ID: 929490768

View in Genome Browser
Species Human (GRCh38)
Location 2:42394251-42394273
Sequence CCTTTTTAGCAGTTTTTGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 369
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 333}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929490768_929490775 22 Left 929490768 2:42394251-42394273 CCCAACAAAAACTGCTAAAAAGG 0: 1
1: 0
2: 1
3: 34
4: 333
Right 929490775 2:42394296-42394318 GACACAGTCTGCCGACACCACGG 0: 1
1: 0
2: 0
3: 3
4: 106
929490768_929490773 -3 Left 929490768 2:42394251-42394273 CCCAACAAAAACTGCTAAAAAGG 0: 1
1: 0
2: 1
3: 34
4: 333
Right 929490773 2:42394271-42394293 AGGCAGGGAAGAGTAGACATAGG 0: 1
1: 0
2: 3
3: 45
4: 593
929490768_929490774 -2 Left 929490768 2:42394251-42394273 CCCAACAAAAACTGCTAAAAAGG 0: 1
1: 0
2: 1
3: 34
4: 333
Right 929490774 2:42394272-42394294 GGCAGGGAAGAGTAGACATAGGG 0: 1
1: 0
2: 2
3: 29
4: 315

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929490768 Original CRISPR CCTTTTTAGCAGTTTTTGTT GGG (reversed) Intronic
900691139 1:3981376-3981398 CCTTTTGAGCTGCTTTTGCTGGG - Intergenic
901198464 1:7453490-7453512 CCCTTTTAGCATTTTATGTCCGG + Intronic
905606541 1:39305413-39305435 CTGTTTTAGCAGATTTTGCTGGG + Intronic
906898975 1:49812512-49812534 CCTTTATGTCAGTGTTTGTTAGG - Intronic
908040949 1:60112484-60112506 CCATTTTAGGAGTGTTTGTATGG - Intergenic
909259662 1:73471018-73471040 TCCTTTTACCAGTTTTTGATGGG - Intergenic
909969918 1:81970351-81970373 TCTTTTTGGCAGCTTTTGCTTGG + Exonic
910012965 1:82487829-82487851 GCTTTTTAATAGTTTTTTTTGGG + Intergenic
910979055 1:92940235-92940257 TGTTTTTAGCAGTCTGTGTTGGG - Intronic
912646819 1:111400931-111400953 GCATTTTAGAAGGTTTTGTTAGG - Intergenic
912745180 1:112240047-112240069 CCCTTTTAGCATATTTTGCTTGG - Intergenic
913175032 1:116265685-116265707 CCTTTTTTGCTCTTTATGTTGGG + Intergenic
913482357 1:119300930-119300952 CCTTTTCACCAGATTTTGCTTGG + Intergenic
913702755 1:121388840-121388862 CCCTTTTAGCAGTTTTCTCTAGG - Exonic
914043318 1:144069344-144069366 CCCTTTTAGCAGTTTTCTCTAGG - Intergenic
914134768 1:144891151-144891173 CCCTTTTAGCAGTTTTCTCTAGG + Exonic
915198691 1:154210024-154210046 CCTTCTAAGCAGTTTTTACTAGG + Intronic
917400340 1:174642128-174642150 GCTTTTTCTCATTTTTTGTTTGG + Intronic
918030607 1:180804974-180804996 CTTTCCTAGCAGCTTTTGTTCGG + Intronic
918724019 1:187894275-187894297 CCTTTTTGAAAATTTTTGTTAGG - Intergenic
919117048 1:193293772-193293794 CCCTTTTAGAAGTTTTTGACAGG - Intergenic
919557276 1:199074300-199074322 ACTTTTTAGCTGATTTTTTTTGG - Intergenic
920490186 1:206407581-206407603 CCCTTTTAGCAGTTTTCTCTAGG - Intronic
920999447 1:211027798-211027820 CATATTTTGCAGTTCTTGTTTGG - Intronic
922094038 1:222426024-222426046 CATTTTTAGCATTTCTTGTAGGG - Intergenic
922498717 1:226081552-226081574 TCTTTTTAAAATTTTTTGTTTGG - Intergenic
923458473 1:234186888-234186910 CCTTTTTGGTTGTTGTTGTTTGG + Intronic
924335014 1:242978889-242978911 ACTTGTTACAAGTTTTTGTTTGG - Intergenic
1063082818 10:2784199-2784221 TCTTTTTAGTTGTTTTTTTTGGG - Intergenic
1064906360 10:20350263-20350285 CCTATTTGTCAGTTTTTGTCAGG - Intergenic
1065102812 10:22347530-22347552 CCATTTTAAAAGTTTTAGTTTGG - Intronic
1065613038 10:27491324-27491346 TCTTTTTACCTGTGTTTGTTGGG + Intergenic
1066129282 10:32375301-32375323 TATTTTTAGCATTTTATGTTTGG + Intronic
