ID: 929484142

View in Genome Browser
Species Human (GRCh38)
Location 2:42339750-42339772
Sequence GCCTGTGACCCGCTCCTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 4, 3: 13, 4: 95}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929484141_929484142 -6 Left 929484141 2:42339733-42339755 CCAGCACTCAGAAGTCGGCCTGT 0: 1
1: 0
2: 0
3: 9
4: 96
Right 929484142 2:42339750-42339772 GCCTGTGACCCGCTCCTGTCAGG 0: 1
1: 0
2: 4
3: 13
4: 95
929484136_929484142 20 Left 929484136 2:42339707-42339729 CCCCTGGAGGAAGACCTGGGATG 0: 1
1: 0
2: 0
3: 19
4: 218
Right 929484142 2:42339750-42339772 GCCTGTGACCCGCTCCTGTCAGG 0: 1
1: 0
2: 4
3: 13
4: 95
929484139_929484142 6 Left 929484139 2:42339721-42339743 CCTGGGATGCTGCCAGCACTCAG 0: 1
1: 1
2: 5
3: 37
4: 336
Right 929484142 2:42339750-42339772 GCCTGTGACCCGCTCCTGTCAGG 0: 1
1: 0
2: 4
3: 13
4: 95
929484134_929484142 23 Left 929484134 2:42339704-42339726 CCACCCCTGGAGGAAGACCTGGG 0: 1
1: 1
2: 0
3: 28
4: 265
Right 929484142 2:42339750-42339772 GCCTGTGACCCGCTCCTGTCAGG 0: 1
1: 0
2: 4
3: 13
4: 95
929484137_929484142 19 Left 929484137 2:42339708-42339730 CCCTGGAGGAAGACCTGGGATGC 0: 1
1: 0
2: 0
3: 13
4: 224
Right 929484142 2:42339750-42339772 GCCTGTGACCCGCTCCTGTCAGG 0: 1
1: 0
2: 4
3: 13
4: 95
929484138_929484142 18 Left 929484138 2:42339709-42339731 CCTGGAGGAAGACCTGGGATGCT 0: 1
1: 3
2: 1
3: 20
4: 240
Right 929484142 2:42339750-42339772 GCCTGTGACCCGCTCCTGTCAGG 0: 1
1: 0
2: 4
3: 13
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929484142 Original CRISPR GCCTGTGACCCGCTCCTGTC AGG Intronic
900428665 1:2592037-2592059 GCCTGAGCTCAGCTCCTGTCTGG - Intronic
900633230 1:3649730-3649752 TCCTGGGTCCCGCACCTGTCTGG + Intronic
900633246 1:3649790-3649812 GCCCGGGCCCCGCACCTGTCCGG + Intronic
900800357 1:4733350-4733372 TCCTGTGACCTGCTTCTGTTGGG - Intronic
901237557 1:7675630-7675652 ACCTGAGACCCGCTCCTGCTGGG - Intronic
902984435 1:20146946-20146968 GACTGTGACCAGCACCTCTCAGG - Intronic
903945572 1:26960255-26960277 GCCCGGGACCCTCTCCTGTCCGG + Intronic
903986880 1:27234944-27234966 GGCGGTGACCCGTACCTGTCAGG - Exonic
904305095 1:29583650-29583672 ACAGGTGACCAGCTCCTGTCAGG + Intergenic
906477739 1:46181197-46181219 GCTTGTGACCTGCTCCTATAGGG - Intronic
907812335 1:57883749-57883771 GCCTTTGTCCCCCTCCTGTGTGG - Intronic
919922031 1:202171713-202171735 GCCTGGGGCCCGCTACTGTGTGG + Intergenic
921163717 1:212491063-212491085 GCCTCTGCCCGGCTCCTGGCTGG + Intergenic
922856292 1:228777791-228777813 CCCTGTGACTCTCTCCTGTGTGG - Intergenic
1067473493 10:46551917-46551939 GCCTGTGGCCTGCTCCCCTCTGG + Intronic
1069325876 10:67230992-67231014 GACTGTGTCCCGCACCTGGCTGG + Intronic
1073379811 10:103069535-103069557 GCCTGTGGCCGGCTCTTGTCTGG + Intronic
1076988175 11:254202-254224 GGCTGTGATCAGCTCATGTCTGG - Intergenic
1077243298 11:1523252-1523274 GGCTGTGAACCGCTCCTGGCCGG + Intergenic
1077324904 11:1959483-1959505 TCCCGTGACCCGCTCCTGCCTGG + Intronic
1082879548 11:58024663-58024685 CCGTGTGACCCTCTCCTCTCTGG + Intronic
1084460847 11:69295795-69295817 GGCTGAGCCCCGCACCTGTCTGG - Exonic
1085740679 11:79075909-79075931 GCTTGTGACCCGCTCCTCTCTGG - Intronic
