ID: 929485058

View in Genome Browser
Species Human (GRCh38)
Location 2:42345764-42345786
Sequence CTGGGTTCACATGACCCCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 94}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929485058_929485064 -2 Left 929485058 2:42345764-42345786 CCCCCGGGGTCATGTGAACCCAG 0: 1
1: 0
2: 0
3: 7
4: 94
Right 929485064 2:42345785-42345807 AGAGCACTGTTGTGAAGAGTAGG 0: 1
1: 0
2: 1
3: 19
4: 171
929485058_929485065 21 Left 929485058 2:42345764-42345786 CCCCCGGGGTCATGTGAACCCAG 0: 1
1: 0
2: 0
3: 7
4: 94
Right 929485065 2:42345808-42345830 ACCGCACTTACTCAGCACCGTGG 0: 1
1: 0
2: 0
3: 3
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929485058 Original CRISPR CTGGGTTCACATGACCCCGG GGG (reversed) Intronic
902110806 1:14076692-14076714 CTGCTTTCACCTGACCCCGGTGG + Intergenic
904388425 1:30162676-30162698 CAGGGTACAAATGACCCCAGAGG - Intergenic
905043043 1:34976312-34976334 CTTGGTACAGATGAGCCCGGAGG + Intergenic
914676657 1:149911482-149911504 CTGGGTCCACAGGAGCCCAGGGG + Intronic
919641920 1:200053743-200053765 CTGAGTCCAGATGACCCCGTGGG + Intronic
1062822788 10:547531-547553 CAGGGTTCACATTATCCAGGAGG + Intronic
1072554444 10:96504067-96504089 CTGGGCTCACATGATCTCAGGGG - Intronic
1077358540 11:2129712-2129734 CGGGGCTGGCATGACCCCGGGGG - Intronic
1082774876 11:57237166-57237188 CTGGGTTCTCCAGACCCTGGAGG + Exonic
1083849206 11:65355364-65355386 CTGGATTCAGATGACGCCGCTGG - Intronic
1096567931 12:52496691-52496713 CTGGGTTCAGCTGTCCCCTGGGG - Intergenic
1098243003 12:68487590-68487612 CAGGGTTCCCAGGACCCCGCGGG - Intergenic
1103741719 12:123095802-123095824 CTGAGTTCACACGACACAGGAGG - Intronic
1105547439 13:21361209-21361231 CTGGGATCACACGACCCTGCAGG + Intergenic
1113472138 13:110554776-110554798 CTGGGTTCACAGCACCTCTGAGG + Intronic
1113649463 13:112025887-112025909 GTGGGTTCACATGCCCAGGGAGG + Intergenic
1114640069 14:24213587-24213609 CTTGGGTCACGTGACACCGGTGG - Exonic
1118030335 14:61812582-61812604 CTGGGCTCTCAGGACGCCGGCGG + Intergenic
1119862344 14:77945453-77945475 CTGTGTTCAAATGACCCATGGGG + Intergenic
1121412175 14:93755830-93755852 CTGGGTTCTCATTACCCTTGTGG - Intronic
1202935676 14_KI270725v1_random:85544-85566 CAGGGTTCACCTGCCCCTGGTGG - Intergenic
1124687318 15:31793287-31793309 CTGGGGTCAGATAACCCAGGAGG - Intronic
1132870259 16:2112637-2112659 CTGGGTGCACAGGAGCCCTGAGG - Intronic
1134522280 16:14924298-14924320 CTGGGTGCACAGGAGCCCTGAGG + Intronic
1134709950 16:16322949-16322971 CTGGGTGCACAGGAGCCCTGAGG + Intergenic
1134717165 16:16362949-16362971 CTGGGTGCACAGGAGCCCTGAGG + Intergenic
1134949653 16:18345696-18345718 CTGGGTGCACAGGAGCCCTGAGG - Intergenic
