ID: 929484059

View in Genome Browser
Species Human (GRCh38)
Location 2:42339267-42339289
Sequence TGGCACCACCAGGAGCTGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 273}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929484051_929484059 14 Left 929484051 2:42339230-42339252 CCAGGGAGGGCACTCAGGAAACC 0: 1
1: 0
2: 1
3: 20
4: 244
Right 929484059 2:42339267-42339289 TGGCACCACCAGGAGCTGAGGGG 0: 1
1: 0
2: 1
3: 35
4: 273
929484054_929484059 -7 Left 929484054 2:42339251-42339273 CCACAGACGCGGCCGTTGGCACC 0: 1
1: 0
2: 0
3: 2
4: 46
Right 929484059 2:42339267-42339289 TGGCACCACCAGGAGCTGAGGGG 0: 1
1: 0
2: 1
3: 35
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929484059 Original CRISPR TGGCACCACCAGGAGCTGAG GGG Intronic
900429933 1:2596679-2596701 TGGCCCCACCAGGCGCTGTTTGG - Exonic
900504052 1:3020436-3020458 GGCCACCAGCAGGAGCTGAGGGG + Intergenic
900742707 1:4340355-4340377 TGGCACCAGCTGGAGCTCAGTGG + Intergenic
901441648 1:9281816-9281838 TGACATTCCCAGGAGCTGAGAGG + Intergenic
902058151 1:13619274-13619296 TGCCACCCCCAGGAGATGACTGG + Intergenic
902870054 1:19308447-19308469 CGGCTGCACCAGGAGGTGAGGGG - Exonic
902979973 1:20115605-20115627 TGGCAGCACCTGGAGCAGACAGG + Exonic
903344159 1:22673672-22673694 TAGCCCGGCCAGGAGCTGAGCGG - Intergenic
904287543 1:29461900-29461922 TGGCTGCACCTGCAGCTGAGAGG + Intergenic
904577396 1:31513951-31513973 TGGCACAACCAGCTGCAGAGAGG - Intergenic
904684579 1:32251121-32251143 GGGGACCCCCAGGGGCTGAGAGG + Intergenic
905938097 1:41840720-41840742 TGGCACGGCCAGGATCTGATGGG - Intronic
906236453 1:44214062-44214084 TGACACCTCTAAGAGCTGAGAGG + Intronic
906773431 1:48506117-48506139 CAGCACCCCCAGTAGCTGAGAGG + Intergenic
907781989 1:57575111-57575133 AGGGAGCACCAGGAACTGAGTGG + Intronic
909301038 1:74013715-74013737 TTGACTCACCAGGAGCTGAGAGG - Intergenic
910126031 1:83843504-83843526 TGGCACCACCAGAGTCTGAATGG + Intergenic
912501758 1:110127249-110127271 TGGCACCAGCAGGAAGTGGGTGG + Intergenic
913238494 1:116806329-116806351 TGGCATCACCAGGTGCTCAGAGG + Intergenic
913496750 1:119434480-119434502 TGGCAGCACCAGTAGATGCGGGG + Intergenic
915100586 1:153496042-153496064 TGGCCCCAGCAGGTGCTGAATGG - Intergenic
915490675 1:156248434-156248456 AGGCAGCACCAGGTGCTAAGAGG - Intergenic
915730802 1:158052839-158052861 AGGCCTCACCAGAAGCTGAGTGG - Intronic
915895768 1:159809547-159809569 TTCCACCACAGGGAGCTGAGTGG - Exonic
921952656 1:220946553-220946575 TGATAGCACCAGGAGCAGAGTGG + Intergenic
922503415 1:226112662-226112684 TGACACCTCCAGGAGCCCAGTGG - Intergenic
922675465 1:227546611-227546633 GGGCACCCCCAGGGGGTGAGGGG + Intergenic
923980076 1:239311628-239311650 CTGCACTACCAGCAGCTGAGGGG + Intergenic
924227556 1:241934330-241934352 TGGCAGCACCAGGAGTTCGGAGG - Intergenic
924877632 1:248122656-248122678 TCCCACCACCATGAGGTGAGAGG - Intergenic
