ID: 929491173

View in Genome Browser
Species Human (GRCh38)
Location 2:42397925-42397947
Sequence TTAAAATCAAGAAGACGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 395
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 369}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929491169_929491173 16 Left 929491169 2:42397886-42397908 CCACTTAATTCTCACAACTCTAA 0: 1
1: 0
2: 2
3: 33
4: 350
Right 929491173 2:42397925-42397947 TTAAAATCAAGAAGACGGGCTGG 0: 1
1: 0
2: 1
3: 24
4: 369

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929491173 Original CRISPR TTAAAATCAAGAAGACGGGC TGG Intronic
901087133 1:6617722-6617744 TTAAAAGCAAGCAGACAGCCAGG - Intronic
901298338 1:8178543-8178565 TTAAATTCAAGATTAAGGGCAGG + Intergenic
901387237 1:8918940-8918962 TTAAAATAAAGAAAGTGGGCCGG + Intergenic
901664057 1:10816583-10816605 TTAAAAGCAGCAAGACTGGCAGG + Intergenic
903252507 1:22066206-22066228 TTAAAATCTATTAGAGGGGCTGG + Intronic
907543682 1:55240369-55240391 TAAAAATCAAGAGTACGGCCGGG - Intergenic
912921297 1:113869689-113869711 TTAAAATAATGTAGACTGGCCGG - Intronic
914794523 1:150908914-150908936 TTATTATCAAGAAAATGGGCTGG - Intergenic
915060751 1:153182472-153182494 TTAAAATCTAGATGATGGGTTGG - Intergenic
915778862 1:158522693-158522715 TTAAAATTTAGATGACGGGTTGG + Intergenic
916225389 1:162484893-162484915 TTAAAATTTAGAAGGCAGGCTGG - Intergenic
916298156 1:163243349-163243371 TTAAAACCTAGATGACAGGCCGG + Intronic
917938316 1:179891517-179891539 TAAAAATCAAGGAGAAAGGCCGG - Intronic
918013863 1:180613721-180613743 ATAAAATCAACATGAAGGGCAGG - Intergenic
919170000 1:193941834-193941856 TTAAAATGAAGAAAACAGGCTGG + Intergenic
923082806 1:230675132-230675154 CAAGAATCAAGACGACGGGCGGG - Intronic
924046777 1:240040204-240040226 TAAAAATCAGTAATACGGGCTGG - Intronic
1063454150 10:6171349-6171371 TAAAAATAGAGAAGAAGGGCCGG - Intronic
1064183178 10:13136981-13137003 TTAAAAGAAAGAAAACAGGCCGG + Exonic
1064292601 10:14049625-14049647 TTAAAATGAGGAAAACGGTCAGG + Intronic
1064901222 10:20297688-20297710 TTAAAATGAAAAAGGGGGGCAGG - Intergenic
1065021021 10:21501505-21501527 TTAAAATAAAGAAGAGGAGGAGG + Intergenic
1065721561 10:28633061-28633083 TAGAAATCATGAAGAGGGGCTGG + Intergenic
1065892383 10:30132192-30132214 AGAAAATCTAGAAGAAGGGCAGG + Intergenic
1067117063 10:43443668-43443690 TTAAAACAAAAAAAACGGGCCGG - Intronic
1069079750 10:64076012-64076034 TTTTAATCAGGAAGACAGGCTGG + Intergenic
1069172616 10:65252960-65252982 TTAAAATCAAGAAGAAATGTGGG + Intergenic
1069293547 10:66814444-66814466 TAAAATGCAAAAAGACGGGCTGG + Intronic
1069526634 10:69178037-69178059 TTGAAATCAGAAAGACTGGCTGG + Intergenic
1071986467 10:91055942-91055964 TTAAAATCAAGAATCTGGGCCGG - Intergenic
1072706020 10:97681581-97681603 TTAAAAAAAAGAATACGGCCGGG + Intronic
1073824395 10:107303955-107303977 GAAAAATCAAGAAGAAGGGCAGG - Intergenic
1074586067 10:114768426-114768448 TTCTTATTAAGAAGACGGGCGGG - Intergenic
1076215676 10:128691871-128691893 TTACAGTCAAGAAGAAGGGAGGG - Intergenic
1078274770 11:9833295-9833317 ATAAATGCAAGAAGACAGGCAGG + Intronic
1078772912 11:14367181-14367203 TTAAAAAGATGAAGACTGGCAGG + Intergenic
1078776768 11:14401009-14401031 TTAAAACCTAGATGACGGGTTGG + Intergenic
1079046140 11:17105479-17105501 TTAAAACCTAGATGACGGGTTGG - Intronic
1079421876 11:20300494-20300516 TTAAAATCAAGAGGAAGGCAAGG - Intergenic
1079662691 11:23060331-23060353 TTAAAGTCAAGATGACAGACAGG - Intergenic
1080370272 11:31630641-31630663 TTAAAATGAATAAAACTGGCTGG + Intronic
1080877120 11:36286251-36286273 CTAAAATTAAAAATACGGGCTGG + Intronic