1134957587 16:18389210-18389232 CTGGGTGCACAGGAGCCCTGAGG - Intergenic
1142294975 16:89215334-89215356 GTGAGATCACATTACCCCGGTGG + Intergenic
1144633323 17:16887326-16887348 TTTGGTACAAATGACCCCGGGGG + Intergenic
1144707311 17:17378121-17378143 CTGGGTGCACATGAGCCAGTGGG - Intergenic
1144855376 17:18264521-18264543 CCGGGGTCACCTGACCCAGGTGG + Exonic
1145939894 17:28737823-28737845 CTGGCCTCACAGGTCCCCGGGGG - Exonic
1147053304 17:37814480-37814502 CCGAGATCACATGAACCCGGAGG - Intergenic
1152016212 17:77752333-77752355 CTGGGTTCACTGAACCCGGGAGG - Intergenic
1152787090 17:82254186-82254208 CTGGCTTCACAAGGCTCCGGCGG - Intronic
1152946564 17:83200901-83200923 CTGGGTTGACATGTCCCCTTAGG - Intergenic
1154307624 18:13242046-13242068 CTGGCTTCACATCACCCTGGAGG - Intronic
1155536869 18:26827878-26827900 CTGGATTCTCATGGCCTCGGAGG - Intergenic
1158214103 18:55081146-55081168 CTGGGCTCAGATGACCCCAATGG + Intergenic
1159001893 18:62981863-62981885 CAGGGTTCACCTGTCCCCGGGGG + Intergenic
1161501666 19:4619628-4619650 CTGGGTGCACATCTCCCCCGGGG + Intergenic
1162588833 19:11577745-11577767 CAGGGCTCACATGACCCAAGGGG - Intronic
1162809543 19:13155704-13155726 CAGGCTTCCCATGACCCCAGGGG + Intergenic
1165113016 19:33513103-33513125 CTTGGTGCCCATGACCCTGGGGG + Intronic
1167152514 19:47718502-47718524 CTGGGCACACATGAACCTGGGGG - Exonic
926231547 2:11008026-11008048 CTGCGTACACATCACACCGGAGG - Intergenic
927043706 2:19255786-19255808 CTGGGTTCACATGGCCAGGCAGG - Intergenic
929485058 2:42345764-42345786 CTGGGTTCACATGACCCCGGGGG - Intronic
934080910 2:88467220-88467242 CTGGGTTCCTAGGAGCCCGGAGG - Intergenic
934926501 2:98385302-98385324 CAGGGTTCACATCACCCTGGAGG + Intronic
938152623 2:128900574-128900596 CTTGGTTCACACCACCCAGGTGG - Intergenic
941666232 2:168246793-168246815 CTGGGTTTCCAGGGCCCCGGGGG - Intronic
941994796 2:171592159-171592181 CAGGATTTACATGACCTCGGTGG + Intergenic
1170789679 20:19497392-19497414 CTGGAGAAACATGACCCCGGAGG - Intronic
1175404477 20:58717464-58717486 CTGGGATAACATCACCCAGGTGG - Intronic
1176548994 21:8213493-8213515 CGGGGTTCGCGTGTCCCCGGCGG + Intergenic
1176556887 21:8257705-8257727 CGGGGTTCGCGTGTCCCCGGCGG + Intergenic
1176567923 21:8396523-8396545 CGGGGTTCGCGTGTCCCCGGCGG + Intergenic
1176575827 21:8440742-8440764 CGGGGTTCGCGTGTCCCCGGCGG + Intergenic
1179655504 21:42842043-42842065 CTGTGGCCACCTGACCCCGGGGG + Intergenic
1179985636 21:44919150-44919172 CTGTGGCCACCTGACCCCGGGGG - Intronic
1183670475 22:39269739-39269761 CTGTGAGCCCATGACCCCGGGGG - Intergenic
1185383217 22:50519678-50519700 CTGGGTACAGTTGACCCCGGGGG - Intronic
