ID: 929484832

View in Genome Browser
Species Human (GRCh38)
Location 2:42343785-42343807
Sequence CCTCAATGTCAGACAAGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 1, 2: 3, 3: 16, 4: 151}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929484826_929484832 17 Left 929484826 2:42343745-42343767 CCATGAGGAAAATCAGAAGGAAG 0: 1
1: 2
2: 4
3: 58
4: 653
Right 929484832 2:42343785-42343807 CCTCAATGTCAGACAAGCCAGGG 0: 1
1: 1
2: 3
3: 16
4: 151
929484824_929484832 29 Left 929484824 2:42343733-42343755 CCAAGCTTTTGACCATGAGGAAA 0: 1
1: 0
2: 1
3: 28
4: 214
Right 929484832 2:42343785-42343807 CCTCAATGTCAGACAAGCCAGGG 0: 1
1: 1
2: 3
3: 16
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929484832 Original CRISPR CCTCAATGTCAGACAAGCCA GGG Intronic
901444140 1:9297041-9297063 CCTCAATGGCAGGCAAGGCTGGG - Intronic
904553538 1:31342003-31342025 GCACAATGGCAGACAAGTCATGG - Intronic
905416236 1:37806647-37806669 TCTCAAAGTCTGAAAAGCCAGGG - Intronic
908651929 1:66343247-66343269 CCTCAATGTCAGAAAATCTATGG + Intronic
909508699 1:76425830-76425852 CCTCAGTGTCAGATAATCAATGG + Intronic
909825811 1:80126244-80126266 CCTCAGAATCAGACAAGACAAGG + Intergenic
910813188 1:91258760-91258782 CAACAATGACAGCCAAGCCAAGG + Intergenic
911396500 1:97316828-97316850 CCTAAGTGACAGACAAGTCATGG - Intronic
915483575 1:156204295-156204317 ACTCCATGTCAGACAGGGCACGG - Intronic
916868383 1:168886074-168886096 CCTCAATTTCACACAAGGCAGGG - Intergenic
918404674 1:184200067-184200089 CCTCCATGTCAGGCAAGCCCTGG - Intergenic
920787693 1:209058300-209058322 CCTTAATGACAAACAGGCCAGGG - Intergenic
1063822010 10:9846649-9846671 CCTCCATGTTAGACATGCCTGGG + Intergenic
1063861047 10:10307835-10307857 CCTAAAAGTCAGGCCAGCCAAGG + Intergenic
1066801666 10:39199302-39199324 CCTCAATGTCAGTCTTGGCATGG + Intergenic
1068095087 10:52481420-52481442 CCTCAGTGTCAGAGAAGGGAAGG - Intergenic
1073903573 10:108250844-108250866 CCTCAATGCCATCTAAGCCATGG - Intergenic
1076141020 10:128078543-128078565 CACCAGTGTGAGACAAGCCATGG - Intronic
1077469960 11:2752938-2752960 CCTCAAGCCCAGACCAGCCAGGG - Intronic
1078469182 11:11573389-11573411 CCTAAGTATCAGCCAAGCCAAGG + Intronic
1081076740 11:38684283-38684305 CCTCAAAGTTAGACAAACCTAGG - Intergenic
1081191947 11:40115185-40115207 CCTCAATGTCACTGAAGGCATGG - Exonic
1081412068 11:42771376-42771398 CCTCAAAGTCAGACACATCATGG - Intergenic
1085677127 11:78533225-78533247 TCTGAATCTCAGTCAAGCCAGGG - Intronic
1086498533 11:87428370-87428392 CAGCAATGTCAGAGAAGCAATGG + Intergenic
1087163156 11:94971028-94971050 CTTCAGTGTCAAAAAAGCCACGG - Exonic
1087909160 11:103733093-103733115 CCTGAGTTTCAGACAAACCAGGG - Intergenic
1089582325 11:119489187-119489209 CCTCAAGGACAGGCCAGCCAGGG + Intergenic
1090496836 11:127221409-127221431 CCTGAATGTCAAGCAAGCCTAGG + Intergenic
1091842606 12:3631567-3631589 CCTCAAGGCCAGACAAGGCCAGG + Intronic
1092870388 12:12800917-12800939 CCTAAATGTCAGAGTACCCAGGG - Intronic
1095361656 12:41348766-41348788 CAAGAATGACAGACAAGCCATGG + Intronic
1098076200 12:66734391-66734413 CCTGAATTTCAGACAATCAAAGG - Intronic
1102050334 12:109857348-109857370 CATCACTGTCAGGCAAGCCCTGG + Intronic
1102621071 12:114194867-114194889 CCTCACTGTCAGACAGTCCCGGG - Intergenic
