826 11:71767898-71767920 ATTGCCATTATGAGGGTGTGGGG - Intergenic
1084977426 11:72809942-72809964 CTGATCAATATGAAGGTGTGAGG + Intergenic
1085910632 11:80821002-80821024 ATGGACATTTTGAAGGTCAGAGG - Intergenic
1087747841 11:101970307-101970329 TTGCACAATATTATGGTGTGAGG - Intronic
1088558425 11:111087096-111087118 ATGAAAAATATGAAAGTGTCTGG + Intergenic
1090945424 11:131425605-131425627 ACTGACACTATGCAGGTGTGGGG - Intronic
1092437119 12:8458217-8458239 ATGGACAACATGGATATGTGAGG - Intronic
1096591604 12:52663719-52663741 ATGGACAGTGGGAAAGTGTGTGG - Intergenic
1098153821 12:67576149-67576171 ATTGATAACATGAAGATGTGTGG + Intergenic
1099284195 12:80695349-80695371 ATGCACAATATGAAGATCTGGGG + Intergenic
1100449177 12:94688902-94688924 ATGGGTAATATGAGGGAGTGTGG - Intergenic
1101369891 12:104117236-104117258 ATGGACATTCTGAATGTGTCAGG - Exonic
1108039122 13:46322959-46322981 ATGGACATCATGAAGATTTGTGG + Intergenic
1108151624 13:47541804-47541826 ATGGAGAATATGAGGGAGGGAGG + Intergenic
1109339638 13:61039298-61039320 AAGGTCAATATGAAGGAGAGAGG + Intergenic
1110820382 13:79908605-79908627 ATAGACCATATTAAAGTGTGTGG + Intergenic
1112708151 13:102095926-102095948 ATGAACAACATGAAGGTTTGGGG - Intronic
1113961301 13:114127766-114127788 ATGGACAATACTAAGTGGTGAGG + Intronic
1114317762 14:21523757-21523779 ATGGCCAACATGGAGGTGAGAGG - Exonic
1116217040 14:42029873-42029895 ATGGACAATCTGTGGCTGTGTGG + Intergenic
1116231114 14:42218010-42218032 ATGTACAAAATGAAGGGGTATGG - Intergenic
1116525543 14:45899864-45899886 ATGGACAAAATGAAGGTGGGAGG + Intergenic
1116772206 14:49139963-49139985 AGGAACAATATTTAGGTGTGTGG - Intergenic
1117679297 14:58186906-58186928 ATGGCCACTGAGAAGGTGTGAGG + Intronic
1117933613 14:60875376-60875398 ATCCACAAAATGAAGGTGTTAGG + Intronic
1119532941 14:75375885-75375907 ATGGAAATTATGTAGGTCTGGGG - Intergenic
1121264125 14:92588141-92588163 ATGGCCAACATGATGGTATGAGG - Intronic
1121693886 14:95896863-95896885 ATGGAAAATATGGAGGGCTGTGG - Intergenic
1122476550 14:102013898-102013920 ATGGACTAGATGTGGGTGTGAGG + Intronic
1122676329 14:103417281-103417303 ACTGACCCTATGAAGGTGTGGGG + Intronic
1122910292 14:104824519-104824541 ATGGACAGTAGGATGGTGGGTGG + Intergenic
1126471503 15:49016371-49016393 ATGGACAATTTCAAGGCTTGCGG + Intronic
1129854268 15:78812338-78812360 TTGGACAATGAGGAGGTGTGCGG - Intronic
1131382002 15:91972097-91972119 ATTGACTATATAAAGGGGTGAGG + Intronic
1135687550 16:24510278-24510300 TTGGACAACATGAAGGTTTGGGG - Intergenic
1135688553 16:24517709-24517731 TTGGACAACATGAAGGTTTGGGG + Intergenic
1135903122 16:26484941-26484963 ATGAAAAATATGAAGATGAGTGG + Intergenic
1138550479 16:57745101-57745123 ATGGAGAATGGGAAGGAGTGGGG - Intronic
1140719625 16:77759473-77759495 ATGGACATAATAAAAGTGTGAGG + Intergenic
1144751091 17:17648515-17648537 ATTGACAATAAGAAGGTGGCTGG + Intergenic