1081900020 11:46619681-46619703 TTAAAAGCAAGAAATCGGCCAGG - Intronic
1082673590 11:56067758-56067780 TTAAAACCTAGATGACGGGTTGG - Intergenic
1082885101 11:58073735-58073757 TTAAAATCTAGATGACAGGTTGG - Intronic
1083026087 11:59552284-59552306 TTAAAAACAAGCAGACAGCCGGG + Intergenic
1084341739 11:68508423-68508445 TTAAAAACAAAAAGCCGGCCAGG - Intronic
1084688066 11:70708912-70708934 TTAAAATACACAAGAAGGGCAGG + Intronic
1085162019 11:74356644-74356666 ATAAAGTCAAGAAGACTGGGAGG + Intronic
1085476007 11:76789258-76789280 TTCAAATCCAGATGAGGGGCTGG + Intronic
1085705798 11:78786120-78786142 TTAAAATCAACAAAACCGGCAGG + Intronic
1086229756 11:84554448-84554470 TAAAAATAAAGAAAATGGGCCGG + Intronic
1086885920 11:92205417-92205439 TTTAAAACAAGAAAACTGGCTGG - Intergenic
1087324932 11:96710203-96710225 TTCAAATAAAAAAGATGGGCAGG - Intergenic
1087774058 11:102241704-102241726 TTAAAATCAAGAGCAAGGCCGGG + Intergenic
1088630162 11:111766535-111766557 CTGAACTCAAGAAGACGGGTGGG + Intergenic
1089827388 11:121291091-121291113 TTAAAACCTAGATGACGGGTTGG + Intergenic
1090368764 11:126230757-126230779 TCAGAATGAAGAAGGCGGGCTGG + Intronic
1091504298 12:1051391-1051413 TAGAAATAAAGAAGACTGGCTGG + Intronic
1093368660 12:18337376-18337398 TTAAAATCAACAACGCAGGCTGG - Intronic
1093576371 12:20735303-20735325 TTACAATCAAGAAACCTGGCAGG + Intronic
1093708970 12:22307565-22307587 CTAAAACCAGGAAGATGGGCTGG - Intronic
1095523304 12:43094413-43094435 TGAAAATCAAGTAAAGGGGCTGG + Intergenic
1095807978 12:46342296-46342318 TTAAAATCAAGAAGAAACTCTGG - Intergenic
1097945118 12:65358975-65358997 TTAAAATTAGGAAGAGGGGAGGG - Intronic
1097984873 12:65772374-65772396 ATAAAATGAAGAGGAAGGGCTGG + Intergenic
1100608188 12:96169262-96169284 TTTAAATCCATAAGACAGGCTGG + Intergenic
1100736981 12:97546283-97546305 TTTAAATCAAGGAAATGGGCTGG + Intergenic
1101172237 12:102110201-102110223 CTAAAATTAAAAAGACAGGCTGG + Intronic
1103589689 12:121982672-121982694 TTAAACTCAAGAATCCTGGCTGG - Intronic
1104367444 12:128190983-128191005 TTGAAATCAGGAGGAGGGGCTGG - Intergenic
1104988202 12:132609398-132609420 TAAAAATCATTAAGACGGCCCGG + Intronic
1105013397 12:132770929-132770951 TTAAAATCAAGAAATCGGGCCGG - Exonic
1105718875 13:23094291-23094313 TTAAAAGCAAGGAAACGGCCGGG + Intergenic
1106218047 13:27720579-27720601 TTAAAAGTAAGCAGATGGGCCGG + Intergenic
1107474204 13:40719573-40719595 TAAAAATCAAGTAGAAGGGCTGG - Intergenic
1107742289 13:43464199-43464221 TCAAAATCAACAAGAAGGTCAGG + Intronic
1108032166 13:46243670-46243692 TAAAAACCAAGAGGACGGGCTGG + Intronic
1108672599 13:52707188-52707210 TTAAAATAAAAAATACAGGCTGG - Intronic
1109876678 13:68414693-68414715 CTATAATCAAGAAGGCTGGCAGG - Intergenic
1111034151 13:82648609-82648631 AAAAAATCAAGAAAAGGGGCGGG + Intergenic
1112315922 13:98361965-98361987 TTAAAAACAAGTAAACGGGTTGG + Intronic
1112551978 13:100429978-100430000 TTAAAAAAAAGAAAACAGGCTGG + Intronic
1115177288 14:30577769-30577791 CTACAATCAAGGAGAGGGGCAGG + Intronic
1115756073 14:36526805-36526827 TTAAAATCAAGGAGCTGGACGGG - Intergenic
1116788217 14:49311159-49311181 TTAACATCACGAAGACAAGCAGG + Intergenic
1117359168 14:54956330-54956352 GTAAAAACAAGGAGAGGGGCAGG + Intronic
1118604923 14:67495778-67495800 ATAAAATCCAGAAGGCTGGCTGG - Intronic
1119275459 14:73351176-73351198 TTAAAATAAATAAGATGGCCGGG + Intronic
1119816990 14:77578418-77578440 TAAAAATAAAGAAGCCAGGCTGG + Intronic
1120168834 14:81228786-81228808 TTAAAACCAAGGTGTCGGGCGGG + Intergenic
1120912686 14:89682038-89682060 TTAAAATCTAGCAAACAGGCTGG + Intergenic