1105817262 13:24047964-24047986 CGTCAATGTCTGACATCCCAGGG + Intronic
1107411891 13:40165534-40165556 CCCCGATGTCAGAAAAGACAGGG + Intergenic
1107630880 13:42341915-42341937 CCACGATGGCAGAGAAGCCAAGG - Intergenic
1110749596 13:79097231-79097253 CCTGAGTGTCATTCAAGCCATGG + Intergenic
1112348413 13:98612157-98612179 CCTCAGTAACAGACCAGCCAGGG - Intergenic
1112973404 13:105287784-105287806 CCTCAAAGGCACACCAGCCAAGG + Intergenic
1113260299 13:108554070-108554092 CCTAAATATCAGAGAACCCAAGG - Intergenic
1114228303 14:20758476-20758498 CCTCCATGCCAGAAAAGTCAGGG + Intergenic
1115525146 14:34272419-34272441 CCTCAGTGGCAGAAAGGCCAAGG + Intronic
1115765536 14:36619247-36619269 CTTCAATGTCAGCCAAAGCACGG - Intergenic
1118447512 14:65865180-65865202 CCTGAATGCCAGTCCAGCCACGG - Intergenic
1119895043 14:78213049-78213071 CCTCAAAATCAGCCAAACCAGGG - Intergenic
1122476960 14:102016978-102017000 CCTCCATGTCAGGCAAGGCCCGG - Exonic
1123037007 14:105475613-105475635 CCTCAAGGTCAGAACAGCCCTGG + Intronic
1124153828 15:27208106-27208128 TCTCAATGACAAACTAGCCAAGG - Intronic
1125874187 15:43129684-43129706 CCTCAATGTGCCTCAAGCCAAGG + Intronic
1126334428 15:47570734-47570756 CCTCAATGCAAGACAAATCAGGG + Intronic
1130023550 15:80251586-80251608 CCTCAATGGCAGAGAGGCCGAGG + Intergenic
1131120057 15:89816653-89816675 CCTCCATGTCTGACAAGCCAAGG + Intergenic
1132198721 15:99933071-99933093 CCTGAATGTCCAAAAAGCCAAGG + Intergenic
1132842561 16:1985192-1985214 CTTCAGTGCCAGACAAGGCAGGG - Intronic
1133660429 16:7911036-7911058 CCTCAGTCCCAGATAAGCCACGG - Intergenic
1134422152 16:14103677-14103699 CGTCAAAGTCAGTCCAGCCAAGG + Intronic
1135425973 16:22336039-22336061 CCTCAATGCCAGGCATGCCCTGG + Intergenic
1137899548 16:52252016-52252038 AATCACTGTCAGACAAACCAAGG + Intergenic
1143421545 17:6797024-6797046 CCTTTATGTCAGACACACCAAGG - Intronic
1145828945 17:27899267-27899289 CATCAAAGTCAGACAAGCAATGG + Intergenic
1145835713 17:27952871-27952893 ACTCAATGTCTGAAAGGCCAAGG - Intergenic
1147898726 17:43769629-43769651 GCTCAATGACAGACTAGCCAAGG - Exonic
1148218376 17:45846235-45846257 CCACAATGTCACCGAAGCCAAGG - Exonic
1148722713 17:49765245-49765267 CCCCAATCACAGACAATCCAGGG - Intronic
1149433581 17:56615057-56615079 GCACAATATCAAACAAGCCAAGG + Intergenic
1153927451 18:9846674-9846696 TCTCAAAGTCAGAGAAGCCGTGG + Intronic
1156310652 18:35918872-35918894 ACTCAATGACAGTTAAGCCAGGG + Intergenic
1156779688 18:40836579-40836601 TATCAAGGTCAGACAAGTCAAGG - Intergenic
1157403990 18:47408520-47408542 ACTAAATGTCAGGAAAGCCAGGG + Intergenic
1158261653 18:55612409-55612431 GCTCAATGTCAGATAAGCTTTGG - Intronic
1161274994 19:3410956-3410978 CCCCAAAATCAGACAAGCCTGGG + Intronic
1161992096 19:7689979-7690001 CCTCCAGGTCAGAGAAGCCTTGG + Intronic
1163790007 19:19301145-19301167 CCTGAATGTCAGACTGGCCCTGG - Intronic
1164554200 19:29237814-29237836 CCAAAATGTCAGACCAGCCTGGG + Intergenic
926075862 2:9942197-9942219 CCTCGATCTCAGGCAAGCCATGG + Intergenic
927287107 2:21368448-21368470 CCTCTGGGTCACACAAGCCAGGG - Intergenic
928225527 2:29444972-29444994 ACTCAATATCAGAGAGGCCAAGG + Intronic
929484832 2:42343785-42343807 CCTCAATGTCAGACAAGCCAGGG + Intronic