924879619 1:248145872-248145894 TCCCACCACCATGAGGTGAGAGG - Exonic
924882774 1:248180710-248180732 TCCCACCACCATGAGGTGAGAGG - Exonic
924884878 1:248203792-248203814 TCCCACCACCAAGAGGTGAGAGG - Exonic
924894698 1:248323822-248323844 TCCCACCACCATGAGGTGAGAGG + Exonic
1064000631 10:11661203-11661225 AGGCACCAGCAGGAGCAGGGGGG + Intergenic
1067531522 10:47077593-47077615 CGGCAACACCAGCAGCTGAGAGG - Intergenic
1069330389 10:67284932-67284954 TGCCACCCCCAGGGGGTGAGGGG - Intronic
1069595511 10:69667426-69667448 GGGAAGCACCAGAAGCTGAGTGG - Intergenic
1071549695 10:86557152-86557174 TGGCACCAGCAGGAGGTGACAGG - Intergenic
1074921781 10:118021702-118021724 TGGTATCACATGGAGCTGAGAGG - Intronic
1076814898 10:132909808-132909830 TGGCTCCATCTGGAGCTAAGTGG + Intronic
1076885064 10:133258424-133258446 TGGGGGCACCTGGAGCTGAGCGG + Intergenic
1077203176 11:1324010-1324032 AGGCACCTGCAGGAGATGAGCGG - Intergenic
1077506619 11:2932533-2932555 TGGTCCCACCTGGGGCTGAGCGG + Intergenic
1078403094 11:11045054-11045076 TGGCTCTACCAAGGGCTGAGGGG - Intergenic
1078810446 11:14756530-14756552 AGGCACCAGCAGGAGATGAAAGG - Intronic
1079100507 11:17538743-17538765 AGGCACAAGCAGGAGATGAGAGG + Intronic
1080583954 11:33665489-33665511 TGGGACAACCAGCAGCAGAGAGG - Intronic
1084570566 11:69957137-69957159 TGGAACCAGCAGCAGCTGAAGGG - Intergenic
1089304100 11:117516101-117516123 TGGAGCCCCCAGGAGCTCAGCGG - Intronic
1091753045 12:3034332-3034354 TGGTGCCACCCGGAGGTGAGAGG + Intronic
1094172245 12:27505723-27505745 TGACCCCACCAGGAGCTCTGCGG - Intergenic
1096069074 12:48764726-48764748 TGGCCGGACCAGGTGCTGAGAGG - Intergenic
1096542968 12:52318482-52318504 TCCCACCACCTGCAGCTGAGTGG - Intronic
1100690894 12:97037595-97037617 TGGAGCCACCAGGAGGTGAGGGG + Intergenic
1100805382 12:98277814-98277836 AGGGACCTCAAGGAGCTGAGAGG - Intergenic
1101641796 12:106591036-106591058 TGGCAGAACCAGGATTTGAGCGG + Intronic
1101967672 12:109292150-109292172 TTGCACCACCAGGCGCCGGGAGG - Intronic
1102566760 12:113802168-113802190 TGGCTCAACCATGAGCTGTGTGG + Intergenic
1102682323 12:114699001-114699023 TGGCAGCACCTGGGGCTGGGTGG + Intergenic
1103166114 12:118772152-118772174 TGGAGCCACCAGAAGCTGAAAGG + Intergenic
1103242271 12:119423496-119423518 AGGCACCATCAGGAACTGAAGGG + Intronic
1104504584 12:129319210-129319232 TGGCACCACAAGGATCTATGGGG - Intronic
1105444257 13:20438721-20438743 TGGCACCACCAGGTTGTCAGAGG - Intronic
1105641363 13:22268350-22268372 CGCCACCACCAGCAGCTAAGAGG - Intergenic
1106020737 13:25912823-25912845 TGGCACTACATGGTGCTGAGTGG + Intronic
1107401941 13:40077743-40077765 AGGCCCCAGGAGGAGCTGAGAGG - Intergenic
1108066649 13:46584597-46584619 AGGCTCCAACAGGAGCTGAGGGG - Intronic
1110810691 13:79808084-79808106 TGGGACAACCAGAAGCAGAGAGG + Intergenic