1120961088 14:90125517-90125539 TTAAAATTAAGTAGATCGGCTGG - Intronic
1121286824 14:92742581-92742603 TTAAAAACAGCAAGACAGGCTGG - Intronic
1122158431 14:99765238-99765260 TTAAAATGGTTAAGACGGGCTGG - Intronic
1124164448 15:27311773-27311795 TTAAAACCAAGAAAACAGGTTGG + Intronic
1124521353 15:30408610-30408632 TTAAAAACCAGACCACGGGCTGG - Intronic
1124537309 15:30557607-30557629 TTAAAAACCAGACCACGGGCTGG + Intronic
1124754839 15:32397625-32397647 TTAAAAACCAGACCACGGGCTGG - Intronic
1125655917 15:41357070-41357092 TTAAAAACAAGAAGAATGGCCGG + Intronic
1125961657 15:43835168-43835190 TTAAAAGCAAGATGCAGGGCCGG + Intronic
1126015383 15:44345554-44345576 TAAATATCAAGAAGAAAGGCTGG - Intronic
1128026926 15:64445974-64445996 TTCAACTCAAGAATAAGGGCTGG + Intronic
1128171765 15:65519637-65519659 TAAAAATCAAGAACTCTGGCCGG - Intergenic
1130527638 15:84721056-84721078 TTAAAAACATGAAGTCAGGCCGG - Intergenic
1130816833 15:87445115-87445137 TTAAAATCAAGAAAACAGAATGG - Intergenic
1131037023 15:89229526-89229548 TTAAAAACAAGAAGGCGGCTGGG + Intergenic
1132046405 15:98566324-98566346 TTAAAACCAAACAGACCGGCTGG + Intergenic
1132439303 15:101842644-101842666 TTAAAATTAGGAAGAGGGGGAGG - Intergenic
1132818342 16:1846858-1846880 TTAAAACCTAGATGATGGGCTGG + Intronic
1133603540 16:7363817-7363839 TAAACATCAAGAAGACTGACGGG - Intronic
1134098125 16:11432984-11433006 TTAAAATCTAGAACAAGGGTTGG + Intronic
1134479905 16:14609915-14609937 TAAAAAACAAGAAAAGGGGCTGG + Intronic
1135064179 16:19295497-19295519 TTAAAATCAAGAGTCCTGGCTGG - Intronic
1135965604 16:27032540-27032562 TTAAAACCCAGAAAACGGCCTGG - Intergenic
1138200626 16:55085587-55085609 TTAAAACCTAGAAGATGGGTTGG + Intergenic
1138756285 16:59490093-59490115 TTATAATGAAGAAGAAGGGGAGG + Intergenic
1140133728 16:72186814-72186836 TTAAAAGCAAGCAAACAGGCTGG + Intergenic
1140341409 16:74167821-74167843 TTAAAACCTAGATGACAGGCTGG - Intergenic
1141089252 16:81118779-81118801 GCAAAATCACGAAAACGGGCTGG + Intergenic
1141499257 16:84432368-84432390 TTAAAACCTAGATGACGGGTTGG - Intronic
1141866043 16:86750689-86750711 TTAAAATAAAGGAGAAGGCCAGG - Intergenic
1142671081 17:1487619-1487641 TTAAAATCTAGAGGGAGGGCCGG + Intronic
1143057742 17:4175034-4175056 TTAAAAGAAAGAACACAGGCCGG + Intronic
1143074909 17:4333379-4333401 GTAAAATGTAAAAGACGGGCCGG + Intronic
1143076037 17:4344242-4344264 CTACAATCAAGAAGCCCGGCCGG + Intronic
1143415075 17:6741210-6741232 TTAAAACCTAGATGACGGGTTGG + Intergenic
1143769536 17:9159503-9159525 TTAAAAACATGTAGAAGGGCTGG + Intronic
1144858223 17:18282697-18282719 TTAAGACCAAGAAGAATGGCGGG - Exonic
1145833447 17:27936153-27936175 TTGAAAACAAGAAGAATGGCCGG + Intergenic
1145948257 17:28794514-28794536 TTAAAATGCAAAAGACAGGCCGG - Intronic
1146012785 17:29208929-29208951 TTAAAACCTAGATGACGAGCTGG + Intergenic
1146800129 17:35812298-35812320 TTAAAAACATGAAGAACGGCTGG + Intronic
1147222757 17:38948509-38948531 TAAAAATCCAGAATAGGGGCGGG - Intronic
1147517508 17:41135085-41135107 TTAAAACCTAGATGATGGGCAGG + Intergenic
1147611143 17:41802547-41802569 TAAAAAAAAACAAGACGGGCCGG - Exonic
1148429401 17:47630035-47630057 TTAACATCAGGAAGTCAGGCTGG - Intergenic
1149065729 17:52477481-52477503 ATAAAATTATGAACACGGGCTGG + Intergenic
1149228337 17:54501930-54501952 TTAAAACCTAGATGACGGGTTGG - Intergenic
1149327293 17:55545074-55545096 TTTAAATAAATAATACGGGCCGG + Intergenic
1150390496 17:64787361-64787383 TGAAAATAAACAACACGGGCTGG - Intergenic
1150713106 17:67548292-67548314 TTAAAAGTAAGAACCCGGGCTGG + Intronic