1089630390 11:119780551-119780573 GCATGTCACCTGCTGCTGTCAGG + Intergenic
1202807886 11_KI270721v1_random:14662-14684 TCCCGTGACCCGCTCCTGCCTGG + Intergenic
1091705378 12:2689956-2689978 GCCTGGCACTCGCTCCTTTCAGG - Intronic
1098021522 12:66160995-66161017 GCCTCTGACCCGCCGCTGCCCGG - Intronic
1105247400 13:18665940-18665962 CCCTGTGACCTGCTCCTGGCCGG - Intergenic
1105541333 13:21319761-21319783 GCCTGTGGCCCGCACCTGGCAGG - Intergenic
1107056134 13:36105890-36105912 GCCTGTGAGCCTTTTCTGTCTGG - Intronic
1107727662 13:43316156-43316178 GCATGTTCCCAGCTCCTGTCAGG - Intronic
1110142306 13:72145488-72145510 GTCTATGATCTGCTCCTGTCTGG - Intergenic
1112365642 13:98752825-98752847 GCCTGCCACGCGCTCCCGTCGGG - Intergenic
1113518387 13:110920341-110920363 GCCACTGACCGGCTCCTGGCTGG + Intergenic
1114728502 14:24965161-24965183 GTCTGTGTCCCACTCCTGACAGG - Intronic
1122937760 14:104967812-104967834 GCCTCGGACCCGCGCCAGTCGGG + Intronic
1129744353 15:78007810-78007832 CTCTGTGCCCAGCTCCTGTCCGG - Intronic
1132751170 16:1458405-1458427 GCCTGTCACCCGCGCCAGGCTGG - Intronic
1133130441 16:3673380-3673402 CGCTGGGACCAGCTCCTGTCTGG + Intronic
1140225900 16:73076757-73076779 GCCTGAGAACCGATCCTGTCAGG + Intergenic
1141441695 16:84033448-84033470 GTGTGTGACTCCCTCCTGTCTGG - Exonic
1144822957 17:18088246-18088268 GCGTGAGACCCGCTCCCGCCTGG - Intronic
1149546552 17:57508184-57508206 GCCTGTGGCCCGCTATTGGCTGG + Intronic
1152072807 17:78142369-78142391 ACCAGTGACCAGCTCCTGGCTGG + Exonic
1154441444 18:14393182-14393204 CCCTGTGACCCGCTCCTGGCCGG + Intergenic
1160922044 19:1525548-1525570 GCCTGTGCCCCGCTGCAGGCGGG + Intronic
1161531492 19:4792570-4792592 CCCTGCGACCTGCTCCTGGCCGG - Exonic
1165065807 19:33227050-33227072 GCCAGGGACCCGCCCCTGCCAGG - Intergenic
1167395735 19:49227266-49227288 GCCTGTGACCTGTTTCTGTGTGG + Intergenic
1168121971 19:54256693-54256715 GCCCGTGACCCTCTGGTGTCAGG - Exonic
1168128085 19:54298311-54298333 GCCTGTGACCACCTGGTGTCAGG - Intergenic
1168132657 19:54331354-54331376 GCCTGTGACCCTCTGGTGTCAGG - Intergenic
925194659 2:1913387-1913409 TCCTGTGACCCCCTCCAGCCAGG - Intronic
925413826 2:3655935-3655957 GCCTGTTGCCCGCTCCGGTGGGG + Intergenic
928378510 2:30798638-30798660 GCCTGCGGCCCTCTCCTGGCTGG + Intronic
929484142 2:42339750-42339772 GCCTGTGACCCGCTCCTGTCAGG + Intronic
934655044 2:96113001-96113023 GACTGTGACCCTCTGCTGGCCGG - Exonic
936506968 2:113115746-113115768 GCCTGTCTCCCTCTCCTCTCAGG - Intronic
938132989 2:128733147-128733169 GCCTGTGAACAGCTTCTGTTGGG + Intergenic
938310707 2:130286677-130286699 GGCTGTGGTCCTCTCCTGTCGGG - Intergenic
942318109 2:174712973-174712995 GCCTGTGACAGGCTCCTGGCTGG - Intergenic
946043738 2:216803960-216803982 GCCTGTGACCCGCTGCTCTCAGG + Intergenic
1169046577 20:2538156-2538178 TCCTGTGACCCGCTGCTGTCTGG + Intronic
1173405185 20:42758329-42758351 ACCTGTGCCCCTCTCCTGACAGG - Intronic
1178518179 21:33266267-33266289 GCCTGTGCCCCGCGCCTCGCGGG + Intronic
1181043801 22:20205229-20205251 GCCTGTGACCCCGTCCTGAGTGG - Intergenic
1181934770 22:26430143-26430165 GCCTGTCACCCTCTCCACTCAGG - Intronic
1182049909 22:27304760-27304782 GCCTGTGACAGGCTCCTGAAAGG - Intergenic