1067670380 10:48315126-48315148 CCTTTTCAGAAGTTTTTTTCTGG + Intronic
1068906579 10:62332400-62332422 TCCATTTAGCATTTTTTGTTGGG + Intergenic
1070273836 10:74985190-74985212 CCTTTTCATCATTTTTTGTAAGG - Exonic
1071436714 10:85654270-85654292 AGTTTTTAGCAGTTTATTTTGGG - Intronic
1071544745 10:86521176-86521198 CCTTTTTCGGAGTTCTTTTTCGG - Intronic
1071705537 10:87994050-87994072 CCTATTTAAGAGTTTTAGTTAGG + Intergenic
1071932740 10:90491327-90491349 TCTTTTTAGCCATTTTTGTTTGG - Intergenic
1071985770 10:91048759-91048781 CCTTTAAAGCACTTTTTTTTTGG + Intergenic
1073624641 10:105084603-105084625 GCTTCTCAGCAGTTTGTGTTAGG + Intronic
1074086377 10:110211021-110211043 GCTTTTTAGTAGTTATTATTGGG + Intronic
1074227661 10:111502678-111502700 CATTTTTAGCAGTTTGATTTTGG + Intergenic
1074331435 10:112514881-112514903 CGTTTTTTGCAGTTGTTCTTTGG + Intronic
1079561183 11:21821699-21821721 CCTCTTTAGTATTTTTTGTAAGG - Intergenic
1082727530 11:56754226-56754248 CCTTTTTAGTATTTTTTGCCTGG + Intergenic
1082732996 11:56823383-56823405 CATATTTATCATTTTTTGTTGGG + Intergenic
1085487896 11:76883761-76883783 CTTGTTTAGCAATTTCTGTTTGG + Intronic
1085659475 11:78350583-78350605 ACTTTTTAGAAGTTTTTATTTGG - Intronic
1086069090 11:82779926-82779948 CCTTTTAATGTGTTTTTGTTTGG - Intergenic
1087207034 11:95407532-95407554 CCTGTTCAGCATTTTTTCTTTGG + Intergenic
1090678405 11:129027349-129027371 GACTTTGAGCAGTTTTTGTTTGG - Intronic
1092357449 12:7808466-7808488 CCTTTTTAGTTGTTTTTGGTAGG + Intergenic
1092633336 12:10410766-10410788 TCTTTTTTGCAATGTTTGTTTGG + Intergenic
1092847655 12:12598838-12598860 ACTTTTAAAGAGTTTTTGTTCGG + Intergenic
1093322290 12:17727152-17727174 ACTTTTTAGAAGTTTTTATTTGG - Intergenic
1093599021 12:20999671-20999693 CCTTTTCAGAATTTTTTGTAAGG + Intergenic
1093848006 12:23998128-23998150 GCTATTTTGAAGTTTTTGTTAGG - Intergenic
1095351867 12:41222952-41222974 CATTTTTAGTAGCTTATGTTTGG + Intronic
1095377665 12:41549947-41549969 CCTGTTTCACAGTTTTGGTTTGG + Intronic
1095619604 12:44235475-44235497 CCTTTTTTGATGTTTTTGATTGG + Intronic
1096353827 12:50923253-50923275 CATTTTTAACAGATTTTTTTAGG - Intergenic
1096361937 12:50995418-50995440 CCTCTTTCTCAGCTTTTGTTTGG - Intronic
1096978007 12:55710762-55710784 CAGTTTCAGCATTTTTTGTTTGG - Intronic
1098577379 12:72058442-72058464 CCTTTTTATAAGTTTTGTTTGGG + Intronic
1098687848 12:73448083-73448105 ACTTTTTAGCAGTTGTTGTGGGG + Intergenic
1099485184 12:83221122-83221144 TATTTTTGGCATTTTTTGTTTGG + Intergenic
1099633585 12:85182371-85182393 CCCTTTTATATGTTTTTGTTTGG + Intronic
1099934898 12:89113409-89113431 CTTTTGTAGAAGTTTTTGATTGG - Intergenic
1100002375 12:89853152-89853174 CCTTTTTTGTTGTTTTTTTTTGG + Intergenic
1102938957 12:116921401-116921423 TCTTTGTAGCATTGTTTGTTTGG + Intronic
1104452898 12:128885864-128885886 CTTTAGTAGCAGTTTTTATTGGG + Intronic
1105662458 13:22513368-22513390 GCTTTGTAGCTGTTTTTATTTGG + Intergenic
1108856961 13:54805021-54805043 CTATTGTAGCAGTTTTTTTTAGG - Intergenic
1108874652 13:55030645-55030667 TCTTTATAGCATTTTTGGTTAGG + Intergenic
1108950776 13:56089040-56089062 CCTTTTTAGCTTTTTGTTTTTGG + Intergenic
1109018921 13:57059804-57059826 CCTCATTGGCAGTTTTTCTTAGG - Intergenic
1109584745 13:64384931-64384953 ACTTTTAAACAGTATTTGTTAGG - Intergenic
1109598574 13:64592222-64592244 ACTTTTTAGCAGTTATTTGTGGG - Intergenic
1109625169 13:64964453-64964475 TCCTTTTAGCAGTTCTTGTAGGG - Intergenic