1150752318 17:67876508-67876530 TTAAGATCAAGAACAGGGCCAGG + Intronic
1150970625 17:70023267-70023289 GTAAAATAAAGAAGTTGGGCTGG + Intergenic
1151753017 17:76052506-76052528 TTAAAACCTAGATGATGGGCTGG + Intronic
1152112323 17:78363944-78363966 TTAAAATTTGGCAGACGGGCTGG + Intergenic
1153387404 18:4512474-4512496 TTAAAATCCTGAAAAAGGGCCGG - Intergenic
1154371724 18:13769309-13769331 TAAAAATAAAAAAGAAGGGCTGG + Intergenic
1155060198 18:22221775-22221797 TTAAAATGAGGAAGATGGGCTGG + Intergenic
1155063575 18:22249698-22249720 TTAAAATGAAAAAGAAGGCCGGG - Intergenic
1155606609 18:27613374-27613396 TTAAAACCTAGAAGATGGGTTGG + Intergenic
1157126194 18:44958631-44958653 TTCACATCAAGGAGAAGGGCAGG + Intronic
1157904451 18:51556762-51556784 TTAAAAATCAGAAGACGGCCGGG - Intergenic
1158584306 18:58717582-58717604 TTAAAATAGAGAAGATAGGCTGG + Intronic
1159824380 18:73188697-73188719 GGAAAATCATGAAGAAGGGCAGG - Intronic
1160324798 18:77935370-77935392 TTAAAATAAAGAAAACTGACAGG - Intergenic
1161960142 19:7518766-7518788 TAAAAATAAAGAAGTGGGGCTGG + Intronic
1162647354 19:12059558-12059580 TTAAAAACAAGAAACCGGCCGGG - Intergenic
1162881331 19:13661951-13661973 TTAAAAACTTGAAGATGGGCAGG + Intergenic
1163985455 19:20943070-20943092 TTAAATTTAAGAATACTGGCTGG - Intronic
1165172055 19:33900533-33900555 TAAAAACCGAGAAGATGGGCCGG + Intergenic
1165243658 19:34485377-34485399 TTAAAATCAGGAAAGTGGGCCGG - Intronic
1165520957 19:36313455-36313477 TTTAAATCAAGGTGACAGGCTGG + Intergenic
1165583070 19:36886548-36886570 TTAAAATGAGGAAGAGGGCCAGG + Intronic
1165623116 19:37265131-37265153 TTTAAATCAAGGTGACAGGCTGG - Intergenic
1166112019 19:40628243-40628265 TTAAAATCAAGAACATAGCCGGG + Intronic
1166411632 19:42559465-42559487 TTCAAATAAAGAAGAGGAGCAGG + Intronic
1167969704 19:53181121-53181143 TTAAAATGGAGAAAATGGGCTGG + Intronic
1168148649 19:54433253-54433275 TTAAAATCAAGAATAAGCGGCGG + Intronic
925401671 2:3577610-3577632 TTAAAAGCAAGAAGAATGGCAGG - Intronic
925472879 2:4182110-4182132 TTAAAATCTAGGAAATGGGCTGG + Intergenic
925550053 2:5063856-5063878 TGAAAATCAAGCAGATGTGCGGG - Intergenic
927111385 2:19866119-19866141 TTAAAATAAAAAATACTGGCTGG - Intergenic
927377955 2:22440569-22440591 TTAAAACCTAGATGACGGGTTGG - Intergenic
927622893 2:24680996-24681018 TTAAAATCAAGGAAACTGGAAGG - Intronic
927806994 2:26156880-26156902 TTAGAAACCAGAAGACAGGCTGG + Intergenic
928937371 2:36693456-36693478 TAAAAATCAAGTAGTAGGGCCGG + Intergenic
929491173 2:42397925-42397947 TTAAAATCAAGAAGACGGGCTGG + Intronic
929811687 2:45194123-45194145 TTAGAAGCAAGAAGAGGGGAAGG + Intergenic
930794958 2:55379629-55379651 TAAAAATAAAGCAGAGGGGCTGG + Intronic
931397228 2:61898321-61898343 TAAAAATCAGCTAGACGGGCTGG + Intronic
931845086 2:66195360-66195382 ATAAAATTAAGAATACAGGCCGG + Intergenic
932280483 2:70487056-70487078 TTAAAAACAAGAAATAGGGCTGG - Intronic
933370482 2:81408798-81408820 TTAAAATTAGCCAGACGGGCTGG - Intergenic
935012106 2:99145062-99145084 CTAAAATCAAGATGTCAGGCAGG + Intronic
935603218 2:104943752-104943774 TTAAAATCAAGCAGAGGTGAGGG + Intergenic
935976951 2:108587495-108587517 TTAAAAACAAGAAAACGGCCAGG - Intronic
936364201 2:111837323-111837345 TTAAAAACAGCAAGAGGGGCCGG + Intronic
936445895 2:112594910-112594932 TTAAAATAAACAAAAGGGGCTGG - Intergenic
936730038 2:115371197-115371219 TTAAAATTCACATGACGGGCGGG - Intronic
937968490 2:127532655-127532677 TGGAAATCAAGAAGATGGGTTGG - Intergenic
938969094 2:136415940-136415962 CTAAAATGGAGAAGACGGGGAGG - Intergenic
939296843 2:140277287-140277309 TTAAGATTAAAAAGATGGGCTGG + Intronic