1203253878 22_KI270733v1_random:129800-129822 CGGGGTTCGCGTGTCCCCGGCGG + Intergenic
1203261934 22_KI270733v1_random:174879-174901 CGGGGTTCGCGTGTCCCCGGCGG + Intergenic
949550547 3:5109157-5109179 CTGGGATCACTTGAGCCCAGGGG + Intergenic
965801839 3:172502482-172502504 CTGTGTTCCCATGACTCAGGAGG - Intergenic
970846029 4:20538280-20538302 CTGGAGTCACATGCCCCTGGGGG - Intronic
972979505 4:44678612-44678634 GAGGGTCCACATGACCCGGGCGG - Exonic
982712178 4:158768869-158768891 CCGGGCTCACGTAACCCCGGCGG - Intergenic
985299547 4:188473328-188473350 CTGGGTTCTCAGGTCCCTGGAGG + Intergenic
994123518 5:96144749-96144771 CTGGATTCACTTGAACCCAGAGG - Intergenic
994213174 5:97108610-97108632 CTGGGTTCACAGGAGCCTGTAGG - Intronic
998149373 5:139748107-139748129 CTGTATTCACGTGACCCCCGGGG + Intergenic
999741683 5:154560023-154560045 CTGTGTTGACATGACCCCACTGG + Intergenic
1001295920 5:170498895-170498917 CTGGGTTCATATGAGCTCAGGGG + Intronic
1002825911 6:774218-774240 CTAGGTTCACAAGCCCCTGGAGG + Intergenic
1003404238 6:5815477-5815499 CTGGGTTCACATGACCTTGCAGG - Intergenic
1006407063 6:33851605-33851627 CTGGGCTCACATGGCTCCCGGGG - Intergenic
1019492714 7:1322630-1322652 CTGGGCTCCCAGGACCCAGGCGG - Intergenic
1021969328 7:25951305-25951327 CGGGGCGCACGTGACCCCGGGGG - Intergenic
1023995731 7:45157928-45157950 CGGGGTTCACCGGACCCGGGTGG + Intronic
1027882276 7:83855824-83855846 CTGGGGTCACATGAACCACGGGG + Intergenic
1029468071 7:100738530-100738552 CTGAGTCCACTTGGCCCCGGAGG - Exonic
1032445195 7:131976365-131976387 CTGGCTTCACAGTACCCCTGTGG - Intergenic
1034820760 7:154214356-154214378 ATGGGTTCTCATGACCTCTGAGG + Intronic
1035000590 7:155609500-155609522 TTGGGTTCACATCACTCCCGTGG + Intergenic
1036709175 8:11067365-11067387 CTGGGTTGAGATCACCCGGGTGG - Intronic
1049962830 9:752990-753012 CTGGGTTCATTGGACCCCTGTGG - Intergenic
1052345232 9:27402739-27402761 CAGGGTTCACTTGGCCCCGTGGG + Intronic
1053151818 9:35748693-35748715 CTGGGTCCCCATGACCTCGATGG + Exonic
1055370634 9:75594462-75594484 ATGTGGTCACATGACCCAGGAGG + Intergenic
1055965429 9:81860962-81860984 CTGGGTCCCCAACACCCCGGTGG - Intergenic
1056332062 9:85529154-85529176 CTGGCTCCACATGGCCCTGGAGG - Intergenic
1057116200 9:92524702-92524724 CTGGGTTCTTATGATCCCTGGGG - Intronic
1062405880 9:136396071-136396093 CAGGGTTCACAGGACGCCTGTGG - Intronic
1203470278 Un_GL000220v1:112944-112966 CGGGGTTCGCGTGTCCCCGGCGG + Intergenic
1203478099 Un_GL000220v1:156916-156938 CGGGGTTCGCGTGTCCCCGGCGG + Intergenic
1185459355 X:327776-327798 CTGGGGTCACATGTCCCCGTGGG - Intergenic
1190214605 X:48471230-48471252 CCAGGTTCAGATGACCCTGGAGG + Intergenic
1200354321 X:155532128-155532150 CTGAGTTCTCATGTCCCCAGAGG - Intronic