ID: 929483744

View in Genome Browser
Species Human (GRCh38)
Location 2:42337148-42337170
Sequence GAATTTAAGCAATGGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 199}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929483744_929483748 -3 Left 929483744 2:42337148-42337170 CCATCCACCCATTGCTTAAATTC 0: 1
1: 0
2: 1
3: 24
4: 199
Right 929483748 2:42337168-42337190 TTCTAGAATCAACCTCCAAAAGG 0: 1
1: 0
2: 2
3: 14
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929483744 Original CRISPR GAATTTAAGCAATGGGTGGA TGG (reversed) Intronic
900541088 1:3203192-3203214 GAAGTTAGGCTATGGGTGGTGGG + Intronic
901366247 1:8751460-8751482 GAATTTAAGAGAAGGGTGGAAGG + Intronic
902405189 1:16178983-16179005 TAACTGAAGGAATGGGTGGATGG - Intergenic
902962628 1:19975659-19975681 GAAATTCAGCACTGGGTGGAAGG + Exonic
904667471 1:32134106-32134128 GTATTTAAAAAATGGGTGGTGGG + Intronic
905205118 1:36339082-36339104 AAATTTAAGCAAAGGAAGGAAGG + Intergenic
908516047 1:64893903-64893925 AAAATTTAGCAAGGGGTGGAAGG - Intronic
909145466 1:71924530-71924552 GACTTGAACAAATGGGTGGATGG - Intronic
910261801 1:85300119-85300141 GAATTAAAGGAGTTGGTGGATGG + Intergenic
913345790 1:117809957-117809979 GAATTCCACCACTGGGTGGAAGG + Intergenic
914815991 1:151062858-151062880 AGATTTAAGCAGTGGGTGGTTGG + Intronic
916589979 1:166180918-166180940 GAATTGAAGCCCTGGGAGGATGG - Intergenic
917728103 1:177846969-177846991 GATTTTAAGCAGTGTGTGGCTGG - Intergenic
919032464 1:192260582-192260604 GAATTAAACAAATGGCTGGAGGG + Intergenic
919972894 1:202592150-202592172 GAATTCAAACAGTGGGAGGAAGG + Exonic
920604079 1:207362973-207362995 GAATTTAAGCTATGTGAGAAGGG + Intergenic
921256812 1:213348914-213348936 GAATTGAATGAATGGGTGAATGG + Intergenic
922212306 1:223495579-223495601 GAATTTAGGCAGTGGCTGTAGGG - Intergenic
922822384 1:228493411-228493433 GAATTTCGGGAATGGGTGGGTGG + Intronic
923079145 1:230637225-230637247 GATTTCAGGGAATGGGTGGAGGG - Intergenic
1068485693 10:57655559-57655581 GAATTCAGGCAATGTCTGGAAGG + Intergenic
1068496177 10:57787747-57787769 GAATTTAAACAATGGGTCTTTGG - Intergenic
1069062032 10:63904256-63904278 GAATTAAAGTAATCTGTGGATGG + Intergenic
1070224768 10:74491463-74491485 GAATCTCAGTAATGGGTAGATGG - Intronic
1071978486 10:90978907-90978929 GAATTATAGCTGTGGGTGGAAGG - Intergenic
1074089202 10:110231441-110231463 GATTTTAAGGAATGGGGGAAAGG - Intronic
1075023663 10:118968468-118968490 GCATTTAAGGAATGGGTGGTGGG + Intergenic
1078193238 11:9110896-9110918 GAATTCAAGCAATGTGTTCAAGG - Intronic
1085022081 11:73216301-73216323 GAATTTAAGGATAGGGTGCAGGG + Intergenic
1086147154 11:83564613-83564635 GAATTTTATCAGTGGATGGAGGG - Intronic
1086506995 11:87515521-87515543 GAATTTATGCATTGGGTGGGGGG + Intergenic