1112807651 13:103180754-103180776 TGTCAGCAGCAGGAACTGAGAGG + Intergenic
1113893527 13:113748988-113749010 AGGCACCAGCAGGAGATGAAGGG - Intergenic
1114148170 14:20002882-20002904 TGTTACCACCATGAGGTGAGAGG - Intergenic
1117195515 14:53336241-53336263 TGGCACCAGGGAGAGCTGAGAGG + Intergenic
1117323672 14:54648695-54648717 TGGGGCTACCAGGAGCTGTGTGG + Intronic
1118751044 14:68808161-68808183 TGGGCACACCCGGAGCTGAGCGG - Intergenic
1118819318 14:69334746-69334768 AGGCACCAGCAGGAGATGACGGG - Intronic
1118991813 14:70803538-70803560 TAGCACCACCAGCATCTGAGTGG - Intronic
1119159279 14:72439747-72439769 TGACACCAACAGGAGATCAGAGG + Intronic
1119168748 14:72516548-72516570 TGGCAGCAGCAAGAGCTGGGCGG + Intronic
1120444510 14:84577421-84577443 TGGCACCATCATGTGCTTAGAGG + Intergenic
1122995725 14:105262767-105262789 TGGCCCCAGGAGGAGCTGAGTGG + Intronic
1123092147 14:105746613-105746635 GGGCACCTCCTGGAGCTCAGGGG - Intergenic
1124055524 15:26237984-26238006 TGGCAGAAGCAGGAGGTGAGTGG + Intergenic
1124433014 15:29623264-29623286 TGGCACCCCCATGTCCTGAGTGG + Intergenic
1124633308 15:31349523-31349545 TGGCACCAGCTGGAGCAGACTGG - Intronic
1124696278 15:31867365-31867387 TGGCACCATCAGAAGGTCAGAGG + Intronic
1124696466 15:31868622-31868644 CGGCACCATCAGGAGGTCAGAGG + Intronic
1124937617 15:34187122-34187144 TGGGACCACCAGCTGCAGAGAGG + Intronic
1125548807 15:40528907-40528929 TGGCTCCAGCACGTGCTGAGTGG + Intronic
1126773832 15:52082733-52082755 TGGCTCCACCAGGAGGTGGGAGG - Intergenic
1126826924 15:52560782-52560804 TGGCATCACCAGGAGCAGAATGG - Intronic
1128067518 15:64774444-64774466 TGGAACCACCAGCAGCTGGGTGG - Intronic
1128684287 15:69672129-69672151 TGGCCCCATCAGGACCTGTGAGG - Intergenic
1129292885 15:74582045-74582067 TGGCATCTCCAGGAGAGGAGTGG - Intronic
1130195770 15:81779084-81779106 TGGCACAAGCAGGAGGTGAGTGG - Intergenic
1130732290 15:86509314-86509336 TGGCTCCATCAGCAGGTGAGGGG + Intronic
1131066637 15:89438916-89438938 TGCCAACACTAGGACCTGAGGGG + Intergenic
1131211855 15:90504405-90504427 TGGCACCACCAGCAGCAGCTGGG - Intergenic
1133035358 16:3031091-3031113 TGGCAGCCCGAGGAGCCGAGTGG - Exonic
1133210695 16:4261939-4261961 TGGGGTCCCCAGGAGCTGAGCGG - Exonic
1136107692 16:28042096-28042118 TCACATCACCAGGAGGTGAGAGG + Intronic
1137456630 16:48622835-48622857 GCGCAGCACCAGGAGCGGAGGGG - Intergenic
1139949035 16:70660376-70660398 TGGCCTCACCTGGAGCGGAGGGG + Exonic
1140794559 16:78425008-78425030 TGACACGGGCAGGAGCTGAGCGG - Exonic
1141513907 16:84530360-84530382 AGGCACTAGCAGGAGCTCAGAGG + Intronic
1141663661 16:85454682-85454704 CGGCACCGCCAGCAGCTGGGAGG - Intergenic
1143098715 17:4492864-4492886 TGGCAACAGCAAGAGCAGAGAGG + Intergenic
1143385306 17:6525981-6526003 ACTCACCACCAGGAGTTGAGTGG + Intronic
1145101787 17:20083221-20083243 TGGCCCCACCAGCAGCTGGCTGG - Intronic