1147643953 17:42022626-42022648 AAGGACAAGAAGGAGGTGTGTGG + Exonic
1150204280 17:63389974-63389996 AAGGACAGGATGAAGGTGTCTGG - Intronic
1155086010 18:22458644-22458666 ATGGAAAATAAGAAAGTGTTCGG - Intergenic
1155534617 18:26804255-26804277 AGGGAGAAAATGAAGGTGTCGGG + Intergenic
1158552896 18:58451834-58451856 AGGTACAAAATTAAGGTGTGTGG + Intergenic
1161394139 19:4035766-4035788 ATGGACTGTATGGATGTGTGTGG - Intronic
1163055892 19:14717474-14717496 AAGGAAAATTTTAAGGTGTGTGG - Intronic
928580622 2:32704101-32704123 ATGGCCAATATGAAAGTATTAGG - Intronic
929278048 2:40046571-40046593 GTGTACAATATGAATGAGTGAGG + Intergenic
929481781 2:42315092-42315114 ATGGACAATATGAAGGTGTGAGG - Intronic
929736201 2:44552567-44552589 ATGGAAAATATGGAGGTGAGTGG - Intronic
932319497 2:70811268-70811290 AAGGCCAAGATGAAGGTGTATGG - Intronic
932449124 2:71798522-71798544 GTGGTCACTATGAAGCTGTGCGG + Intergenic
935039150 2:99409479-99409501 GTGACCAATATGAAGATGTGTGG - Intronic
936054930 2:109255414-109255436 ATGATCAGTATGAAGGTCTGTGG + Intronic
937174020 2:119908301-119908323 ATGGTCAAATTGAAGGTTTGTGG + Intronic
938162753 2:129001169-129001191 ATGGCAAATATGAAGGAGTTGGG - Intergenic
938306215 2:130256991-130257013 ATGAACAACATGAAGCTTTGAGG - Intergenic
939025372 2:137006897-137006919 TTGGACACTATGAAACTGTGAGG + Intronic
939735303 2:145836662-145836684 AAACACAATATGAATGTGTGAGG + Intergenic
940364148 2:152827654-152827676 AAGGATAAAATGAAGGAGTGGGG + Intergenic
940894788 2:159070620-159070642 AAGGACAATTTGAAAATGTGAGG + Intronic
943546903 2:189292344-189292366 ATGGCCAATGTCAAGGTGTAAGG - Intergenic
944246485 2:197535591-197535613 AAGGCCAAGATGAAGGTGTGTGG + Exonic
944397667 2:199287563-199287585 AAGGATAATATGGAGGGGTGTGG + Intronic
945035722 2:205702491-205702513 ATGCAGAATATAACGGTGTGGGG - Intronic
945694530 2:213086458-213086480 GTGGACAAGATGAATGTGTGTGG + Intronic
947155604 2:227160078-227160100 ATAGTAAATACGAAGGTGTGAGG + Intronic
948064825 2:235069799-235069821 CTAAACAAAATGAAGGTGTGAGG + Intergenic
1170796960 20:19556165-19556187 ATCAACAATATGAAGGTATTGGG - Intronic
1171212008 20:23324445-23324467 ATGGAGAAGAAGAAGGTTTGTGG + Intergenic
1174965838 20:55213784-55213806 AAGGAAAATTTGAAGGGGTGGGG + Intergenic
1175686073 20:61029749-61029771 AAGGAGATTATGAAGGTGAGAGG - Intergenic
1177740875 21:25152091-25152113 ATGCATAATATCAAGGTGTTAGG + Intergenic
1182794143 22:32978142-32978164 GTGGAAAACATGAAGTTGTGAGG + Intronic
949523462 3:4878935-4878957 GGGGACACTTTGAAGGTGTGGGG - Intronic
951587907 3:24234085-24234107 AAGGAGAATTTGAAGGAGTGAGG - Intronic
951648383 3:24919903-24919925 AATGGCAAAATGAAGGTGTGTGG + Intergenic
951792249 3:26498971-26498993 ATGGACAACCTAAAGGTCTGGGG + Intergenic
952658505 3:35816784-35816806 ATGGGGAGTATGGAGGTGTGGGG - Intergenic