1087782859 11:102319444-102319466 GAGTTGAAGCAATGAGGGGATGG + Intronic
1089312229 11:117566230-117566252 CAATTTATGCAGAGGGTGGAGGG - Intronic
1090457903 11:126865712-126865734 GAATTTAAGGAATGAGAGCAGGG + Intronic
1091590680 12:1841172-1841194 GCATTTCAGCACTGGGTGGTGGG + Intronic
1092339518 12:7663448-7663470 GGATTTGAGCATTGGGAGGAAGG + Intronic
1092932695 12:13331758-13331780 GGATTTAGACAATTGGTGGAGGG + Intergenic
1093180586 12:15962741-15962763 GAAAGTAAGCAAGGGGGGGAGGG - Intronic
1093918792 12:24836178-24836200 GAAGTTAAGGAATGTCTGGATGG + Intronic
1094034664 12:26055347-26055369 GAACTTAAAGTATGGGTGGATGG + Exonic
1094720655 12:33059705-33059727 GCTTTTAGGTAATGGGTGGAAGG - Intergenic
1094789171 12:33890915-33890937 GATTATAAGTAATGGGTGAAAGG - Intergenic
1096884211 12:54700237-54700259 GAATGAAAGCAGTGGATGGAGGG - Intergenic
1101553719 12:105786895-105786917 GAGTTTGAGGAATGGGTTGATGG + Intergenic
1102105300 12:110316315-110316337 GAAATTTAGGAATGGGGGGATGG - Intronic
1105292438 13:19061516-19061538 GGATGCAGGCAATGGGTGGAAGG - Intergenic
1106138222 13:26990393-26990415 GAATTGAAGCGATGTGGGGATGG - Intergenic
1106579407 13:31004687-31004709 GCATTTAAGAAATGAGTGGCTGG + Intergenic
1107014661 13:35698332-35698354 GCATTTAAGCGATGGAGGGAGGG + Intergenic
1107688277 13:42925986-42926008 GAATTTAAAGAATGGAAGGAAGG + Intronic
1108027422 13:46192654-46192676 GTAGTTGAGCAATGGGGGGAGGG + Intronic
1110070945 13:71176944-71176966 GAATGTAAGAAATGGGTTGCAGG + Intergenic
1111118015 13:83806530-83806552 GAATTGAAGCAATGTGTTAAAGG + Intergenic
1111514253 13:89307072-89307094 AAATTTAAGCAATAGGTCCAAGG + Intergenic
1113358738 13:109608855-109608877 GAATGTGTACAATGGGTGGAAGG + Intergenic
1117118658 14:52545266-52545288 GTATTTAAGCATTGGCTGTATGG - Intronic
1117474392 14:56079036-56079058 GAATGGAATGAATGGGTGGATGG + Intergenic
1118006220 14:61566283-61566305 AAATTGAAGCAAAGGGTGGTGGG - Intronic
1119440064 14:74622171-74622193 GAATTTTAGAAATGGGTGCTTGG - Intergenic
1119736217 14:76984482-76984504 TGCTTTAAGCAGTGGGTGGAGGG + Intergenic
1122815870 14:104313722-104313744 GAAATTAAGGAGTGGGTGCAGGG + Intergenic
1124391565 15:29263427-29263449 GAGCTCTAGCAATGGGTGGAGGG + Intronic
1124464527 15:29924895-29924917 GAATTTAAGCACTGGGACTATGG - Intronic
1126921672 15:53533455-53533477 TAATTTAAAGAATGGCTGGAGGG - Intronic
1128473208 15:67974173-67974195 GAATGGAAGCAAGGGATGGAGGG - Intergenic
1128712052 15:69879351-69879373 GAATGTAAGCAATGTTAGGAAGG - Intergenic
1129612579 15:77072240-77072262 GAATGTAAGCCATGGAAGGAAGG - Intronic
1129821105 15:78602575-78602597 TAATTAAAGAAATGGGAGGAAGG + Intronic
1130144047 15:81258977-81258999 GAATTTTAGGGATGGGTGTAGGG - Intronic