1145912314 17:28549832-28549854 TGGCAACAAAAAGAGCTGAGAGG + Intronic
1146296258 17:31653073-31653095 AGGCCTCACCAGGAGCTGAGTGG - Intergenic
1146495508 17:33318687-33318709 GGGCACCTCCAGGATCTCAGGGG - Intronic
1148383953 17:47221346-47221368 TGGCAGCAGCAGGATGTGAGGGG - Intronic
1148889827 17:50799632-50799654 TGGCAGAGCCAGGAGCTGTGGGG + Intergenic
1149884701 17:60328311-60328333 TGGGACCACCAGGTGCAGAGAGG + Intronic
1151539823 17:74759193-74759215 TGGCGGCTCCAGGACCTGAGGGG - Intronic
1151773115 17:76177743-76177765 TGGGACCACCAGCTGCAGAGAGG + Intronic
1152108744 17:78345391-78345413 GGCCACCACCAGGAGCTGGCAGG + Intergenic
1152554760 17:81047259-81047281 GGGCTCCACCAAGAGCTGACAGG + Intronic
1152922423 17:83072739-83072761 TGGCACCACTGGGAGTAGAGTGG + Intergenic
1156791198 18:40976602-40976624 TGGCAACAGCAGCAGCTGTGGGG + Intergenic
1158502220 18:58012907-58012929 TGGCACCACCAGGAGCTTGTTGG + Intergenic
1160513753 18:79467128-79467150 TTGCACACCCAGGAGCCGAGAGG - Intronic
1162205195 19:9050469-9050491 TTTCACCAGCAGGAGCTAAGGGG + Intergenic
1162378889 19:10320768-10320790 TGCCACCTCCAGGGGCTGGGGGG + Exonic
1165027067 19:32969785-32969807 CGGCTCCCCCAGGAGCAGAGAGG + Intronic
1165124541 19:33584343-33584365 TGGCCTCAGCAGGAGGTGAGTGG - Intergenic
1165601821 19:37060398-37060420 TGCCACCGCCACGGGCTGAGGGG - Intronic
1167623069 19:50569334-50569356 TGGCTCCTCCAAGAGCTCAGTGG - Intergenic
925725139 2:6865082-6865104 TGGCACCACCGGGTGCAGCGGGG + Exonic
925853019 2:8101981-8102003 AGACACCACCAGGGACTGAGAGG - Intergenic
926111825 2:10188621-10188643 TGACCCCCTCAGGAGCTGAGAGG - Intronic
927047267 2:19291760-19291782 TGGCACCACCAGGAAATGGAGGG - Intergenic
927181628 2:20450615-20450637 GGGCTCCTCCAGGAGCAGAGGGG + Intergenic
927855096 2:26522915-26522937 TGGCCCCACGAGGGGCTGGGCGG + Intronic
927873549 2:26639732-26639754 TGCCACCACCAGACCCTGAGTGG + Intronic
929405036 2:41631727-41631749 AGGCCTCACCAGAAGCTGAGCGG + Intergenic
929484059 2:42339267-42339289 TGGCACCACCAGGAGCTGAGGGG + Intronic
930063652 2:47311132-47311154 TGGCAGGACCAGGAGGTGGGGGG + Intergenic
932737940 2:74268383-74268405 TGGCACCACAAGGACCTTAAGGG + Intronic
933665315 2:84960097-84960119 TGGAATCACCAGGAGGGGAGTGG - Intergenic
934166350 2:89297700-89297722 TAGGAGCCCCAGGAGCTGAGCGG + Intergenic
934200926 2:89884756-89884778 TAGGAGCCCCAGGAGCTGAGCGG - Intergenic
934550872 2:95260812-95260834 TGGGATCACCAGCAGCTGATTGG + Intergenic
934769796 2:96900436-96900458 AGGCACCGCCAGGTGCCGAGGGG + Intronic
934861394 2:97766174-97766196 AGGCAACACCAGTAGCTCAGAGG - Exonic
935090766 2:99892891-99892913 GGGCCCCACCACGAGCTGGGAGG - Intronic
935745826 2:106189538-106189560 TGGCCTGCCCAGGAGCTGAGCGG - Intronic
935822479 2:106908120-106908142 TGGAGCCACCAGAAGCTGAAAGG - Intergenic
938329794 2:130441534-130441556 TGGCACCACCTGCATCTCAGAGG - Intergenic