1109630719 13:65042668-65042690 CCTTTTTATGGGTTTTTGCTAGG - Intergenic
1109813528 13:67547475-67547497 CCTTCTTAGCAGTTTCTCCTGGG + Intergenic
1109896003 13:68691132-68691154 CCTTTTAACAGGTTTTTGTTTGG - Intergenic
1110516902 13:76423840-76423862 CCTTTTTAACAGTTTTATTTAGG + Intergenic
1110768725 13:79310188-79310210 CGTTTTTATGAGTTTTTATTTGG + Intergenic
1111886609 13:94029498-94029520 CCTTTTTATCAGCATTAGTTGGG - Intronic
1114653663 14:24302982-24303004 CATTTTTAGTTGTTTTCGTTGGG + Intronic
1114687999 14:24553453-24553475 CATTTTTAGCAGTCCTTCTTGGG + Intergenic
1114783397 14:25565944-25565966 CAGTTCTAGCAGTTTTTTTTTGG + Intergenic
1115096842 14:29647870-29647892 CCTTTTAAGCAGTTTATGGTGGG + Intronic
1115097191 14:29650653-29650675 CCTTTTAAGCAGTTTTTGGCAGG + Intronic
1115391303 14:32857371-32857393 ACTTTTTTGAAGTTTTTGCTTGG - Intergenic
1116706526 14:48309309-48309331 CCTTTTTGTCAGTTTTTTTCTGG - Intergenic
1119755589 14:77116360-77116382 CCTTTTTGGCAGAATATGTTTGG + Exonic
1119974956 14:79015204-79015226 CCATTTTTGCAGTGTTTGGTGGG + Intronic
1120037735 14:79717057-79717079 CCTTTTTAGCAGGTTCTCCTGGG + Intronic
1120939246 14:89930957-89930979 GCTTAAAAGCAGTTTTTGTTAGG - Intronic
1121370033 14:93347947-93347969 TTTTTTAAGCACTTTTTGTTAGG + Intronic
1122069902 14:99199178-99199200 GGTTTGTAGCAGTTTTTATTAGG - Intronic
1125001360 15:34773667-34773689 TATTTTTAGCAGATTGTGTTTGG - Intergenic
1127925391 15:63535305-63535327 CCTTCTAAGCAATTGTTGTTTGG + Intronic
1128121243 15:65148691-65148713 CCTTTTACACAGTTTTTTTTAGG - Exonic
1128652004 15:69423349-69423371 CCTTCTTAGCTGTTAATGTTGGG + Intronic
1129561189 15:76571279-76571301 CATTTTCAGTTGTTTTTGTTGGG + Intronic
1129850728 15:78792097-78792119 CCCTCTTAACAGTGTTTGTTTGG - Intronic
1129935700 15:79448320-79448342 CCTCTTTAGCAATTTTTTTGTGG + Intronic
1130952213 15:88601529-88601551 CCTTTGGACCAGTTTTTCTTTGG - Intergenic
1132910220 16:2306324-2306346 TCTTTTTAACAATTTTTTTTTGG - Intronic
1133949214 16:10376189-10376211 TCTTTTTAGCATTTTTTGTAGGG + Intronic
1134365592 16:13574934-13574956 CCTTTCTAGAAGTTTGAGTTGGG - Intergenic
1134770848 16:16808100-16808122 TTTTTTTTGCAGTTTTTCTTTGG - Intergenic
1136743088 16:32557209-32557231 CCTTTTTTCTAGTTTTTATTGGG - Intergenic
1139686960 16:68611422-68611444 CCTTTTTTGTATTTTTTGTAGGG - Intergenic
1203026511 16_KI270728v1_random:518020-518042 CCTTTTTTCTAGTTTTTATTGGG + Intergenic
1203045210 16_KI270728v1_random:816411-816433 CCTTTTTTCTAGTTTTTATTGGG - Intergenic
1142831540 17:2552826-2552848 CCTTTTTAGCTATTTTTTTCTGG - Intergenic
1143912920 17:10266851-10266873 CCTCTTTCGCAGTCTTTGTCTGG + Intergenic
1143936360 17:10489265-10489287 TCCCTTTAGCATTTTTTGTTAGG + Intergenic
1146094108 17:29911674-29911696 ACTTGTTAGCAGTGTTTTTTGGG - Intronic
1147667422 17:42157423-42157445 CCTTGTTTGAAATTTTTGTTTGG - Intronic
1148122434 17:45221237-45221259 CCTGTTTAGGAGTTCCTGTTTGG + Intergenic
1148531668 17:48399053-48399075 GCTATTTAGGATTTTTTGTTTGG - Intronic
1149010628 17:51853220-51853242 CCTGATTAGCAGTTTCTGTGGGG - Intronic
1149688468 17:58553234-58553256 CCGTGTTAGTAGTTTTGGTTTGG + Intergenic
1152011060 17:77717346-77717368 CATTTCTAGCAGTTTTATTTGGG + Intergenic
1153296880 18:3554920-3554942 TCTTTTTCTCACTTTTTGTTAGG + Intronic
1154295076 18:13140437-13140459 CTTTCTTGGCAGTTTTGGTTAGG + Intergenic