940139241 2:150475189-150475211 ATAAATTCAAGAAGAGGGCCAGG + Intronic
940241881 2:151572023-151572045 TTAAAATGTACAAGAAGGGCTGG + Intronic
940283216 2:152008594-152008616 GAAAAATAAAGAAGACTGGCTGG - Intronic
941873148 2:170406671-170406693 TAAGAGTCAAGAAGACGGGTGGG - Intronic
941945480 2:171092025-171092047 TTAAAAAAAAAAAGACGGCCGGG - Intronic
944065832 2:195618050-195618072 TTAAAAAGAAAAAGAAGGGCTGG + Intronic
944174534 2:196815262-196815284 TTAAAATCAAGAAACTGGCCAGG - Intergenic
944261447 2:197682231-197682253 TTAAAACCTAGAAGACAGGTTGG - Intergenic
944548161 2:200819089-200819111 TTAAAAACAAGAATATGGCCTGG + Intronic
944611172 2:201409999-201410021 TTAAAAACCTGAAGAGGGGCCGG + Intronic
946089099 2:217204932-217204954 TTAAAAGCAAGAAAACTGGCTGG - Intergenic
947016003 2:225620818-225620840 TTAAAATCTGGAAGAGGGCCAGG + Intronic
947609591 2:231515572-231515594 TTAAAATCAATAACAAGGACAGG + Intergenic
947811753 2:233009091-233009113 TAAAAATTATGAAGATGGGCCGG - Intronic
947858568 2:233341825-233341847 TTAAAATGATGAAGCTGGGCAGG + Intronic
948218535 2:236250759-236250781 TTAAAAGTAAGAAGCTGGGCAGG + Intronic
948400763 2:237683237-237683259 CTAAAATCAAGCCGACGGTCAGG + Intronic
949008213 2:241662778-241662800 TCAAAATCAATAAAGCGGGCCGG + Intronic
949008234 2:241662884-241662906 TCAAAATCAATAAAGCGGGCCGG + Intronic
1169318925 20:4615212-4615234 TTCAAATGAAGAAGTAGGGCAGG - Intergenic
1169372652 20:5040338-5040360 TAAAAATAAAAAAGAGGGGCCGG + Intergenic
1170852355 20:20016938-20016960 TTAAAAACAAAAAGAAGGCCGGG - Intergenic
1172129626 20:32647096-32647118 TTAAAATAAAGAACTAGGGCCGG + Intergenic
1172269524 20:33646294-33646316 TCAAAACCAAAAAGACAGGCCGG - Exonic
1172353813 20:34265089-34265111 TTATAATCAAGTAAACTGGCTGG - Intronic
1174656962 20:52179632-52179654 TCAAAATCAATCAGGCGGGCAGG + Intronic
1174687225 20:52467650-52467672 TTAAAACCTAGATGACAGGCTGG - Intergenic
1175628480 20:60510548-60510570 TTGAAATCACGAAGATGGTCAGG - Intergenic
1176361763 21:6002574-6002596 TTAAAAATAAGAAGAAGGCCAGG - Intergenic
1177006938 21:15685483-15685505 CTAAAATCAAGATGTCGGGAAGG + Intergenic
1178382265 21:32120722-32120744 TTAAAATCTATCAGACTGGCTGG + Intergenic
1178543401 21:33474331-33474353 TTAAAAAAAAGAAAACTGGCTGG - Intronic
1178565446 21:33679992-33680014 TTAAAAACAAAAGGATGGGCTGG - Intronic
1178591419 21:33914072-33914094 TTAAAATCAAGGTACCGGGCTGG - Intronic
1179253401 21:39693884-39693906 TTAAAATCAACAAGAGTGGAAGG - Intergenic
1179761755 21:43535976-43535998 TTAAAAATAAGAAGAAGGCCAGG + Intronic
1181688632 22:24545885-24545907 TAAAAATCAACAAAACAGGCCGG - Intronic
1182099776 22:27649699-27649721 CTAAAATCATGAAGATGGGTCGG + Intergenic
1183479216 22:38053798-38053820 TTAAAAAGAGGAAGACAGGCTGG - Intergenic
1183507412 22:38217028-38217050 TTAAAAGTAAGAAAACAGGCCGG + Intergenic
1183888494 22:40905373-40905395 TTAAAATCAATTAAAGGGGCCGG - Intronic
1184659065 22:45957385-45957407 TTAAAATACAGAAAACAGGCCGG + Intronic
949173375 3:1030003-1030025 TTAAAACCTAGATGACGGGTTGG - Intergenic
949328600 3:2895736-2895758 TTAAAATCAAAAGGAGGGGCTGG + Intronic
951141950 3:19172835-19172857 GTACAATCAAGAAGACTGGTGGG - Intronic
951408303 3:22328466-22328488 TTAAAATAAAAAAAACTGGCTGG + Intronic
951970016 3:28433468-28433490 TTTAAATAAAGAAAACAGGCTGG + Intronic
952182331 3:30930837-30930859 TTAAAATCTAGATGACGGGTTGG + Intergenic
953911335 3:46894559-46894581 TCACAATTAAGAAGAGGGGCTGG - Intronic
954006217 3:47593120-47593142 TTAAAACCAAGACTACGGCCAGG - Intronic
954268088 3:49485955-49485977 TTCAAAACAAGAAAACAGGCTGG - Intronic