938360152 2:130679969-130679991 TGGCACCACCTGCATCTCAGAGG + Intergenic
938436555 2:131286676-131286698 TGGCACCACCTGCATCTCAGAGG + Intronic
938993583 2:136654536-136654558 TGGAAGCACCAGGAACAGAGAGG + Intergenic
940230360 2:151444971-151444993 AGCAACCACCAGAAGCTGAGAGG - Intronic
943631500 2:190257858-190257880 TGGTACCACTAAGAGGTGAGTGG - Intronic
945403857 2:209422550-209422572 AGGCACACCCAGGAGCTGGGAGG - Intergenic
945510451 2:210695077-210695099 AGGCACCAGCAGGAGATTAGAGG - Intergenic
946054226 2:216886933-216886955 AGTCACCAGCAGGAGCTGATGGG - Intergenic
946322092 2:218960170-218960192 TGGCACCGCCAGGGGCTTGGCGG - Exonic
946706293 2:222461784-222461806 AGGAACCAGCAGGAGATGAGTGG - Intronic
947010466 2:225560674-225560696 TGGCACAAGCAGGAGCTGGAAGG + Intronic
947202475 2:227626922-227626944 AGCCACCACCAGGAGGTGAGTGG + Intronic
948663343 2:239520065-239520087 AGGCACAATCAGGAGCTGGGAGG - Intergenic
948675687 2:239595270-239595292 TGGCAGCAACAGGTGCAGAGTGG + Intergenic
948857513 2:240736914-240736936 TGGCACCTGCAGGAGCTGTGCGG - Intronic
948902699 2:240964417-240964439 TGGCCCCACCAGGAGGTGCGGGG + Intronic
948962845 2:241354817-241354839 TGACACCACCAGGCCCAGAGTGG - Intergenic
1168995616 20:2130778-2130800 TGCAAGCACCCGGAGCTGAGGGG + Intronic
1169116876 20:3071859-3071881 TGAGAACTCCAGGAGCTGAGCGG + Intronic
1169395479 20:5225211-5225233 CAGCAACACCAGGAGCTGAAAGG + Intergenic
1169936745 20:10891813-10891835 GGGGACCACCATGAGCTGTGGGG + Intergenic
1170069514 20:12350213-12350235 TGTTATCACCAGGTGCTGAGTGG - Intergenic
1170673495 20:18457006-18457028 TCCCACCAGCAGTAGCTGAGGGG + Intronic
1171482925 20:25467601-25467623 TGGCAACAGCAGGGACTGAGAGG - Intronic
1171503163 20:25610398-25610420 TGTCAGCATTAGGAGCTGAGTGG - Intergenic
1173246876 20:41343042-41343064 TGTCACAACCTGGAGCTGCGGGG + Intronic
1173654263 20:44688975-44688997 TGGCAATTCCAGGAGCTGGGAGG + Intergenic
1173950824 20:46992032-46992054 TGCCACCAGTAGGAGCTGAGAGG + Intronic
1174090360 20:48042119-48042141 TGGCAGCACAAGATGCTGAGAGG - Intergenic
1177842691 21:26252253-26252275 TGGCCCCAGCAGGAGATCAGAGG - Intergenic
1179150460 21:38805164-38805186 TGGCGCCCTCTGGAGCTGAGCGG - Intergenic
1179358218 21:40681895-40681917 AGGCAACACCAGGTGCTGGGAGG + Intronic
1179600898 21:42476633-42476655 TGGCACTGACAGCAGCTGAGGGG - Intronic
1180178914 21:46109277-46109299 TGGCACGACCAGCTGCAGAGAGG - Intronic
1181397129 22:22630359-22630381 TGGCACCACCAGGACAGGTGGGG + Intergenic
1181499876 22:23309718-23309740 TGGCACCACCAGGACAGGTGGGG + Intronic
1181661555 22:24353989-24354011 AGGCCTCACCAGAAGCTGAGCGG - Intronic
1181705098 22:24645034-24645056 TGGCACCACCAGGACAGGTGGGG + Intergenic
1182539697 22:31032147-31032169 TGGCACCAACAGGGCTTGAGCGG - Intergenic