1156582248 18:38391948-38391970 CCTTTTTAGCAAATGTTGCTTGG + Intergenic
1156954033 18:42939471-42939493 CCTTTTAATCACCTTTTGTTAGG + Intronic
1158529427 18:58245487-58245509 CCTTTTTAATTGTTTTTGTCTGG - Exonic
1159555812 18:69943335-69943357 CCTTTCTAGCAGAGTTTGTGAGG - Intronic
1159638607 18:70836924-70836946 ACTTTTTAGAAATTTTTGTGGGG + Intergenic
1159824821 18:73194739-73194761 TCTTTTTAGCAATTTTCATTCGG - Intronic
1162255395 19:9485026-9485048 CCTTTTTAGTATTTAGTGTTTGG - Intronic
1162664247 19:12195966-12195988 CTTTTTTAGCAGTTTCAGGTCGG + Intergenic
1162701589 19:12519397-12519419 ACTTTTTAGTTGTGTTTGTTTGG - Intronic
1164122054 19:22274826-22274848 CCTATTTATCATTTTTTATTGGG - Intergenic
1164558341 19:29270259-29270281 ACTTTGTTGCAGTTTTTCTTTGG - Intergenic
1168289345 19:55349816-55349838 AGTTTTTAGCCCTTTTTGTTGGG - Exonic
925420434 2:3706008-3706030 CCTTTTCTTCAGTTTTTTTTAGG + Intronic
925469602 2:4144615-4144637 CATTTTTAACAGTTTTATTTAGG + Intergenic
925967828 2:9082798-9082820 CATTTTTAGTTGTTTTTATTAGG + Intergenic
926422109 2:12710077-12710099 TCTTTTAAGGAGTTGTTGTTTGG + Intergenic
926582278 2:14643703-14643725 CAGTTTTAGCTGTTTTTGTAGGG - Intronic
926604468 2:14883676-14883698 CCTTTTTAGCAGTCATTTCTGGG - Intergenic
926740145 2:16103715-16103737 CTTTTTTAACAATTTTTTTTTGG - Intergenic
929490768 2:42394251-42394273 CCTTTTTAGCAGTTTTTGTTGGG - Intronic
929627307 2:43422584-43422606 GCTTCATAGCAGTTTTTGTGGGG - Intronic
931132635 2:59354464-59354486 GTTATTTAGCAGTTTTTCTTTGG - Intergenic
931523920 2:63131721-63131743 CCTCTTTAGCATTTCTTGTAGGG + Intronic
933451871 2:82464056-82464078 CATTTTCAGCATTTTTTTTTAGG - Intergenic
934165701 2:89292274-89292296 TCTTCTTAGCACTTTTTGCTGGG - Intergenic
934201576 2:89890182-89890204 TCTTCTTAGCACTTTTTGCTGGG + Intergenic
935043303 2:99455461-99455483 ACTTTTCTTCAGTTTTTGTTTGG - Intronic
936789659 2:116136352-116136374 CCTTTTTCGCAGGTTTTTTACGG + Intergenic
937733996 2:125267178-125267200 ACTTTTTAGCAGGATGTGTTTGG + Intergenic
938223835 2:129598018-129598040 CCTTTTTATTGGTTTTTATTTGG + Intergenic
939017487 2:136919657-136919679 CCTTTTTCCTAGTTTTTCTTGGG + Intronic
939276699 2:140007494-140007516 CCTTCCTATTAGTTTTTGTTTGG + Intergenic
940130592 2:150377051-150377073 CCTGTTTCGAAGTTTTGGTTTGG - Intergenic
940522933 2:154774900-154774922 CTTTTTTTGTTGTTTTTGTTTGG + Intronic
942737184 2:179127752-179127774 CTTGTTTATCAGTTATTGTTTGG + Intronic
943478871 2:188393736-188393758 CCCTTTTAGCATTTCTTGTAGGG + Intronic
944363019 2:198880942-198880964 ATTTTTTAGTAGTTTTTGGTTGG - Intergenic
944370439 2:198976063-198976085 CCTCTTTAGCATTTCTTGTAGGG - Intergenic
945309364 2:208293439-208293461 CCTTTTCAGCATTTTTTGCAAGG + Intronic
946262169 2:218502615-218502637 AATTTTTAGCAGTTTTATTTTGG - Intronic
947206069 2:227662340-227662362 CCTTTTCAGGATTTTTTTTTGGG + Intergenic
947348080 2:229214111-229214133 CCTTCTAAGTAGTGTTTGTTAGG + Intronic
947417629 2:229914278-229914300 ACTTTTTAGCATTTTTGCTTTGG - Intronic
1169545043 20:6641221-6641243 CCATTTTAGAAGTTTTAGCTTGG - Intergenic
1170270323 20:14520305-14520327 TCTTTTTTGTTGTTTTTGTTGGG - Intronic
1170726363 20:18930887-18930909 TCTTTTTAGCATTTCTTGTAAGG - Intergenic
1170905493 20:20512436-20512458 TCTTTTTATCAGTTTGTGGTTGG - Intronic
1173234282 20:41229753-41229775 GGTTTTTTGCTGTTTTTGTTGGG + Intronic