1130920220 15:88337686-88337708 GGAGTTAGGCAATGGGAGGAGGG + Intergenic
1131731753 15:95288873-95288895 GAATTCAAGGAGGGGGTGGATGG + Intergenic
1134246904 16:12546958-12546980 TAATTGGAGGAATGGGTGGATGG - Intronic
1138793872 16:59943599-59943621 GAATTTAAGCAAGGAGAGGAAGG + Intergenic
1140741637 16:77946951-77946973 GAATTAAAGTAAGGGGTTGAGGG - Intronic
1143319455 17:6058672-6058694 GAATTTAATCCATGGGCTGAGGG + Intronic
1146301515 17:31693273-31693295 GAAGTTAAGCAATGTGTCCAAGG - Intergenic
1148394458 17:47296930-47296952 CTATTTAAGCGAAGGGTGGATGG - Intronic
1148593627 17:48835166-48835188 GAATTTTATCACTGGGAGGAAGG + Intronic
1150538405 17:66070575-66070597 GAAGTTAAGGAATGCTTGGAAGG - Intronic
1151832363 17:76561477-76561499 GACTTAAAGCAATGGGGGCAGGG + Intergenic
1154050478 18:10951571-10951593 GAATTTAACCTATAGGTGGAAGG - Intronic
1155730281 18:29149202-29149224 GATTTTAAGCATTGGGTGACTGG - Intergenic
1157099816 18:44719340-44719362 GAATGTGTGCAAGGGGTGGAGGG + Intronic
1157752774 18:50194155-50194177 GAGGGTAAGCAATGGGTAGAGGG - Intronic
1158086308 18:53655687-53655709 TTATTTAGGCAATGTGTGGAGGG - Intergenic
1158097655 18:53792676-53792698 GAATTGAACAACTGGGTGGATGG - Intergenic
1160140282 18:76315291-76315313 GAATTTAACCAATGGGTAGGCGG + Intergenic
1160462853 18:79052553-79052575 GAAGTTGGGCTATGGGTGGATGG - Intergenic
1161850202 19:6734074-6734096 GATTTTAAGAGATGGATGGATGG + Intronic
1162633687 19:11949027-11949049 GAATGTAAGCAATATGGGGAAGG + Exonic
1164139857 19:22449596-22449618 GTATTTTAGCAATAGGAGGAAGG - Intronic
1164183620 19:22841792-22841814 GTATTTTAGCAATAGGAGGAAGG - Intergenic
1165778962 19:38421061-38421083 GACTGTGAGCTATGGGTGGAGGG - Intronic
929333697 2:40714329-40714351 GAATTTTATCAGGGGGTGGAGGG - Intergenic
929483744 2:42337148-42337170 GAATTTAAGCAATGGGTGGATGG - Intronic
932471910 2:71964861-71964883 GAAATCAAGCATTGGGTGGGAGG - Intergenic
935640116 2:105282214-105282236 GCATCTGAGCAATGGATGGAAGG - Intronic
936601490 2:113900505-113900527 AAATTAAAGGAATGGGTAGAGGG + Intronic
936956989 2:118032424-118032446 GAATATGAGTGATGGGTGGATGG + Intergenic
937004108 2:118495885-118495907 CAATTTAGGCAAAGGGTGAAGGG - Intergenic
938655955 2:133434073-133434095 GTATTTAAGCAATGAGTGTCTGG - Intronic
938747899 2:134297838-134297860 GAAGTTAAGTGATGGGTAGAAGG + Intronic
939483080 2:142773660-142773682 GAATTTATCCAATGGATGCAAGG - Intergenic
941441567 2:165544257-165544279 GAATTAAAGCAATGGCTGTCAGG + Intronic
943823561 2:192359375-192359397 GGATTTGAGCAAGGGCTGGATGG - Intergenic
944117720 2:196207228-196207250 GAATATAGGAAATGGGTAGAGGG + Intronic
944173348 2:196802759-196802781 GAATTTTAGAAATGTGTGTAGGG + Intergenic
944461717 2:199956379-199956401 TAAGTCAAGCAATGGCTGGAAGG - Intronic
