ID: 929497028

View in Genome Browser
Species Human (GRCh38)
Location 2:42454061-42454083
Sequence AATCAGAACCACAATGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 429
Summary {0: 1, 1: 0, 2: 18, 3: 93, 4: 317}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929497025_929497028 7 Left 929497025 2:42454031-42454053 CCCAACATTATTAATCATCAGAA 0: 1
1: 4
2: 22
3: 124
4: 576
Right 929497028 2:42454061-42454083 AATCAGAACCACAATGAGGATGG 0: 1
1: 0
2: 18
3: 93
4: 317
929497026_929497028 6 Left 929497026 2:42454032-42454054 CCAACATTATTAATCATCAGAAA 0: 1
1: 7
2: 33
3: 169
4: 746
Right 929497028 2:42454061-42454083 AATCAGAACCACAATGAGGATGG 0: 1
1: 0
2: 18
3: 93
4: 317
929497024_929497028 29 Left 929497024 2:42454009-42454031 CCAATGAGCATATGAAAAGATGC 0: 3
1: 99
2: 710
3: 2182
4: 5296
Right 929497028 2:42454061-42454083 AATCAGAACCACAATGAGGATGG 0: 1
1: 0
2: 18
3: 93
4: 317

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929497028 Original CRISPR AATCAGAACCACAATGAGGA TGG Intronic
900892877 1:5462226-5462248 ATCCAGACCCACAATGAGTAGGG + Intergenic
901185289 1:7368958-7368980 AAACAGAAGCAGAAGGAGGAAGG - Intronic
902805313 1:18857660-18857682 AAGCAGATCCAGAATGAGGAAGG + Intronic
904218401 1:28943354-28943376 AATCAAAACTACAATGAGGCCGG + Intronic
904856933 1:33505487-33505509 AATTAAAACCACAATGAGGCCGG - Intergenic
905479099 1:38248967-38248989 AAACAGAAACAAAATGGGGAGGG - Intergenic
905853746 1:41293630-41293652 AAGCAGAACTACAGTGAAGAGGG - Intergenic
907561258 1:55390611-55390633 AATTAAAACCACAATGAGGTAGG - Intergenic
907915487 1:58865111-58865133 AAACTGAACCACAAAGATGAAGG + Intergenic
908724892 1:67164910-67164932 AATCAAAACTACAATGAGCTGGG + Intronic
911152394 1:94608158-94608180 AAAGAGATCCACAAAGAGGAAGG - Intergenic
915515714 1:156411321-156411343 CAGCAGAAGCACAATGCGGAGGG + Intronic
916024226 1:160820092-160820114 AATGTGGACTACAATGAGGATGG + Intronic
916117793 1:161502470-161502492 AACTAGAACCCCACTGAGGAAGG + Intergenic
916350549 1:163844844-163844866 ATTAAGAACCAATATGAGGAAGG - Intergenic
916356088 1:163910235-163910257 AATTAAAACCACAATGAGGCTGG + Intergenic
916928871 1:169553410-169553432 AATCAAAACCACAATGAGGCCGG + Intronic
917492147 1:175506765-175506787 AATCATCACAACAATGAGGCAGG + Intronic
920071218 1:203304676-203304698 GGTCCAAACCACAATGAGGAAGG + Intergenic
920410593 1:205757108-205757130 AATCAAAACCACAATGAGCCGGG - Intergenic
921573615 1:216807770-216807792 AAAGAGAACCAAGATGAGGATGG + Intronic
922243731 1:223774822-223774844 AAACAGAGCCACTGTGAGGAAGG - Exonic
923449063 1:234099150-234099172 TATCATAACCACAATGATGGAGG + Intronic
924172944 1:241360005-241360027 CATCAATACAACAATGAGGAAGG + Intergenic
924675105 1:246167805-246167827 AATCAAAACCACAATGAGGCTGG - Intronic
924742430 1:246802884-246802906 AATTATAACCACAAACAGGACGG + Intergenic
1064897031 10:20248716-20248738 AAACAGATCCACAATGACCATGG + Intronic
1065078898 10:22108424-22108446 AATTAAAACCACAATGAGGCCGG - Intergenic
1065502693 10:26397786-26397808 AATCAGAATCTGAATGAGGGTGG - Intergenic
1067150792 10:43731666-43731688 AAGCAGAAACAGAAGGAGGAAGG - Intergenic
1068515750 10:58023283-58023305 AGTCAGGACCCTAATGAGGAAGG - Intergenic
1068594947 10:58892746-58892768 AAGCAGAAGCACCTTGAGGAAGG - Intergenic
1068843136 10:61638451-61638473 AATTAAAACCACAGTGAGGCCGG - Intergenic
1068978534 10:63036457-63036479 AATCTGAACAACAAGGAGGGAGG + Intergenic
1069208675 10:65727998-65728020 AAAAAGAACAACAATGAGAAGGG + Intergenic