1173506015 20:43587711-43587733 CCTTATTAGCTTTTTTGGTTGGG + Intronic
1174977841 20:55354560-55354582 CCTTTTTTGCATTTTGTGTTAGG + Intergenic
1176923226 21:14715247-14715269 ACTTTTTAGTAGTTTTCATTTGG - Intergenic
1180706641 22:17814545-17814567 CCTTTATGGCTGTTTTTGTTTGG + Intronic
1181454452 22:23048599-23048621 TCCTTTTAGCAGTTCTTGTAGGG - Intergenic
1184971494 22:48025066-48025088 TTTTTTTAGCATTTTCTGTTGGG - Intergenic
949749493 3:7334380-7334402 CCTTTTTAGTAGATCTTGTAGGG - Intronic
952200541 3:31122398-31122420 CCTTTTTAGAAGATGTAGTTAGG + Intergenic
952424490 3:33160881-33160903 GGTTTTTAGCAGTTTTAATTTGG - Intronic
952949585 3:38510320-38510342 CCTTTTTAGCAACTTTTTTCTGG - Intronic
952954292 3:38547496-38547518 CCTTTTTAGGAATTTTTTTCAGG - Intergenic
953066225 3:39473417-39473439 CCTTTATTGTGGTTTTTGTTGGG + Intronic
953448612 3:42988287-42988309 ACTTGTGGGCAGTTTTTGTTTGG + Intronic
953796546 3:45990376-45990398 CCTTCTTACTAGTTTTTATTGGG - Intronic
955014302 3:55053663-55053685 CATTTCTAGTAGTTTTTGGTAGG + Intronic
957569640 3:81930114-81930136 TCCTTTCATCAGTTTTTGTTTGG + Intergenic
957570508 3:81942041-81942063 TATTTTTAACAGTTTTTTTTTGG + Intergenic
957933204 3:86909736-86909758 CCTTTGAAGCTTTTTTTGTTAGG - Intergenic
957954416 3:87165905-87165927 CTTTTTTTACAGTTTATGTTTGG + Intergenic
957996730 3:87699388-87699410 CCTTTCTAGCTTTTTTTGTGGGG - Intergenic
958978491 3:100693586-100693608 CCTTTTTAAGAGTTTATTTTTGG - Intronic
959310616 3:104731153-104731175 CTTTTTTAGCTGTTTTTGAAAGG + Intergenic
959374048 3:105565648-105565670 CATGTTTAGTAATTTTTGTTTGG + Intronic
959646226 3:108705293-108705315 CATTTTTTGCATTTTTTTTTTGG - Intergenic
959838249 3:110945466-110945488 CATTTTTAGGATTTTTTTTTTGG - Intergenic
960468472 3:118029215-118029237 CCTTTTTAGCATTTCTTCTAGGG + Intergenic
960843928 3:121989125-121989147 CCTTTTGAGCAGTATATTTTAGG - Intronic
961906233 3:130265409-130265431 CATTGTTAGCAGTTTGTCTTGGG + Intergenic
962065834 3:131979859-131979881 CTCTTTTAGCAGTTCTTGTAGGG + Intronic
963434293 3:145248550-145248572 CATTTTTAGTAGTATGTGTTTGG + Intergenic
963609104 3:147442525-147442547 CCTTTTTTTTAGTTGTTGTTTGG + Intronic
964564408 3:158034122-158034144 CCATTTTAGCATTTCTTGTAGGG - Intergenic
964574353 3:158148199-158148221 CCTTTGTAGCTCTTCTTGTTTGG + Intronic
966229750 3:177639233-177639255 TCCTTTTAGCAGTTCTTGTAGGG + Intergenic
966867705 3:184269293-184269315 TCTTTTTTGCTTTTTTTGTTTGG + Intronic
968023120 3:195413443-195413465 CCTTTTGCTCAGTTTTTATTTGG - Intronic
968126099 3:196161578-196161600 CTTTTTTAGAAGTTTATTTTAGG - Intergenic
970738333 4:19200506-19200528 ACTTTTTAGTAGTATTTATTTGG + Intergenic
971412303 4:26386954-26386976 CGTTTTTAGCAGTTTATTTTTGG + Intronic
971966162 4:33558682-33558704 CCTTTTCAGCTGTTTTTTTGTGG - Intergenic
972009665 4:34161152-34161174 CTTTTTATACAGTTTTTGTTAGG - Intergenic
972865150 4:43222775-43222797 CCTTTTTTGTTGTTTTTGTTGGG - Intergenic
973068981 4:45834177-45834199 TCCTTTTAGCAGTTTTTGTAGGG + Intergenic
973576492 4:52294996-52295018 ACTTTTTAGCTTTTTTTTTTTGG + Intergenic
973629405 4:52805282-52805304 CCTCTTTATCATTTTTTATTGGG - Intergenic
974080216 4:57204466-57204488 CCCTTTTTGCAGGCTTTGTTGGG + Intergenic
974132638 4:57775621-57775643 CCTTTTAAGAAGGTTTTTTTTGG + Intergenic
974462917 4:62211347-62211369 CTTTTTTTGCAGTTTTTGTAAGG + Intergenic
974856545 4:67467773-67467795 TCTTTTGATCATTTTTTGTTTGG - Intergenic