945975496 2:216267265-216267287 GCATTTAAGAAATGGGTCTAGGG + Intronic
946482356 2:220069316-220069338 TAATTAAAGCAACGGGTGGAAGG - Intergenic
946767839 2:223056546-223056568 TTTTTTAAGCCATGGGTGGAAGG + Intronic
947304005 2:228723077-228723099 GAATTTAAGTAATGTGTACAGGG - Intergenic
1169479052 20:5961053-5961075 GAATTTAAGCCATTGGTGAAGGG + Intronic
1170460813 20:16574875-16574897 GAATTTGACCAACGGGTGGCAGG + Intergenic
1170586546 20:17739151-17739173 GAATTTCAACAATGTTTGGAGGG - Intergenic
1172242173 20:33420517-33420539 GAAGTTAGGCAAAGGGTGCAGGG - Intronic
1173209485 20:41021088-41021110 GAACTTAAGCAGTGTGTGTATGG - Intergenic
1174159901 20:48543276-48543298 GAAGTTCAGGAGTGGGTGGAGGG - Intergenic
1174438006 20:50525432-50525454 GAATTTAATAAATGTGTGAATGG - Intronic
1178101653 21:29275464-29275486 TAATTTAATCAATGGGGGAAAGG - Intronic
1178714595 21:34952274-34952296 TAATTTAGGTAATGGGTTGATGG + Intronic
1183796548 22:40123168-40123190 GATTTTAAGAAGTGAGTGGAGGG + Intronic
949279612 3:2330633-2330655 GAATCTAAGTAATTTGTGGAAGG + Intronic
949989326 3:9565123-9565145 GAATTTAGGCAATGAGTACATGG + Intergenic
950884013 3:16347162-16347184 GGATTTTTGCAATGGGTTGAAGG - Intronic
951388583 3:22073697-22073719 GAATTAAAGAAATGGGGGGTTGG + Intronic
952412436 3:33061728-33061750 GAAGTTAAGTTGTGGGTGGAAGG + Intronic
952873080 3:37919606-37919628 GAAGTTGAGGAATTGGTGGAAGG + Intronic
953416313 3:42720693-42720715 AGGTTTAAGCAAGGGGTGGAAGG + Intronic
954788307 3:53111698-53111720 GAATTTCAGAAATGGGAGGAGGG - Intronic
954933308 3:54303174-54303196 GATTCTAAGCTCTGGGTGGATGG + Intronic
955070651 3:55570154-55570176 GAATATAAGAAATGGGGGGTCGG - Intronic
956587508 3:70879861-70879883 GAATTGGAGCAAGGGGTGGAGGG + Intergenic
956877113 3:73474797-73474819 GAAATGAACCAAGGGGTGGATGG + Intronic
959289234 3:104451278-104451300 AAATTTAACCAATGAGTTGAAGG + Intergenic
959969219 3:112390016-112390038 AAATTAAAGCAAATGGTGGAAGG + Intergenic
963266017 3:143240777-143240799 GAATTAAAGCAATGGGGAGGGGG + Intergenic
965427440 3:168545101-168545123 GAATTTAGGCTATGGCTGAAGGG - Intergenic
965892503 3:173532001-173532023 AAATTGAAGCAATGAGTGAAAGG - Intronic
966494395 3:180562916-180562938 CAATTAAAGCACTGGGTAGAGGG + Intergenic
966515706 3:180818820-180818842 CAATCTAAGCAATGAGTGGATGG + Intronic
967517082 3:190382722-190382744 GGTTTTAAATAATGGGTGGATGG - Intronic
971010442 4:22428951-22428973 GAACTGAAGAAATGGGTGGAAGG + Intronic
975452032 4:74539606-74539628 GAGTTTAGGCAATGAGTTGATGG - Intergenic
976917952 4:90402084-90402106 GAATTATTGGAATGGGTGGAGGG + Intronic
978325853 4:107553434-107553456 GAATTTCAGCCATGGCTGGAAGG - Intergenic
978517521 4:109584604-109584626 CATTTAAAGCAATGTGTGGAGGG - Intronic