1183055721 22:35304345-35304367 GGGCAGCACCCGTAGCTGAGAGG + Intronic
1183376762 22:37469816-37469838 TGGCAAGCCCAGGATCTGAGTGG - Exonic
1183599618 22:38832364-38832386 CTGCCCCAGCAGGAGCTGAGTGG - Intronic
1183777136 22:39973691-39973713 TGGCAGCACCAGAGGCTGAGGGG - Exonic
1184352870 22:43955948-43955970 TGGCTCCAGCAGCGGCTGAGCGG - Intronic
1185284775 22:49995328-49995350 TGGGAACAGCAGGAGCTGGGTGG - Exonic
949113545 3:292687-292709 TGGCTTCCCCAGAAGCTGAGCGG - Intronic
950159160 3:10746490-10746512 GGGCACCTCCAGGGGCTCAGTGG - Intergenic
950700909 3:14745316-14745338 GGGCACCAGCAGGAGATCAGAGG - Intronic
951202646 3:19892020-19892042 TGGCACCACCAATAGCTCTGAGG - Intronic
952906342 3:38141389-38141411 TGGCATCTCCAGGAATTGAGAGG - Exonic
953569000 3:44056979-44057001 TGGCATCACCAAGTGCTGTGGGG - Intergenic
953662566 3:44901704-44901726 TGGCAGATCCAGGGGCTGAGGGG + Intronic
953696628 3:45164949-45164971 TGGCAGCACCAGAAGCTGTGGGG - Intergenic
953902386 3:46850568-46850590 TGGGACAACCAGGTGCTGTGAGG - Intergenic
954570715 3:51638494-51638516 TGGCACCCCCAGGAGTTATGTGG - Intronic
955935628 3:64099902-64099924 TGGCACCACCATCAGCAGAGAGG + Exonic
960913624 3:122675034-122675056 TGGCACCTCCAATAGCAGAGAGG + Intergenic
961452418 3:127008389-127008411 TGGAGTCACCAGGCGCTGAGTGG + Intronic
961635999 3:128333126-128333148 TGGCACAACCAGGAGCTTCCAGG + Intronic
961643931 3:128382386-128382408 CGGCACCAGCAGGAGCTGTGTGG + Intronic
961681861 3:128604700-128604722 TGGGACAACCAGAAGCTCAGGGG + Intergenic
961737408 3:129010714-129010736 GGGCACCATCTGGAGCTGGGAGG + Intronic
963106722 3:141653785-141653807 TGGCACCAACAGGAGGAGAAAGG - Intergenic
963237926 3:142973851-142973873 TGGCACCTCCAGGAGCTGCCAGG - Intronic
966008860 3:175051483-175051505 TGTGACCTCTAGGAGCTGAGAGG - Intronic
967432175 3:189398571-189398593 TGGCATCATCAGGAGATCAGAGG + Intergenic
968649687 4:1755610-1755632 TGGTACCGCCAGAAGCAGAGAGG + Intergenic
968849964 4:3072504-3072526 TGTCAATACCAGGAGGTGAGGGG + Intergenic
968964512 4:3763227-3763249 TGGCACGACCAGGAGGGGCGAGG - Intergenic
969474406 4:7412952-7412974 TGGGACCACCATGAGCCCAGGGG + Intronic
969672190 4:8595938-8595960 TGGGGCCACCAGGAGCCGGGAGG + Intronic
969837141 4:9851045-9851067 GGGCACCAGCAGGAGTTGGGTGG - Intronic
970446284 4:16125763-16125785 TGGAACCACCCAGAGGTGAGAGG - Intergenic
971362166 4:25948153-25948175 GGTCATCACCAGGGGCTGAGGGG - Intergenic
972161929 4:36237641-36237663 AGGCCTCACCAGAAGCTGAGTGG + Intronic
977666093 4:99649281-99649303 TGGCACCACCATGAGCTTTGTGG - Exonic
979841829 4:125451477-125451499 AGGCACTACCTGTAGCTGAGGGG - Exonic
980941789 4:139281405-139281427 TGCCACCACCAGGTGGTGGGTGG + Intronic
980977495 4:139625072-139625094 TGAAACCAGCAGCAGCTGAGAGG - Intergenic
983214590 4:164991405-164991427 TGGCATCTCCAGGAGCTATGTGG - Intergenic