975031435 4:69622863-69622885 AATTTTTAGCAATTTTTGTCAGG - Intronic
976085966 4:81407510-81407532 CCTTTTTAGCAATAATTTTTTGG + Intergenic
976574383 4:86652416-86652438 TCTCTTTAGCATTTTTTGTAAGG + Intronic
978260862 4:106757024-106757046 TCCCTTTAGCAGTTTTTGTAAGG - Intergenic
978395526 4:108275622-108275644 AATTTATACCAGTTTTTGTTAGG + Intergenic
979242101 4:118456390-118456412 ACTTGTTACAAGTTTTTGTTTGG + Intergenic
979535727 4:121818419-121818441 CCTGTTGAACAGTGTTTGTTAGG - Intronic
980033587 4:127858127-127858149 TCTTTTTAGCAGTTCTTGTAGGG - Intergenic
980124069 4:128756705-128756727 CTTCTTTTACAGTTTTTGTTTGG - Intergenic
982674041 4:158355330-158355352 CCTGTTTAGCACTTTTTGCCAGG + Intronic
984108726 4:175582174-175582196 CCTTTTCAGTAGCTTTTGTTGGG + Intergenic
984175289 4:176410091-176410113 CCTTGTTAGGATTTTTGGTTGGG - Intergenic
985585711 5:732715-732737 CCTTTTGAGCAGGATTTGTGAGG - Intronic
986126136 5:4883856-4883878 CATTTTGAGCAGTTTTTATTTGG - Intergenic
986537048 5:8799352-8799374 TCATTTTAGCATTTTTTGTAAGG - Intergenic
987253972 5:16129341-16129363 CATGATTAGCAGTGTTTGTTTGG + Intronic
988430511 5:31113768-31113790 TCTTTTTCACAATTTTTGTTTGG - Intergenic
988963061 5:36388762-36388784 CATTTTTAATAGTTTTTATTAGG + Intergenic
988993960 5:36696698-36696720 CCTTTCTATCATTTTTTGTCTGG + Intergenic
990787184 5:59434779-59434801 CCTGATTAGCAGTTATTGTCTGG - Intronic
993390033 5:87308447-87308469 CTTTTCTAGCAGTTCTTGATTGG + Intronic
993655837 5:90576937-90576959 CCTTTTGACCACTTTTTGATGGG + Intronic
993828626 5:92725234-92725256 GCTTTTTAGCAGTTTTGCTATGG - Intergenic
993855906 5:93074602-93074624 CCTTTATCACAGTATTTGTTTGG - Intergenic
994134602 5:96270894-96270916 CCATTCTAGCAGTTTATTTTTGG - Intergenic
994304216 5:98182204-98182226 TCCTTTTAGCAGTTCTTGTAGGG - Intergenic
994680824 5:102885162-102885184 CTTTGATGGCAGTTTTTGTTAGG - Intronic
994910674 5:105901977-105901999 CCTTTTTATTAGTTTTTATTTGG - Intergenic
995339064 5:111036202-111036224 CCTTTTTAGCAGTTTTATTGAGG + Intergenic
995607550 5:113873378-113873400 TCTATTTATCAGTCTTTGTTAGG - Intergenic
996074006 5:119167975-119167997 TCTTTATAACAGTTTTTGGTTGG + Intronic
998359083 5:141569124-141569146 CCTTTCTTGCAGCTTTTGTCTGG + Intronic
998748956 5:145296151-145296173 CCATTGTAGCAGGTTTTTTTTGG + Intergenic
1000472445 5:161661864-161661886 CCTTTTTACCATTTTTTCTTGGG - Intronic
1005198756 6:23319210-23319232 CCTTTTTAGCAGCCTTCATTTGG - Intergenic
1005241216 6:23830650-23830672 CTTTTTTAGTAATTTTTGTAGGG + Intergenic
1006048548 6:31320838-31320860 ACTTTATAGCTGTTTTTATTTGG - Intronic
1006532466 6:34668542-34668564 ACTTTTTATCAGTTTATTTTAGG - Intronic
1007920531 6:45605464-45605486 CATATTTAAGAGTTTTTGTTTGG - Intronic
1008790697 6:55228902-55228924 ACTTTTCAGCACTTTTTTTTGGG + Intronic
1008831956 6:55775345-55775367 CTCTTTTAGTAGTTTTTATTAGG + Intronic
1009556002 6:65167873-65167895 CCTTTTTAGCTGTGTTTTTTTGG + Intronic
1010312898 6:74408411-74408433 CCTTTACAGCAGTTTTTTTGAGG + Intergenic
1011255010 6:85411252-85411274 CCTTTTTATTAGTTTTTGCATGG + Intergenic
1011725303 6:90204938-90204960 GTTTTTGAGGAGTTTTTGTTTGG - Intronic
1013020048 6:106205574-106205596 CCTGTTTAGCATTTTTTTTCAGG - Intronic
1013504354 6:110784664-110784686 TTTTTGTAGAAGTTTTTGTTGGG - Intronic
1013978796 6:116105533-116105555 CCTTTTGTGCACTTTTTGTTTGG + Intronic