953406330 3:42661716-42661738 AAGGGCAATGTGAAGGGGTGAGG + Intronic
956501033 3:69885398-69885420 AAGGAAAATATTAAGGTCTGGGG + Intronic
959012401 3:101093336-101093358 ATAGACATTAGGAAGGTGGGAGG + Intergenic
961400843 3:126641356-126641378 ATGAACACTATGGAGATGTGAGG - Intronic
964494564 3:157274346-157274368 ATGGCCTATATCAAAGTGTGAGG + Intronic
964558945 3:157972429-157972451 ATTTACAATATGAAGTTCTGGGG + Intergenic
964780532 3:160332285-160332307 AGAGACAATGGGAAGGTGTGGGG + Intronic
968062707 3:195738510-195738532 ATGGCCACTATTAAAGTGTGGGG - Intronic
968731583 4:2271667-2271689 ATGGGGACTTTGAAGGTGTGTGG - Exonic
968876535 4:3270586-3270608 AAGGACAAGAGGAAGGAGTGAGG - Intronic
971481346 4:27117517-27117539 AAGGAGAATAGGAAGGTGGGTGG - Intergenic
973542036 4:51944549-51944571 ATAGACAATGGGAAGGTGTGGGG + Intergenic
979546721 4:121948781-121948803 AAGGACAACATTAAGTTGTGGGG - Intronic
980786064 4:137556748-137556770 ATGGACATTCTGAAGGTCTTCGG + Intergenic
983261504 4:165461637-165461659 ATGGACAATGTTCAGGAGTGAGG - Intronic
983444039 4:167825883-167825905 ATGGAGAAAAAGAAGGTGAGAGG + Intergenic
984351202 4:178596286-178596308 ATGTAGAATTTGAAAGTGTGTGG + Intergenic
987161406 5:15147843-15147865 ATACAAAATATGAAGATGTGTGG + Intergenic
988253618 5:28794527-28794549 ATGGAAAATATCAAGTTGTCAGG - Intergenic
989330751 5:40255077-40255099 ATGTACATTTTGAAGGAGTGGGG - Intergenic
990689491 5:58347541-58347563 ATGGGCAAAATGAATGTATGTGG - Intergenic
993133582 5:83929457-83929479 ATGAAAGATATGAAGGTCTGTGG - Intergenic
995802928 5:116019325-116019347 ATGGACAATATGTATGAGGGAGG - Intronic
998528951 5:142867749-142867771 ATGGACAACATGAAGGGAGGTGG + Intronic
1001144421 5:169171399-169171421 ATGGGCAAAATAAATGTGTGTGG + Intronic
1002835130 6:859512-859534 ATGGACAATTTGTAGGTATTGGG + Intergenic
1003604514 6:7547117-7547139 ATGGAGAAAATCAAGGGGTGAGG - Intronic
1003692303 6:8366678-8366700 ATGGCCTATGTGAAAGTGTGAGG + Intergenic
1004239232 6:13903503-13903525 CTGGGCAACGTGAAGGTGTGAGG + Intergenic
1004365919 6:15012613-15012635 ATGCACAATATTAAGAGGTGGGG + Intergenic
1006494553 6:34412743-34412765 GTGAACAATACGAAGGTGGGAGG - Intronic
1008748277 6:54700319-54700341 ATTGACAATATTAGGGTGTGTGG - Intergenic
1009047771 6:58249667-58249689 ATGAACCATATCAAGGGGTGGGG - Intergenic
1010697707 6:78997518-78997540 GTGGACAAATTGAAGGTGTACGG - Exonic
1012970569 6:105725710-105725732 AAGGTCATTATGAAGATGTGAGG + Intergenic
1013136606 6:107288722-107288744 CTGGACAATATGAAGATGCCGGG + Intronic
1013156109 6:107491578-107491600 ATGGAAAATAAGGAGGTGGGGGG - Intronic
1015296737 6:131603319-131603341 ATGGAGAATATATATGTGTGTGG - Intronic
1015675793 6:135746955-135746977 ATGGAAAATATGAAGGTGGAGGG - Intergenic
1016574220 6:145549882-145549904 ATGGAGAATATTGAGGTGTGTGG - Intronic
1016920159 6:149284912-149284934 GTGGGCATTAGGAAGGTGTGGGG - Intronic