983651497 4:170040727-170040749 TGGGACCACCAGCTGCAGAGAGG + Intergenic
983963568 4:173783389-173783411 TGCCATCACCATGAGTTGAGGGG + Intergenic
984096147 4:175437317-175437339 TGGCACGAGGAGGAGGTGAGGGG - Intergenic
985702830 5:1383811-1383833 TGTCACCAACAGGAGGTGGGGGG + Intergenic
986329958 5:6710779-6710801 CAGCAACACCAGAAGCTGAGAGG + Intergenic
989316265 5:40082471-40082493 TTGCACCTTCAGGAACTGAGTGG + Intergenic
990407924 5:55510675-55510697 TGGTTCCACCAGTAGCTGAATGG - Intronic
992396780 5:76375816-76375838 TGCCTCCACCAGTAGCTGAGTGG + Intergenic
995573076 5:113502460-113502482 TGGACCCACCTGGGGCTGAGTGG - Intergenic
995744952 5:115393602-115393624 TGGGACCACCAGCTGCAGAGAGG - Intergenic
995773653 5:115700668-115700690 TGGGGCCACCAAGAGCTGTGGGG + Intergenic
998119114 5:139561608-139561630 CGGCAGGCCCAGGAGCTGAGTGG + Exonic
998348743 5:141486993-141487015 TGGGGCCTCCAGGAGCTGATAGG - Exonic
998395812 5:141817076-141817098 TGGGAGCCCCAGGTGCTGAGTGG - Intergenic
998454257 5:142258736-142258758 TGGGACCACTAGAAGCTGAAAGG + Intergenic
1000586092 5:163100744-163100766 AGGCACAACCAGGAGCAGAGGGG - Intergenic
1001539774 5:172529693-172529715 TGGCACCTCCAGCAGCTCAGTGG - Intergenic
1001649031 5:173302245-173302267 TGGCTACACCAGGAGGTGGGCGG + Intergenic
1001751228 5:174133160-174133182 TGGCACAACCAGGACCTGGGAGG - Intronic
1001838434 5:174852563-174852585 TAGAAAGACCAGGAGCTGAGTGG + Intergenic
1006296410 6:33171953-33171975 TGATACCACCAGGGGCTGTGGGG - Intronic
1006405730 6:33843701-33843723 AGGCACCAGCAGGAGATCAGAGG + Intergenic
1006412700 6:33884442-33884464 TGCCACCACCAGGATCTTAGGGG - Intergenic
1007649996 6:43413332-43413354 GGGGACAACCAGGAGCAGAGAGG + Intergenic
1010504574 6:76641470-76641492 AGGCACCAGCAGGAGATAAGAGG - Intergenic
1013290524 6:108715424-108715446 TGGCATCTCCAGAAGCTCAGGGG - Intergenic
1013372442 6:109482930-109482952 TGGGACCACCCGGGGCTGCGGGG - Intronic
1013714703 6:112944983-112945005 TGACACCACCAGAAGCTGGAAGG + Intergenic
1014282143 6:119453411-119453433 AGGCAGCACAGGGAGCTGAGCGG + Intergenic
1016988982 6:149916511-149916533 TGGCCCTGCCAGGAGCAGAGTGG - Intergenic
1017046691 6:150353074-150353096 TGGCAGCACAAGGAACTGGGTGG - Intergenic
1017177471 6:151518311-151518333 AGGCAGCTCCAGGGGCTGAGGGG + Intronic
1018833319 6:167463036-167463058 GGCCACCACCAGAAGCTGGGAGG - Intergenic
1020126735 7:5536970-5536992 GGGCACAGCCAGGAGCTGAAGGG + Intronic
1023764597 7:43498704-43498726 TGGCATCACCAGAACCTGGGGGG - Intronic
1026352279 7:69527762-69527784 TGGCAGCACAAGGAGCTCTGTGG - Intergenic
1026610262 7:71852386-71852408 TAGCACTTCCAGGAGCTAAGTGG + Intronic
1027603188 7:80265398-80265420 AAGCACCAGCAGGAGATGAGAGG - Intergenic
1028616116 7:92768879-92768901 GGAGACCACCAGGAGCTGAGAGG + Intronic
1029472747 7:100764966-100764988 GGGCCACACCAGGAGCTGGGAGG - Intronic