1016972705 6:149779339-149779361 CCTTTTAAGCAGTTTGTGGCAGG - Intronic
1017326100 6:153143072-153143094 TGTTTTTAGCAGTCTTGGTTGGG + Intergenic
1018090476 6:160342680-160342702 CCTATTTAGCATTTTCTTTTTGG + Intergenic
1020507567 7:9012710-9012732 TCTTTTTAGCATTTCTTGTAAGG + Intergenic
1020775457 7:12448927-12448949 CTTTTTGAGCAGTATTAGTTTGG - Intergenic
1021592449 7:22278430-22278452 ACTTTTTTGTGGTTTTTGTTGGG + Intronic
1023382011 7:39617921-39617943 AGTTTTTAGAAGTTATTGTTTGG - Intergenic
1024028681 7:45436575-45436597 AGTTTTCAGCAGTTTTTATTTGG - Intergenic
1024087500 7:45907852-45907874 ATTTATTAACAGTTTTTGTTGGG + Intergenic
1024853625 7:53750424-53750446 CCTTTTGTCCAGTTTTTATTAGG + Intergenic
1025147785 7:56519821-56519843 ACAATTTAGCAGTTTTTGTTAGG + Intergenic
1025168496 7:56734947-56734969 CCTGTCTAGTAATTTTTGTTTGG - Intergenic
1025703890 7:63844940-63844962 CCTGTCTAGTAATTTTTGTTTGG + Intergenic
1027126594 7:75560749-75560771 CATTTCTACCAGTTTTTATTTGG + Intronic
1027582334 7:80014201-80014223 TCTTTTTAGCATTTTTTGTAAGG + Intergenic
1028557075 7:92135840-92135862 CCTTTTAAGCAGTTTGTGTTGGG - Intronic
1028571635 7:92294452-92294474 CCTCTTCTGCAGTTCTTGTTTGG + Intronic
1028657724 7:93229820-93229842 CCTTTTAAAAAGTGTTTGTTAGG + Intergenic
1029927762 7:104335737-104335759 CCTATTTGGTAATTTTTGTTTGG + Intronic
1030322101 7:108179819-108179841 CCTTTCCAGGTGTTTTTGTTAGG + Intronic
1030869356 7:114735896-114735918 CCTTTTTAGCAATCTTGATTAGG - Intergenic
1030918265 7:115345199-115345221 ACTGTTTAGCATTTTTTTTTTGG - Intergenic
1032008616 7:128325675-128325697 CTTATTTAGCACTTTGTGTTAGG - Intronic
1032638122 7:133733550-133733572 CCTTTTTGCCACTTTTTGTAAGG + Intronic
1033926395 7:146466484-146466506 CCTTTCTATCAGTTTGTATTAGG - Intronic
1034814540 7:154160437-154160459 CCATTTTAGCATAGTTTGTTAGG - Intronic
1035796477 8:2362080-2362102 CCTTTTGAAGAGTTTTTCTTAGG - Intergenic
1035983447 8:4399254-4399276 CCTTTGTTGCTGTTTTTGTGGGG - Intronic
1036119546 8:6000859-6000881 GCTGTTTAGCAGGTTTTGTGTGG + Intergenic
1036397780 8:8383659-8383681 ATCTTTTAGCAGTTATTGTTAGG + Intronic
1037960823 8:23096758-23096780 CCTTTTAAGCAGTTTGTGGCAGG + Intronic
1038293213 8:26268120-26268142 CCTTTATGGCAGTTTTTATCAGG + Intergenic
1038987368 8:32827090-32827112 GCTTTTTTGCACTTATTGTTAGG - Intergenic
1039105766 8:33987898-33987920 ACTTTTTAGCAGGCTTTGTTTGG + Intergenic
1039630143 8:39102244-39102266 CTTTTTTAGCTGTTTTTGACGGG - Intronic
1039635604 8:39161402-39161424 GTTTTTTAGCAGTTTTTGGTGGG + Intronic
1039932409 8:42005831-42005853 CCTTTTCTGCAGTTGTTCTTTGG - Intronic
1040113172 8:43583005-43583027 GCTTTTTTCCAGTTTTTATTGGG - Intergenic
1040132521 8:43813885-43813907 CCTTCTTACTAGTTTTTGTCTGG - Intergenic
1041308810 8:56493010-56493032 CCTGTTTATCAGTTTGGGTTAGG - Intergenic
1041395957 8:57391417-57391439 CATTTTTAGTTGTTTTTATTAGG - Intergenic
1041677465 8:60549818-60549840 CCTTTCTAGAAGTTGTTTTTTGG + Intronic
1041910783 8:63086232-63086254 CCTGTTTAGCAGCTTTAGTTAGG + Intergenic
1042632316 8:70831551-70831573 CCTTTTTATCATCTTTTGGTGGG + Intergenic
1042790296 8:72597798-72597820 CTTTTTTAGCATTTTTGGGTTGG - Intronic
1044057400 8:87588152-87588174 CCTTTTTAGCTGTCTTATTTAGG + Intronic
1044338947 8:91024795-91024817 CCATGTGAGCAGTATTTGTTAGG + Intronic
1045210231 8:100089967-100089989 CCTTTTTAACTGTTTTTATCAGG - Intronic