955029540 3:55203091-55203113 TGAAAATCAAGAAAACGGCCTGG + Intergenic
955225816 3:57059698-57059720 TTAAAAAGACGAAGAGGGGCTGG + Intronic
955389248 3:58508235-58508257 TTAACAGCGAGAAGACGGGGAGG - Intronic
955771420 3:62388463-62388485 TTAAAAAAAAAAAGAGGGGCTGG - Intergenic
957775175 3:84749776-84749798 TTAAAAACAAGAAAATGGCCAGG - Intergenic
958952639 3:100433149-100433171 TTAAAACCTAGATGACGGGTTGG - Intronic
962035635 3:131648668-131648690 TTATAATCAAGAAGCAGAGCTGG - Intronic
962962695 3:140325663-140325685 TTAAAATAAAGAAGAGGAACAGG - Intronic
963264290 3:143224771-143224793 TGAAAATCAAGAACATGGACTGG + Intergenic
963748285 3:149148167-149148189 GTAAAATAAAAAAGATGGGCCGG - Intronic
965122747 3:164584201-164584223 TTAAAAGCTAGAATATGGGCCGG + Intergenic
965849547 3:173007319-173007341 ATAAAAACAAGAAGAAGGACAGG + Intronic
966599490 3:181761182-181761204 TTAAAATAAAAAAGAAAGGCTGG - Intergenic
968035952 3:195548055-195548077 TTAAAAGCAAGAATAGGGGATGG - Intergenic
968215115 3:196882798-196882820 TTAAAAACAACTAGACGGGCTGG - Intronic
969085585 4:4653716-4653738 TTAAAATCAAGGTGATTGGCTGG - Intergenic
969955525 4:10886230-10886252 TAAAACTCAAGAAGAAGGCCAGG - Intergenic
970014065 4:11493022-11493044 TAAAAATGAACAAGGCGGGCCGG + Intergenic
970501521 4:16681865-16681887 TTAAAATGAAGAATAGAGGCCGG - Intronic
971047433 4:22820638-22820660 TAAAAATGAAAAAGACAGGCTGG - Intergenic
972327402 4:38029660-38029682 TTAAAATGAGAAAGACGGCCAGG - Intronic
972908667 4:43785583-43785605 TAAAAAGAAAGAAGACAGGCCGG + Intergenic
973548351 4:52005336-52005358 TCAAAAACAAGAAAACAGGCTGG + Intronic
973631343 4:52823832-52823854 CTAAAATCAAGATGGTGGGCAGG + Intergenic
975421100 4:74165650-74165672 TTAAAATTAAGCACAAGGGCCGG - Intronic
976157105 4:82158017-82158039 TTAAAACCTAGATGACGGGTTGG + Intergenic
977955509 4:103020923-103020945 TTAAAAACAATAAAAAGGGCAGG - Intronic
980165226 4:129218052-129218074 TTAAAAACATAAAGACAGGCAGG - Intergenic
980239819 4:130159201-130159223 ATATAATCAAGAAAATGGGCAGG + Intergenic
981019617 4:140011637-140011659 ATAAAAACAAGAAAACGGCCGGG - Intronic
981306446 4:143251559-143251581 TTACACTCAAGGAGAAGGGCAGG - Intergenic
983203462 4:164887122-164887144 TTAAAATGAAGAAAACTGGCCGG - Intronic
983456420 4:167969948-167969970 TTAAAATCAAGCAGAAATGCTGG + Intergenic
983556860 4:169066799-169066821 TAAAATTCAAGATGACAGGCCGG - Intergenic
983726055 4:170927416-170927438 TTAAAAGGAAGAAGAGAGGCCGG - Intergenic
983771134 4:171550051-171550073 TTAAAATGAAGAAAAGTGGCCGG - Intergenic
985034412 4:185823828-185823850 TTTAAATCAACAAGTCAGGCTGG + Intronic
987389894 5:17366089-17366111 GTCAAATCAAGAAGACTGGTGGG + Intergenic
987590628 5:19921233-19921255 TTAAAAACAACAAAACAGGCCGG + Intronic
988415565 5:30942969-30942991 TTAAAATCTTGAGGACTGGCTGG + Intergenic
988746761 5:34147826-34147848 TTAAAAACAAAAACAAGGGCGGG + Intergenic
989623899 5:43411534-43411556 TTAAAAACAAAAAGAGGGGAGGG - Intronic
990367126 5:55082421-55082443 ATAAAATCAAGAAAATGGGTTGG + Intergenic
992018192 5:72596411-72596433 TTAAAACCATGAAGATGAGCTGG - Intergenic
992668413 5:79034384-79034406 TTAAAATCAAGAACACGATGCGG + Intronic
992696397 5:79292606-79292628 ATAATATAATGAAGACGGGCTGG - Intronic
993176860 5:84497612-84497634 TGAAAATCAAGAGGAAAGGCTGG + Intergenic
994230622 5:97307147-97307169 TTTATATCAAAAAGATGGGCTGG + Intergenic
995648383 5:114339504-114339526 TTAAAATGCAGGAGATGGGCTGG + Intergenic
997465841 5:134087556-134087578 TTAAAAACAAAAAGAGCGGCCGG + Intergenic