1069689148 10:70338194-70338216 AAACAGAAGGACAAGGAGGAGGG - Intronic
1070549009 10:77475981-77476003 AACCACAACCACAAAGAGAAGGG + Intronic
1070672621 10:78388650-78388672 ACTCAGAACCCCAAAGAGAAGGG - Intergenic
1072247259 10:93554743-93554765 AAGCAGAGCCACAAGGAGAAGGG - Intergenic
1072548190 10:96456744-96456766 AATCAGATCCACAATGTGCCAGG + Intronic
1073813781 10:107182398-107182420 AATCAAAACCACAGGAAGGATGG + Intergenic
1073976224 10:109104561-109104583 ATGCCCAACCACAATGAGGAGGG + Intergenic
1074212933 10:111354314-111354336 AATCAGAACCCCTGAGAGGAGGG + Intergenic
1075301490 10:121328596-121328618 AATCAAAATCACAGTGAGGCCGG - Intergenic
1075601607 10:123773276-123773298 AGTGATAACCACAATGAGGGAGG - Intronic
1075601620 10:123773339-123773361 AATGATGACCACAATGAGGGAGG - Intronic
1076020086 10:127065466-127065488 AACCACAACCACCATGAGGTGGG - Intronic
1077670057 11:4149113-4149135 AATCAAAACCACAATGAGGTAGG + Intergenic
1078277773 11:9867006-9867028 AATCAAAACCACAATGAGATGGG + Intronic
1078884083 11:15482523-15482545 AATGAGAACGACAGAGAGGAAGG - Intergenic
1079161595 11:18000059-18000081 CATCAGAACCACAATGCAGCAGG + Intronic
1080036123 11:27713304-27713326 AGCCAGAACAACAATGAGCATGG + Intronic
1081557345 11:44177458-44177480 AAACAGAAGTAAAATGAGGAGGG - Intronic
1082108488 11:48245654-48245676 AATCAGCAGACCAATGAGGAAGG - Exonic
1083045318 11:59729249-59729271 CAGGAGAACCACAATGAGGTGGG - Intronic
1084643625 11:70441383-70441405 AATCAAAACCACATGGAGGCTGG + Intergenic
1084695750 11:70754615-70754637 ACTCAGAACCCAAATGTGGAAGG - Intronic
1084908172 11:72365021-72365043 AATCAAAACCACAATGAGGCTGG + Intronic
1085141337 11:74145275-74145297 AATCAAAACCACAGTGAGAATGG - Intronic
1085363565 11:75915768-75915790 AAACAGAACCAAAAGGAGAAAGG - Intronic
1085613108 11:77971101-77971123 TATCAAAACCACAATGAGCTGGG - Intronic
1086671263 11:89550504-89550526 CATCAAAACCACAATGAGATAGG - Intergenic
1087193814 11:95284730-95284752 AGTCAGAACTACAATGAAGTTGG + Intergenic
1087789458 11:102391473-102391495 TGTCAGAACCACAAAGAGCATGG - Intergenic
1087852705 11:103050949-103050971 AATCAGACCCAGAATAAGGGGGG + Intergenic
1089031655 11:115336615-115336637 AATCAGAACCAAAATAAGTCAGG + Intronic
1089529715 11:119119341-119119363 AATCTGAATTAAAATGAGGATGG + Intergenic
1089536307 11:119162478-119162500 AATCAGAAGCAGAATGAGCCTGG - Exonic
1091033137 11:132209451-132209473 TATCTGAAGCTCAATGAGGATGG + Intronic
1093076810 12:14767524-14767546 AATCAAGACCACACTGAGGCTGG - Intergenic
1093206191 12:16253572-16253594 AATCAAAACCATAATGAGGCTGG + Intronic
1094285676 12:28790367-28790389 AGGCAGAACAACGATGAGGAAGG - Intergenic
1094714894 12:33003150-33003172 AATAAAAACCACAATGAAGCCGG - Intergenic
1095395579 12:41758604-41758626 CAACATAACCACAATGAGGTGGG - Intergenic
1095668889 12:44835209-44835231 AATCAGTACCACACAGAGGCAGG - Intronic
1097388465 12:58979630-58979652 AATCATAACCAGAATGTTGAAGG - Intergenic
1097425448 12:59438478-59438500 AATCAAAACTACCATGAGGTCGG - Intergenic
1100367754 12:93937094-93937116 CATCAGAACCACAGAGGGGAAGG + Intergenic
1100471365 12:94896319-94896341 AAGCAGAACCAGAATAGGGAAGG + Intergenic
1100650757 12:96585928-96585950 CATCAGAACCACACTTTGGATGG + Intronic
1100855616 12:98755016-98755038 CATCAGTACCACAAACAGGAGGG - Intronic
1102261900 12:111448038-111448060 ACTCTGAACCCCAGTGAGGAAGG - Exonic
1102360641 12:112284769-112284791 AATCAGAATCCCAAGAAGGATGG - Intronic
1102439612 12:112951045-112951067 AATTAGGATCACAAAGAGGATGG - Intronic