982655615 4:158145507-158145529 GAATTTTAGCAAAGGGTTGAGGG - Intronic
982760593 4:159278478-159278500 GAAATTTAGCAGTGGGTGGAAGG + Intronic
984672661 4:182509620-182509642 GAATTAAATCAATGAGGGGATGG + Intronic
984684917 4:182656537-182656559 AAATTTAAGTAGTGGGTGGTGGG - Intronic
984980444 4:185275277-185275299 GAATTTTAGTAATGGCTGAAAGG + Intronic
985771801 5:1816461-1816483 GAATTTAAGCACTGGTTTGAAGG + Exonic
987690231 5:21256997-21257019 GAATGAAAGCAATGTGTAGATGG - Intergenic
989800936 5:45538233-45538255 TAAATTAAGCAATGGGTTTAAGG + Intronic
994374843 5:99007660-99007682 GACTTCAAGAAATGGGTAGAGGG + Intergenic
995072781 5:107943394-107943416 GAAGTTAACCAAAAGGTGGATGG - Intronic
995359649 5:111280877-111280899 GAATATTAGCATTGGTTGGATGG + Intronic
996156866 5:120113027-120113049 CAATTTAGGCAATTGGTTGAAGG + Intergenic
996899579 5:128528993-128529015 TTACTTAAGCACTGGGTGGATGG + Intronic
997849426 5:137317477-137317499 GAGTTTCAGGAATGGATGGAGGG + Intronic
998875912 5:146599225-146599247 GGATTTAAGTGTTGGGTGGATGG - Intronic
999922746 5:156340402-156340424 GAATTGGAGCTATGGGTGGAAGG + Intronic
1000262193 5:159598685-159598707 GAGTTTAAGAGATGGGGGGAGGG - Intergenic
1000574150 5:162954936-162954958 GACTCTAAGCAAAGCGTGGAGGG + Intergenic
1001016532 5:168146757-168146779 GAGGTTAAGCAATGTGTGAAAGG + Intronic
1002805253 6:567395-567417 GAATATCAGCAATGGGTTGGAGG - Intronic
1002815381 6:675483-675505 GGTTTAAAGCAATGGGTTGATGG - Intronic
1002845561 6:941529-941551 GATTTTAATCAATGGTTGGCAGG + Intergenic
1004039159 6:11958950-11958972 TGGTTTGAGCAATGGGTGGATGG - Intergenic
1005268593 6:24139487-24139509 CAATTTCACGAATGGGTGGATGG + Intronic
1005749351 6:28868667-28868689 GAATGTAAGAAATGGGAGGCAGG - Intergenic
1006927486 6:37665202-37665224 GAGTTTAAGCACTGGGGGGCTGG - Intronic
1007224746 6:40305109-40305131 GGACTTGAGCAATGGGTGGAAGG + Intergenic
1007673040 6:43572487-43572509 AAATGTAAGGAATGGGTGGTTGG - Exonic
1007746604 6:44047063-44047085 GGTTTTAAGCAAGGGCTGGATGG - Intergenic
1007933441 6:45712745-45712767 GAATTTGAGTAATGGGTAGGGGG + Intergenic
1008853688 6:56055462-56055484 GAAAATGAGCAAAGGGTGGAGGG - Intergenic
1008865714 6:56207029-56207051 CATTTAAAGCAATGTGTGGAGGG + Intronic
1011061439 6:83274295-83274317 GAAGTTAAGCAGTGGATAGATGG + Intronic
1011771567 6:90679022-90679044 GAATTAGAGCAATAGGTGCATGG + Intergenic
1011974399 6:93276884-93276906 GAATTTAAACAAAGAATGGATGG + Intronic
1012778291 6:103524878-103524900 CATTTAAAGCAATGGGTAGAGGG + Intergenic
1013727699 6:113120006-113120028 TAATTTAAGCAATAGATGGAAGG - Intergenic
1014153527 6:118085809-118085831 AAATTTAAGCATTTGATGGATGG + Intronic
1016944716 6:149519136-149519158 GTATTTATTCAATGGGTGGATGG + Intronic