997973549 5:138424490-138424512 TTAAAAGCAAGGAGATGGCCAGG + Intronic
1000528195 5:162385168-162385190 TCAAAATTAAGAAGATGGCCAGG + Intergenic
1001131172 5:169064856-169064878 TTAAAATGAGGAGGTCGGGCTGG - Intronic
1001776467 5:174332492-174332514 TTAAAATCCAGCAGAAGGCCAGG + Intergenic
1002544503 5:179930740-179930762 TTAAAATCAAGAATGGAGGCTGG + Intronic
1002609926 5:180410307-180410329 TTAAGATCAGGAACAAGGGCTGG + Intergenic
1004333689 6:14744508-14744530 TTAAAAAAAAGAAGGCGGCCAGG + Intergenic
1004518699 6:16342177-16342199 TTAAAATCACTGAGACAGGCCGG - Intronic
1005229335 6:23682208-23682230 TTAAAATCATGAAGACATTCAGG - Intergenic
1006308402 6:33239387-33239409 TTAAAATCCACAGGATGGGCCGG - Intergenic
1006940690 6:37750301-37750323 TTAAAACCTAGATGAGGGGCTGG + Intergenic
1009368623 6:62875478-62875500 TTAGAATCAATATGACGGGCAGG - Intergenic
1009781831 6:68281062-68281084 TTAAAATCAAGAAGAAATTCTGG + Intergenic
1010561763 6:77359629-77359651 TTAAAATTAAGAAGGCTGGCCGG - Intergenic
1011445802 6:87437978-87438000 TTAAAAAGAAGAAAATGGGCTGG - Intronic
1011986480 6:93453339-93453361 TGAAAATCAAGAGGAAGGGTTGG - Intergenic
1013312193 6:108906119-108906141 TTAAAATTAAGATGACTGTCTGG - Intronic
1015093582 6:129387959-129387981 TTAAAACCTAGATGATGGGCTGG + Intronic
1015163999 6:130183077-130183099 TTGAAATCCAGGAGACAGGCAGG + Intronic
1016539994 6:145153789-145153811 TTAATATCAACTAGACTGGCAGG - Intergenic
1016849554 6:148603028-148603050 TTAAAATTTAGAAGACTGGCAGG - Intergenic
1017298123 6:152822887-152822909 TTAAAATGAAGAAAACGAACTGG + Intergenic
1018029317 6:159829777-159829799 CTAAAATCAAGAAGTCGGGGCGG + Intergenic
1019619440 7:1982969-1982991 CTAAAATCAAGCTGACAGGCTGG + Intronic
1022520459 7:31003462-31003484 GTAACATCAGGAAGAAGGGCTGG - Intergenic
1022921550 7:35021003-35021025 TTAAAATGAAGAATTAGGGCCGG - Intronic
1024269814 7:47633824-47633846 TTAAAAACAAGCAGACAGGCCGG - Intergenic
1024636507 7:51294988-51295010 TTAAAACCTAAATGACGGGCCGG + Intronic
1026039848 7:66859022-66859044 TTAAAAACAGTAAGACGGCCGGG - Intergenic
1027358161 7:77379864-77379886 CTCAAATCAAGAAGCCTGGCTGG - Intronic
1027642771 7:80757673-80757695 ATAAAATAAAAAAGACGGCCGGG + Intronic
1028481219 7:91307661-91307683 TTAAAAGCCAGAGGACTGGCAGG + Intergenic
1028512553 7:91641123-91641145 TTAAAATTTAGAAGAAGGACAGG - Intergenic
1028603606 7:92630150-92630172 TTAAAATTAAAAAGCTGGGCTGG + Intronic
1029194944 7:98798695-98798717 TAAAAATGGAGAAGAGGGGCCGG - Intergenic
1031710684 7:125042575-125042597 TTAAAACCTAGATGACGGGTTGG + Intergenic
1031747928 7:125528020-125528042 TTAAAATTATGAAGACAGGATGG - Intergenic
1033362077 7:140644943-140644965 TTAAAATAAAGAAACCAGGCCGG + Intronic
1033656518 7:143378870-143378892 TTAAAATGAAGACAATGGGCTGG - Intergenic
1034154842 7:148948319-148948341 TTAAAAACAAGAACCCAGGCTGG + Intergenic
1034189736 7:149204820-149204842 TTAAAATGAAGAAAGGGGGCTGG + Intronic
1034320952 7:150181371-150181393 TTAAAAATAAAAAGACAGGCCGG + Intergenic
1034558811 7:151866803-151866825 TCAACTTCCAGAAGACGGGCAGG - Intronic
1034580532 7:152038064-152038086 AGAAATTGAAGAAGACGGGCTGG - Intronic
1034762805 7:153689251-153689273 ATAACATCAAGAAAACAGGCTGG - Intergenic
1034771791 7:153785866-153785888 TTAAAAATAAAAAGACAGGCTGG - Intergenic
1035158104 7:156930532-156930554 TCCAAAACAAGAAAACGGGCTGG + Intergenic
1035873442 8:3160867-3160889 TTAAGAGCAAGAACAGGGGCTGG - Intronic
1037160966 8:15771790-15771812 TTAAAAAAAAGAAGAAAGGCCGG + Intergenic
1038314554 8:26472833-26472855 TGAAAATCATTAAGACAGGCTGG + Intronic