1182767857 22:32771598-32771620 TCCTGTGACCCTCCCCTGTGAGG - Intronic
1183279490 22:36924327-36924349 GCCTGAGACACGATGCTGTCTGG + Intronic
1183617781 22:38955613-38955635 GACTGTTCCCCGCTCATGTCTGG + Intronic
1183840754 22:40498737-40498759 GCCTGTGGCCTGCTCCTGAGAGG - Intronic
1185087153 22:48747015-48747037 GCCTGTGAACCACTCCTTCCTGG - Intronic
954456913 3:50604628-50604650 GCCAGGGCCCGGCTCCTGTCTGG - Intergenic
954693178 3:52406639-52406661 GCCTGTGGCCTGCTCCTGGGTGG - Intronic
956502107 3:69898116-69898138 CTCTGTGCCCCTCTCCTGTCTGG - Intronic
956526600 3:70169952-70169974 GCCAGTGTCCCCCTCCTTTCTGG - Intergenic
960375840 3:116900410-116900432 GCCTGAGTCCCTCTCCTGGCTGG - Intronic
961447328 3:126987014-126987036 GCCTCTCACCCACTCCTGGCTGG - Intergenic
966832761 3:184024362-184024384 GCATGTGGCCCGCAGCTGTCAGG + Intergenic
974463775 4:62226178-62226200 CTCTGTGACCGCCTCCTGTCTGG + Intergenic
975988547 4:80231396-80231418 TCCTGTGACCCAATCCTGTCTGG - Intergenic
984839567 4:184055717-184055739 GCCTGTGAGCCTCTCCTGGCTGG + Intergenic
985584886 5:725600-725622 GCCTGAGCCCCGCTGCTGTTTGG - Intronic
985598390 5:809914-809936 GCCTGAGCCCCGCTGCTGTTTGG - Intronic
985976864 5:3426082-3426104 TCCTCTGTCCCGCTCCTGCCAGG + Intergenic
986787107 5:11124672-11124694 GCCAGTGACCCGTTTCTGTATGG - Intronic
990387067 5:55275830-55275852 GCCTCTGCCCTGCTCCTGCCAGG + Intronic
997892591 5:137688246-137688268 GCCTGTGATCCTCTCCTGGGTGG - Intronic
999378503 5:151103702-151103724 GCCTGTGTCTCCCTCCTGCCTGG - Intronic
1001554985 5:172631075-172631097 CCCTGTCACCCACTCCTGGCTGG + Intergenic
1002181563 5:177433543-177433565 ACCTGTGGCCCGCACCTGGCAGG - Exonic
1002194857 5:177496318-177496340 GCCCCTGACCAGCTCCTGTTAGG + Intronic
1002527429 5:179822568-179822590 GCCTGTGACCTGCTCCTGAGGGG - Intronic
1007257845 6:40541157-40541179 GCCTGGGACCCGCTGATGGCTGG - Intronic
1011741431 6:90364473-90364495 GCCTGTGACCGGCTTCTCTGGGG + Intergenic
1018788343 6:167126538-167126560 GCCTGTGAGCTGCTGCAGTCAGG + Intronic
1020761050 7:12269051-12269073 GCCTGTGAGCGGGTCCTGCCTGG - Intergenic
1022496098 7:30854046-30854068 CCCTGTGATCTGCTGCTGTCTGG - Intronic
1023612108 7:41981666-41981688 GCCTGTGCCTCGCTGCTGACAGG + Intronic
1025020697 7:55477038-55477060 GCCTGTGACCACCTCATGCCAGG + Intronic
1025991762 7:66502889-66502911 GCCAGTGACACCCTCATGTCAGG - Intergenic
1029604062 7:101588022-101588044 GCCTGTGACCTGCTCTGGGCTGG + Intergenic
1033242217 7:139689879-139689901 GCCTTTGTCCCTGTCCTGTCAGG - Intronic
1034872791 7:154698784-154698806 GCCTGAGACTAGCTCCTGGCTGG - Intronic
1035284504 7:157797575-157797597 GCCTGTGGCCGCCTCCCGTCCGG - Intronic
1040573372 8:48628728-48628750 GAATGTGACCTGCTCCTATCAGG + Intergenic
1053276706 9:36788600-36788622 CACTGTGACCCCCTCCTGCCAGG - Intergenic
1057037871 9:91824834-91824856 GCCCGTCACCCCCTCCTGCCAGG - Intronic
1058861210 9:109119432-109119454 GCCGGCGGCCCGCTCCTGTACGG - Exonic
1061597049 9:131637605-131637627 ACCTGTGTCCCTCTCCTTTCTGG - Intronic
1061858121 9:133454256-133454278 GCCACTGAGCCCCTCCTGTCTGG - Intronic
1189609728 X:42719252-42719274 GACTGTGACCTCTTCCTGTCAGG + Intergenic