ID: 929482067

View in Genome Browser
Species Human (GRCh38)
Location 2:42318842-42318864
Sequence GGCAAGGTGGCACACACCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5446
Summary {0: 2, 1: 24, 2: 406, 3: 1297, 4: 3717}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929482067_929482073 11 Left 929482067 2:42318842-42318864 CCATAGGTGTGTGCCACCTTGCC 0: 2
1: 24
2: 406
3: 1297
4: 3717
Right 929482073 2:42318876-42318898 TTTAATTTTTCATAGAGCTGAGG 0: 1
1: 13
2: 199
3: 2466
4: 17835
929482067_929482074 30 Left 929482067 2:42318842-42318864 CCATAGGTGTGTGCCACCTTGCC 0: 2
1: 24
2: 406
3: 1297
4: 3717
Right 929482074 2:42318895-42318917 GAGGTCTCCCTATGTTGTCCAGG 0: 21
1: 526
2: 4580
3: 18562
4: 62875

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929482067 Original CRISPR GGCAAGGTGGCACACACCTA TGG (reversed) Intronic
Too many off-targets to display for this crispr