1038557068 8:28529213-28529235 TTAAAAGAAAGAAGAGAGGCTGG - Intronic
1038830868 8:31058830-31058852 TTAAAATGCTGAAGACCGGCTGG - Intronic
1041197875 8:55419087-55419109 TGAAAACCAAGAAGAGGGCCAGG + Intronic
1041351826 8:56954737-56954759 TTTAAATTAGGAAGACGGCCGGG + Intergenic
1041359938 8:57042428-57042450 TTTAAATAAAGAAGTCTGGCCGG + Intergenic
1042378571 8:68084791-68084813 TTAAAAGGAAGAAGACAGACTGG + Intronic
1042883177 8:73517119-73517141 TTAAAATGAAGAAACTGGGCAGG + Intronic
1043951644 8:86316146-86316168 TTAAATTCAAGAAGAAGAGCTGG + Intronic
1044740985 8:95326317-95326339 TTAGAAACAAGAAGACTGACTGG + Intergenic
1044923200 8:97187349-97187371 TCAAAATCTACAAGACAGGCTGG - Intergenic
1045843217 8:106603755-106603777 TAAAAATCAAGAACAGGGCCGGG + Intronic
1047665899 8:127090622-127090644 TTAAAATCAAGAAGTTGGCAGGG - Intergenic
1047665947 8:127091268-127091290 TTAAAATAAAGAAGAGGAACAGG - Intergenic
1049936680 9:506173-506195 TTAAAATGAGGGAGAAGGGCTGG - Intronic
1053207398 9:36198378-36198400 TTAAAAGCAACAACACAGGCCGG + Intronic
1053234894 9:36444502-36444524 TAAAAATCAAGAAAAAGGCCAGG + Intronic
1053448250 9:38170080-38170102 TTAAAAGCAGGAAGATGGCCGGG + Intergenic
1055928482 9:81535373-81535395 TTAAAATAAAGAAGACTTTCAGG - Intergenic
1056060591 9:82881862-82881884 ATAAAATGAAGGAGAAGGGCCGG + Intergenic
1057571450 9:96207182-96207204 TTAAAATCACCCAGACGTGCTGG + Intergenic
1057953713 9:99390582-99390604 TTAAAAACATCAAGAAGGGCTGG + Intergenic
1058479594 9:105377950-105377972 TTAAAATCTAGTAGAGGGCCGGG + Intronic
1059054604 9:110966182-110966204 TTAAAACCTAGATGATGGGCCGG + Intronic
1059371812 9:113846335-113846357 TTAAGATCAAGAACAAGGGAAGG - Intergenic
1059881101 9:118689820-118689842 TTAAAATCAAGAAGTCAGGAAGG + Intergenic
1061097652 9:128468926-128468948 TTAAAATAAAGAACATAGGCTGG - Intronic
1061136710 9:128738678-128738700 TTAAAAAAAAGAAGAAGGTCAGG - Intronic
1061145818 9:128797810-128797832 TAAAAATTAAGAAAACGGCCAGG + Intronic
1061730912 9:132613395-132613417 TTAAAATTAAGAAGAGCGGCCGG + Intronic
1062150096 9:135013743-135013765 TTAAAATGACAAAGACGGGTGGG + Intergenic
1185696238 X:2196851-2196873 TTATTATCAAGAAGAATGGCTGG - Intergenic
1186005603 X:5067123-5067145 TAAAAATCAAGATGAGGGCCTGG - Intergenic
1186765249 X:12763946-12763968 ATAAAATCAAGATGTCGGCCAGG + Intergenic
1187166334 X:16807454-16807476 TTAAAATCAGTAAAAGGGGCTGG - Intronic
1187592668 X:20735447-20735469 GAAAACTCAAGAAGAGGGGCTGG + Intergenic
1187867587 X:23738160-23738182 TCAAAAACAAAAAGACGGCCAGG - Intronic
1188478358 X:30611166-30611188 TTAAAAACGAGAAAACTGGCCGG + Intergenic
1189681881 X:43525639-43525661 TAAAAATCACAAAGACGGCCAGG + Intergenic
1189689113 X:43597113-43597135 TTATAATCAAGATGTCGGCCAGG + Intergenic
1189824272 X:44901083-44901105 TTAAAATTATGAGGACGGCCAGG + Intronic
1192096130 X:68213070-68213092 TAAAAATCAAATACACGGGCTGG + Intronic
1192377547 X:70579190-70579212 TTTAAATCAAGAAACTGGGCCGG + Intronic
1193145561 X:78072377-78072399 TTAAAAACAAAGACACGGGCCGG + Intronic
1193255898 X:79349193-79349215 TTAAAATCAAGAACAAGAGGGGG - Intergenic
1193460756 X:81788716-81788738 TTAAAATCTACATGATGGGCTGG - Intergenic
1193572158 X:83157217-83157239 TTAAAATCTAGATGACTGGTTGG + Intergenic
1193795759 X:85871014-85871036 TAAAAATGAAGAAATCGGGCCGG + Intronic
1193920816 X:87423872-87423894 TTAAAATCTAGATGATGGGTTGG - Intergenic
1194655262 X:96565495-96565517 TTATAATCAAGAAGGCTTGCAGG - Intergenic
1198234196 X:134721274-134721296 CTATAATCAAAAAGACAGGCTGG + Intronic
1198386098 X:136130950-136130972 TTAAAATCATGAGGCCGGCCAGG - Intergenic