1030285965 7:107827233-107827255 TAGCACCATCAGGACCAGAGGGG - Intergenic
1033078115 7:138268312-138268334 TGGCACCAGCAGGGGTTAAGTGG + Intergenic
1033089472 7:138371753-138371775 TGGCACCAGCAGGGATTGAGGGG + Intergenic
1033204448 7:139405696-139405718 TGGAACAACTAGGAGCTGAAGGG + Exonic
1034338500 7:150338302-150338324 GTGCAACACAAGGAGCTGAGAGG + Intronic
1034557551 7:151859672-151859694 TGGCGCCATCAGAAGCTGAGTGG + Intronic
1035249571 7:157588101-157588123 TGTCACCATCAGGTGCGGAGTGG - Intronic
1035734424 8:1877682-1877704 TGGCACCACCGAGACCTGGGAGG - Intronic
1037965096 8:23127962-23127984 TGGCTGCAGCAGGAGCTCAGAGG - Intergenic
1038131434 8:24736356-24736378 TGGCAACACCAGCAGCAGAGAGG + Intergenic
1040482512 8:47839428-47839450 TGCTCCCAGCAGGAGCTGAGTGG + Intronic
1040590614 8:48789148-48789170 TGGCCCCTCCAGGAGCGGGGTGG + Intergenic
1043175208 8:77016554-77016576 TAGCACCACCTGGAGATGTGTGG - Intergenic
1046575122 8:116018502-116018524 TGCCACCACCAGAAGCTAGGAGG + Intergenic
1046633000 8:116640487-116640509 TGGAACCATCATGAGTTGAGAGG - Intergenic
1046967227 8:120181126-120181148 TGGCCACACCAGGAGCTGCAAGG + Intronic
1047224883 8:122947839-122947861 TGGCACCACCAAGACCTGGCAGG - Intronic
1047315178 8:123726538-123726560 TGGAACCTTCAGGAGCTGATTGG - Intronic
1047745214 8:127839916-127839938 AGGCACCAGCAGGAGGTCAGAGG - Intergenic
1048461108 8:134622729-134622751 AGGCACCAGCAGGAGATGAAAGG + Intronic
1050223987 9:3429588-3429610 TAGCACCTCCAGGAGCCTAGAGG - Intronic
1051789246 9:20781772-20781794 TGGCATCACTAGCAGCAGAGAGG - Exonic
1052991429 9:34521293-34521315 TGGCTCCAATAGGAGCTCAGTGG - Exonic
1053433693 9:38060935-38060957 GGCCACCATCAGGAGCTGTGTGG - Intronic
1057702543 9:97374359-97374381 TGTCACCACCCCGAGCTGTGTGG + Intronic
1060108259 9:120888358-120888380 TGGCAGCTCGAAGAGCTGAGAGG + Intronic
1060515945 9:124265923-124265945 TGTCCCCACCAGGTGGTGAGAGG - Intronic
1061589130 9:131587597-131587619 GGGAACCCCCAGGAGCTTAGCGG + Intronic
1061669890 9:132182776-132182798 TGACCCCACCAGGAGCGGAGCGG + Intronic
1062046014 9:134424893-134424915 TGGCACCTGCCGGAGCTGGGCGG - Intronic
1062173163 9:135146544-135146566 AGGAACCACCAGGAGCTGGAGGG - Intergenic
1062560168 9:137138076-137138098 AGGGACCCCCTGGAGCTGAGAGG - Intergenic
1203585801 Un_KI270747v1:2340-2362 TAGGAGCCCCAGGAGCTGAGTGG + Intergenic
1187390690 X:18884841-18884863 TGTCACCACCAGGAGCTCAGGGG - Intergenic
1189083608 X:37997940-37997962 TGGGACCACCAGCTGCAGAGAGG + Intronic
1190394175 X:49963000-49963022 TGACTCCAGAAGGAGCTGAGAGG + Intronic
1190528703 X:51353421-51353443 TGGCACCACCAGGCTATCAGCGG - Intergenic
1194183090 X:90737548-90737570 TGGCACCAGCAGGAGAATAGTGG - Intergenic
1195966459 X:110434204-110434226 TGGCAGCAGCAGGAGGGGAGTGG + Intronic
1200529707 Y:4319503-4319525 TGGCACCAGCAGGAGACTAGTGG - Intergenic