933895621 2:86807879-86807901 CCGCGATGTCAGACAAGAAACGG + Intronic
934888005 2:98041321-98041343 CCTGAATGTCAGACAGGCAAGGG + Intergenic
935222686 2:101028498-101028520 TCACAGTGTCAGACATGCCAGGG + Intronic
935921565 2:108021354-108021376 CCTCTAGGTCAGAAAAGCCAAGG + Intergenic
937729431 2:125209820-125209842 CCTAAATGGCAGAGAAGGCAAGG - Intergenic
940157124 2:150669323-150669345 CCTCAATGTAATACAACCCTGGG + Intergenic
948011567 2:234653205-234653227 CTGCAATGTCTGTCAAGCCAGGG + Intergenic
948365971 2:237454995-237455017 CCTCAATGGCTTACAAGCAAGGG - Intergenic
1170517500 20:17147045-17147067 CCCCAATGCCCGACAGGCCATGG - Intergenic
1171171383 20:23018294-23018316 CTTCAAACTCAGACAACCCAGGG - Intergenic
1171182752 20:23102865-23102887 GCTCACTGTCACACAACCCAGGG - Intergenic
1172208766 20:33182796-33182818 ACTCAAACTCAGAGAAGCCAAGG + Intergenic
1174071916 20:47905405-47905427 GCTCAGTGTCAGACGAGCCTGGG + Intergenic
1174152132 20:48493264-48493286 GCTCAGTGTCAGACGAGCCTGGG - Intergenic
1174412010 20:50342443-50342465 CCCAAATGTCAGTCAAGCCAAGG + Intergenic
1176390194 21:6159239-6159261 CCTGACTGTCAGGCAGGCCAAGG + Intergenic
1178128834 21:29546275-29546297 CCTCAATCTCAGAGAATGCAGGG - Intronic
1179733272 21:43379001-43379023 CCTGACTGTCAGGCAGGCCAAGG - Intergenic
1180176753 21:46094291-46094313 CCTCCATGTCAGCCAAGCCGTGG + Intergenic
1182711227 22:32324670-32324692 CCTCAGTGTCAGACAAGCCCGGG + Intergenic
1183646943 22:39132483-39132505 CCTCACTGGCAGGGAAGCCACGG + Exonic
1184324503 22:43772841-43772863 CCTCAATTCCAGACAAGCTGAGG - Intronic
1184398752 22:44261474-44261496 CCTCAATGTCAGACAAGCCCGGG + Intronic
1185278071 22:49958309-49958331 CCTCAATGTCAAACAGTCCCGGG + Intergenic
949814810 3:8047445-8047467 CTTCAAAGTCAGACATGCCTGGG - Intergenic
951791245 3:26487163-26487185 GCTCAATGTCAGAAAACCCAGGG + Intergenic
954807351 3:53228275-53228297 CTTCCAGGTCGGACAAGCCAAGG - Exonic
955569725 3:60291477-60291499 CCTCCATGTCGGACATGCCTGGG + Intronic
956077623 3:65522745-65522767 CTTCAAAGGCAGACAAGCCCTGG + Intronic
959984838 3:112561441-112561463 CCTCAAGGTAAGCCAGGCCAGGG - Exonic
960689397 3:120328217-120328239 CCTTAATGTCAGCCAATCCCTGG + Exonic
962117419 3:132525768-132525790 CCTCATTTTCAGACAAGGCATGG - Exonic
963018709 3:140850797-140850819 CCTCTATCACAGAGAAGCCAAGG + Intergenic
963327819 3:143881481-143881503 CTTCAGTCTCAGACAAACCAGGG + Intergenic
965645411 3:170875342-170875364 GCTTCATGTCAGAGAAGCCATGG + Intergenic
967216319 3:187213530-187213552 CCTCAAGTTCAGAGAACCCATGG + Intergenic
967674037 3:192274650-192274672 CTTCAACTTCAGAAAAGCCAGGG - Intronic
967905268 3:194494320-194494342 CCACGATGTCAGACTAGCAATGG + Intronic
971135669 4:23865310-23865332 CCTCAGTGTCAGAGAAGAAATGG - Intronic
971765134 4:30821284-30821306 CCACATTGTCAGCCAAGCGATGG + Intronic
971848456 4:31950141-31950163 CCACAGTGTTAGAGAAGCCATGG + Intergenic
971910754 4:32793809-32793831 CCTCATTATCAGACAAGACAGGG - Intergenic
972080539 4:35143619-35143641 CCTCACTGTCAGACTTGACATGG - Intergenic
974885299 4:67810127-67810149 CCTCAAGGTCAGAGATCCCAGGG + Intergenic
977716848 4:100191853-100191875 CCTGAAGGTCAGGCGAGCCAAGG + Intergenic
981086083 4:140685486-140685508 CCTCAATGTCATAGAAGACAAGG + Intronic