1045930316 8:107617229-107617251 CCTTTTTTTCAGTTACTGTTTGG - Intergenic
1046421993 8:113998155-113998177 TCTTTTTAGCATTATTTGTGAGG - Intergenic
1046871538 8:119209343-119209365 CCTTTTTAGCACACTTTGTTGGG + Intronic
1047626734 8:126664437-126664459 CCTTTTTTCCAGTTTTTTTTGGG - Intergenic
1048289895 8:133172903-133172925 CATTTTTAGGAGATTTTGTCCGG + Intergenic
1050170617 9:2812108-2812130 CCTTTTCAGCAGTTTTAGAGAGG + Intronic
1051105958 9:13580658-13580680 CATTTTTTATAGTTTTTGTTCGG + Intergenic
1052036609 9:23688568-23688590 CGATTTTATCAGTATTTGTTTGG + Intergenic
1052794275 9:32908784-32908806 CATTTTTAGTAGTTTATTTTTGG - Intergenic
1055090466 9:72360361-72360383 ACTTTTTAATATTTTTTGTTTGG - Intronic
1055376754 9:75656986-75657008 CATTTTTAGATGATTTTGTTGGG + Intergenic
1056479358 9:86985271-86985293 TCTTTCTAGAAGTTTCTGTTGGG - Intergenic
1056750174 9:89344704-89344726 CCTTCTTAGCAGTTGCTGTAGGG + Intronic
1059066348 9:111089470-111089492 TCTTTTCTGCATTTTTTGTTTGG - Intergenic
1059287929 9:113193050-113193072 CCCTTTTTACAGTTTTTGTGAGG - Intronic
1185874459 X:3691135-3691157 CCTTTTAAGCAGTTTGTGGCGGG + Intronic
1187308903 X:18122078-18122100 CCTTTCTAGCAGCATCTGTTGGG + Intergenic
1187545540 X:20248169-20248191 CCTTTTTAGTGGATTTTCTTAGG + Intronic
1187751781 X:22474163-22474185 TCTTTTTTCCAGTTTTTATTGGG - Intergenic
1187855688 X:23634484-23634506 CCTATCTTGCTGTTTTTGTTAGG - Intergenic
1188563401 X:31496147-31496169 TCTTTTTATTACTTTTTGTTTGG - Intronic
1188613544 X:32129603-32129625 CCCTTATAGCAGTTTTTCTTTGG - Intronic
1191699946 X:64031125-64031147 CCTTTTTCGTTGCTTTTGTTTGG - Intergenic
1191705479 X:64089997-64090019 TCTTTTTAGCAATTTTTAATGGG - Intergenic
1192374142 X:70542019-70542041 CTTCTTTACCAGTTTTTGCTAGG - Intronic
1192816270 X:74596124-74596146 GCTTTTCAGGAGTTTTTGTTAGG - Intronic
1192982121 X:76355740-76355762 CATTTTGAGCAGTATTTGATGGG - Intergenic
1193580180 X:83254424-83254446 TCTTCTTAGCATTTTTTGTAGGG - Intergenic
1193617607 X:83709686-83709708 CCTTTATAGGTGTTTTTGTAAGG + Intergenic
1193937321 X:87638668-87638690 TCCTTTTAGCAGTTCTTGTAGGG - Intronic
1194489780 X:94531369-94531391 CCTTTGATGGAGTTTTTGTTGGG - Intergenic
1194497707 X:94637527-94637549 CCTCTTTATCATTTTTTATTGGG - Intergenic
1195235532 X:102893855-102893877 TCTTTTTTGCAGTGTTTCTTTGG + Intergenic
1195619747 X:106941288-106941310 CCTTTTTATCAGTTTTGGTGTGG - Exonic
1197136295 X:123064105-123064127 CATTTTTAGCAATTTATGCTAGG - Intergenic
1197141788 X:123125340-123125362 CCTTCTTTCCAGTTTTTTTTTGG - Intergenic
1197192040 X:123658377-123658399 CCTTTGTACAAGTTTTTGTGTGG - Intronic
1197371423 X:125630286-125630308 CCTTTTTAGCATTTCTTGTAGGG - Intergenic
1197730629 X:129806252-129806274 CCCTTTTAACTGTTTTTCTTTGG - Exonic
1197809069 X:130425450-130425472 TCTTTTCAGCAGTTTTACTTTGG - Intergenic
1198584052 X:138099585-138099607 CCTCTTGAGCATTTTTTGTAGGG - Intergenic
1198787710 X:140308119-140308141 CCCTTTTTGCATTTTTTGTAGGG - Intergenic
1199267817 X:145848816-145848838 CCTATGTAGAGGTTTTTGTTGGG - Intergenic
1199408337 X:147489533-147489555 CCTTTTTACCAGGTTATGATTGG - Intergenic
1200738346 Y:6826127-6826149 TCTTTCTAGCAGTTCTTGTAGGG + Intergenic
1201539149 Y:15087362-15087384 CCTTTTAAGCAGTTAATGGTGGG + Intergenic
1202389804 Y:24358207-24358229 ACTTGTTACAAGTTTTTGTTTGG + Intergenic
1202480980 Y:25311907-25311929 ACTTGTTACAAGTTTTTGTTTGG - Intergenic