1017950838 6:159133317-159133339 CTGGAGAAAATGAAGGTGTAAGG - Intergenic
1018583218 6:165326079-165326101 TTTGGCAAGATGAAGGTGTGAGG + Intergenic
1018715256 6:166527366-166527388 ATGGACAGTAGGACAGTGTGTGG + Intronic
1022202399 7:28129234-28129256 ATGGATATTATGCAGGTGTATGG + Intronic
1025745925 7:64242733-64242755 TTAGACAATATGCATGTGTGTGG + Intronic
1027306487 7:76903181-76903203 ATGGAGACTATAAAGCTGTGTGG + Intergenic
1028300079 7:89188081-89188103 ATTGACAAATTGAAGGTTTGTGG + Intronic
1028311746 7:89346951-89346973 ATGTAAAATAAGAATGTGTGTGG + Intergenic
1028529071 7:91818037-91818059 ATGGGCAATGTCATGGTGTGTGG - Intronic
1029263545 7:99320892-99320914 ATGGACAAGTACAAGGTGTGTGG - Intergenic
1029306616 7:99624428-99624450 ATGGACACAATGTAGGTGTTTGG - Intronic
1030109173 7:106011908-106011930 ATGAATAATATAAAGGTGTTAGG + Intronic
1030678957 7:112414170-112414192 ATCTACAAAATAAAGGTGTGAGG - Intergenic
1037429400 8:18793933-18793955 TAGCACAATATGAAGCTGTGGGG + Intronic
1038503217 8:28062740-28062762 ATGGGGAATATGAAGGTGACGGG - Intronic
1039532198 8:38272928-38272950 ATTGACGCTATGGAGGTGTGAGG + Exonic
1040549739 8:48428932-48428954 AAGGACAAGATGGAGTTGTGGGG - Intergenic
1040876435 8:52157260-52157282 ATGGAGAATCTGAAGGTGAGAGG + Intronic
1040893053 8:52337600-52337622 ATGAGCAGTGTGAAGGTGTGGGG + Intronic
1042472828 8:69210819-69210841 TTGGACAATATGATGCTCTGTGG + Intergenic
1043768698 8:84169606-84169628 ATGGACAACATGAGGTGGTGTGG + Intergenic
1043821831 8:84875961-84875983 ATGGAGAATCTGAAAGTGTGGGG + Intronic
1044502374 8:92973523-92973545 CAGGACAAAATGAAAGTGTGTGG - Intronic
1047096299 8:121629742-121629764 CTGGCCAATATCAAGGGGTGAGG - Intronic
1047127442 8:121977781-121977803 ATGGTAAATGTGAAGGTTTGTGG - Intergenic
1049471812 8:142778058-142778080 ATGAACATTATGATGGTGAGAGG - Exonic
1049644180 8:143728709-143728731 AAGGACCACATGAAGCTGTGGGG + Exonic
1051136788 9:13931910-13931932 ATGTACAAAATGAAAATGTGGGG + Intergenic
1056460322 9:86803415-86803437 GTGTACAATATGCATGTGTGTGG + Intergenic
1056792887 9:89637721-89637743 GTGGACAATAGGGAGGGGTGGGG - Intergenic
1057918281 9:99074408-99074430 ATAGGCAATAGGAAGGTGAGAGG - Intergenic
1058267560 9:102923639-102923661 ATGGAAAGTAGGAAGGTTTGAGG + Intergenic
1060092747 9:120758601-120758623 ATGGAAAAAATCCAGGTGTGTGG + Exonic
1060377212 9:123127282-123127304 ATGCACAATGCGAAGGTCTGAGG + Intronic
1062293560 9:135810874-135810896 CTGGCCAATATGAGGGTGTCAGG + Exonic
1187934344 X:24321313-24321335 AGGGGCCATATGAAGTTGTGAGG + Intergenic
1188457451 X:30382810-30382832 ATGGACACTAGGAAGGTTGGAGG - Intergenic
1189019358 X:37318391-37318413 TTGGACAAAATGAGGGTATGGGG - Intergenic
1196316852 X:114237038-114237060 ATGGAAGATTTGAAGGTGGGTGG - Intergenic
1198835592 X:140801775-140801797 AAAGACAATCTGAAGGTGAGGGG - Intergenic