1018919944 6:168165409-168165431 AAATTTAATTAAAGGGTGGATGG + Intergenic
1020032168 7:4940737-4940759 GAAACTGAGCAAGGGGTGGAAGG + Intronic
1026326905 7:69318293-69318315 GAAATAAAGGAATGGGTGGAGGG - Intergenic
1027799447 7:82733604-82733626 GAATTTAAATATTTGGTGGAAGG - Intergenic
1029962293 7:104700718-104700740 GAATTTAAACAACTGATGGATGG - Intronic
1030379417 7:108795289-108795311 GAAAGTAAGCAAAGGGTGCAAGG - Intergenic
1031995371 7:128226915-128226937 AAAATGGAGCAATGGGTGGATGG - Intergenic
1034515271 7:151572076-151572098 GAATTTAAGAAATGGTTCTATGG + Intronic
1034543863 7:151777095-151777117 GGCTTTAAGGAAAGGGTGGAGGG + Intronic
1035612480 8:977705-977727 GAATTTTAGTAATGTGGGGAGGG + Intergenic
1039157507 8:34578300-34578322 GCATTTAAGGAGTGGGAGGAGGG - Intergenic
1044698344 8:94944971-94944993 CAGTTTTAGCAATGGGGGGAGGG - Intronic
1045678399 8:104633055-104633077 GAATTCAAGCACGGAGTGGATGG + Intronic
1047257800 8:123228921-123228943 GAGTTTAAGGAATGTGTGCAAGG + Intronic
1048548421 8:135408347-135408369 GAATTTAAGCAAAGGAAGGAGGG - Intergenic
1049536552 8:143185331-143185353 GATTTTGAGCAATGGGAGGGAGG - Intergenic
1049946396 9:600704-600726 GACTGCCAGCAATGGGTGGAGGG - Intronic
1050618706 9:7430010-7430032 GAATTTTAGCCATTGGTGGTGGG + Intergenic
1051260403 9:15258345-15258367 GACTTGAACAAATGGGTGGATGG + Intronic
1052480635 9:29020828-29020850 TAATTTGAGCAAAGGGTGGGGGG + Intergenic
1052521378 9:29551934-29551956 AAATTTAAGCAAGTTGTGGAAGG + Intergenic
1056898311 9:90572592-90572614 CAATTTGAACATTGGGTGGATGG + Intergenic
1058416434 9:104793759-104793781 GAATTTAAGGAATGGTTACATGG - Intronic
1060003564 9:119980308-119980330 GAATTGAAGGAATGGGTGCTAGG - Intergenic
1185864898 X:3614927-3614949 GAAGTTAAGCAATGTGTGGAAGG - Intronic
1186479722 X:9887247-9887269 GGATTTAAGGAATCGGTGCATGG + Intronic
1186587496 X:10891070-10891092 GAATCTAAGCAAAAGGTGGCAGG + Intergenic
1186895795 X:14003426-14003448 GAATTTCAGAAATGTGTTGAAGG - Intergenic
1186907014 X:14121577-14121599 GAATTTAAGCAAGGGTTTCAGGG + Intergenic
1190404706 X:50075211-50075233 GAATTTGAGCAATGGCAGGAAGG - Intronic
1193315793 X:80063697-80063719 CATTTTAAGCAATGTGTAGAGGG - Intergenic
1193338865 X:80322419-80322441 CATTTTAAGCAGTGGGTAGAGGG + Intergenic
1194763596 X:97823113-97823135 GAATTCAAGCACAAGGTGGATGG + Intergenic
1196122408 X:112065246-112065268 GAGTTTAAGGTATGTGTGGAGGG - Intronic
1196681686 X:118475994-118476016 GCATTTGAGCAAAGGCTGGAAGG + Intergenic
1196852220 X:119948103-119948125 GAATTTAAGGAGTGGGTGTTAGG + Intergenic
1197232846 X:124024570-124024592 TAATTTAAACAATGTATGGAAGG - Intronic
1198894118 X:141431728-141431750 GAGTTTAAGGAATTTGTGGATGG - Intergenic
1200799025 Y:7368823-7368845 GAAGTTAAGCAGTGTGTTGAAGG + Intergenic