983506026 4:168554473-168554495 CCTCTATGTCAGCCAATCCGTGG + Intronic
986666754 5:10111317-10111339 CGTCAATGTCATAAAAGACAAGG - Intergenic
987672299 5:21026042-21026064 CTGCAATATCAGACAAGACATGG - Intergenic
990396763 5:55390031-55390053 ACTCAAAGTCAGACAGGGCAAGG - Intronic
994348319 5:98715114-98715136 CCTGAATGGGAGAAAAGCCAAGG - Intergenic
999013918 5:148075789-148075811 CCTCCATGCCAACCAAGCCAGGG - Intronic
1000106958 5:158068889-158068911 CTTTAAAGTCAGACAAACCAAGG - Intergenic
1004395240 6:15242070-15242092 CCTCAATATGAGACAAATCATGG + Intergenic
1007325545 6:41056798-41056820 GCTCTCTGTCAGACAAGACAGGG + Intronic
1007430758 6:41775418-41775440 CGCCGATGTCAGACAGGCCAGGG - Exonic
1008072830 6:47114758-47114780 CCCCAGTTTGAGACAAGCCAGGG - Intergenic
1008749932 6:54720687-54720709 GTTCAATGTTAGACAAACCATGG + Intergenic
1013217037 6:108037002-108037024 CCTCAGTCTCATGCAAGCCATGG - Intergenic
1013734410 6:113208679-113208701 CCTCACTGTCTCACAAGCAAGGG + Intergenic
1020215329 7:6185915-6185937 GCTCAATGCCAGAAAAGCAAGGG + Intronic
1020434068 7:8143469-8143491 CCTCAGTGAGAGAAAAGCCAGGG + Intronic
1023313354 7:38910205-38910227 CCTCAATGGCCCAGAAGCCAAGG + Intronic
1024116670 7:46200693-46200715 CCTCAATTTCACTCAGGCCATGG - Intergenic
1026354457 7:69545368-69545390 CATCAATTTGAGACAAGACAAGG + Intergenic
1027698732 7:81442548-81442570 CTTCAATGACAGAGAAACCATGG - Intergenic
1028948882 7:96611437-96611459 CCTCCATGACAGTCATGCCATGG + Intronic
1032459453 7:132099304-132099326 CCTCAAAGTCAGAGAAATCAGGG + Intergenic
1034309913 7:150078317-150078339 CCTCAATGTCTCACTTGCCATGG + Intergenic
1034796935 7:154022304-154022326 CCTCAATGTCTCACTTGCCATGG - Intronic
1039471980 8:37819089-37819111 CCTCATTGTCAGAAGAGCTAGGG + Intronic
1045620663 8:103974034-103974056 CCTCAAAGTCAGACCAACCCTGG + Intronic
1046330934 8:112713850-112713872 CCTCCATCTCAGACAAGCAAAGG + Intronic
1047466039 8:125115283-125115305 CTTCAATGTCAGATATGCCCAGG - Intronic
1047763262 8:127969839-127969861 CCTCTATGTCAGACAGGCCAGGG - Intergenic
1050052874 9:1621669-1621691 CCTCTATCCCAGACAAACCAGGG + Intergenic
1050559805 9:6823330-6823352 CCTCACTGTCAGAGTACCCATGG + Intronic
1052911331 9:33884485-33884507 CCAGAATTTCAGACAAGCCTAGG - Intronic
1054732338 9:68713999-68714021 CTTCATAGTCAGAAAAGCCAGGG - Intronic
1056442348 9:86633654-86633676 TCTCATTGTCAGAGAAGCTACGG - Intergenic
1058447224 9:105064736-105064758 CTTTGAAGTCAGACAAGCCACGG + Intergenic
1058456195 9:105140325-105140347 CCACAATGCCAGACAAATCAGGG + Intergenic
1059983285 9:119796715-119796737 CTTGAATATCAGACATGCCAGGG - Intergenic
1060395244 9:123312184-123312206 CCTCAAGGTCCCACAGGCCAGGG - Intergenic
1061587850 9:131579945-131579967 CCTCAGAGTCAGGCAGGCCAGGG + Intronic
1062386434 9:136313485-136313507 CATCAATGTCAGAGAAGCAGGGG + Intergenic
1187302774 X:18067321-18067343 TCTCAAGGTCAGAAAAGCCAAGG - Intergenic
1192989069 X:76429706-76429728 CCTGAATGGCAACCAAGCCAAGG + Exonic
1195999214 X:110763086-110763108 CATCATTGTCAGACAAACCTGGG - Intronic
1196080880 X:111629611-111629633 ATTCAATGTCAGATGAGCCAGGG + Intergenic
1199255851 X:145718033-145718055 CGTCAGTGTCAGTGAAGCCAAGG + Intergenic
1201553386 Y:15242645-15242667 TCCGAAGGTCAGACAAGCCAAGG - Intergenic