1103090885 12:118097315-118097337 AATCAAAACTGCAATGAGGCCGG + Intronic
1103094446 12:118121766-118121788 AATCAAAACCACAATAAGGCTGG + Intronic
1104168928 12:126261072-126261094 AATCAAAACCTCACTTAGGAGGG + Intergenic
1104178138 12:126352164-126352186 CATCAGAACCACCATGAGGTGGG - Intergenic
1104446207 12:128835745-128835767 AATCAAAACTACAATGAGGCCGG + Intergenic
1104622933 12:130331851-130331873 AATCAAAACCACACTGTGGGAGG + Intergenic
1104853072 12:131887708-131887730 AATCAAAACCACAGTCAGGCCGG + Intergenic
1105063752 12:133179025-133179047 AATTTAAACCACAATGAGGCCGG + Intronic
1105282205 13:18972782-18972804 AATCAAATACACAATGAGGGTGG + Intergenic
1105936550 13:25105827-25105849 AATTAAAACCACAATGAGGCCGG + Intergenic
1106036499 13:26050029-26050051 AATCAAAGCCACAAAGAGCAAGG + Intronic
1106069871 13:26399435-26399457 AATCAGAAACTCTGTGAGGAGGG + Intronic
1106561813 13:30853159-30853181 AGTCAAAGCCACAATGAGAAAGG + Intergenic
1106981165 13:35282619-35282641 AATCACAACAGCAATGAGTACGG - Intronic
1107695266 13:42993566-42993588 CATCAGAACCACTTGGAGGAGGG + Intergenic
1108078850 13:46711449-46711471 AATCATAATTAAAATGAGGATGG + Intronic
1108147412 13:47493247-47493269 AAACATGAACACAATGAGGAGGG + Intergenic
1108639312 13:52368006-52368028 AACCAAAAACACAATGAGGCTGG + Intergenic
1109390732 13:61688771-61688793 AAACAGAACAACAATAAGTAAGG + Intergenic
1109450492 13:62507674-62507696 AATAAAAACCACAATGAGATAGG - Intergenic
1110280771 13:73691887-73691909 AATCTGAACCATAATGAAAACGG + Exonic
1110701034 13:78549299-78549321 AACCAAAACCACAATGATGGGGG + Intergenic
1111215551 13:85135642-85135664 ACTCAGCAACTCAATGAGGAAGG + Intergenic
1111536006 13:89604113-89604135 GATTAGACCCAAAATGAGGATGG + Intergenic
1111809813 13:93085868-93085890 AAACAAAACCACAATGAGTAAGG + Intergenic
1111903131 13:94224556-94224578 AATCAGAACCATAAGGTGGATGG + Intronic
1113321454 13:109236304-109236326 AATGAGAAGCACAATGACTATGG + Intergenic
1114062163 14:19027724-19027746 AATCAAAACCACAATCCGGGAGG + Intergenic
1114100094 14:19372269-19372291 AATCAAAACCACAATCCGGGAGG - Intergenic
1114148156 14:20002789-20002811 AATCAGCACCACAAAGGAGATGG - Intergenic
1114319968 14:21539185-21539207 AATAAGACCCACAAGAAGGAGGG - Intergenic
1114970763 14:28025674-28025696 CATTAGAACCAAAATGAAGAAGG + Intergenic
1118566899 14:67151520-67151542 AAACAGAACCAAAATGAATACGG + Intronic
1119211261 14:72833883-72833905 AATCAAAACCACAATGAGGCCGG + Intronic
1120151785 14:81044361-81044383 AATCAAAACCACTATGAGGCCGG + Intronic
1120668029 14:87330335-87330357 AATGAGAATAATAATGAGGATGG - Intergenic
1122705440 14:103618009-103618031 AATTAAAACCACAAAGAGGCCGG + Intronic
1123494647 15:20813754-20813776 AATCAAAACCACAATCCGGGAGG - Intergenic
1123551142 15:21382847-21382869 AATCAAAACCACAATCCGGGAGG - Intergenic
1123792733 15:23738583-23738605 AGTTAAAACCACAATGAGGCCGG - Intergenic
1123910455 15:24960595-24960617 AATCAAAATCCCAATGAGGCAGG - Intronic
1126177334 15:45748888-45748910 AATTAAAACCACAATGAGATAGG - Intergenic
1126301137 15:47197377-47197399 AATCAGAAGAACAATTAGGATGG + Intronic
1126411806 15:48379948-48379970 GATCAGAAGCATAAGGAGGAGGG + Intergenic
1126442621 15:48707113-48707135 AATCAAAACCCTAATGAGAATGG - Intergenic
1126483434 15:49153357-49153379 AATCAAAACCACAATTAGAATGG + Intronic
1126770730 15:52053370-52053392 AATCAAAACCACAATGAGGCCGG - Intronic
1126963247 15:54022468-54022490 AATTAAAACCACAAAGAGGCTGG - Intronic
1127219202 15:56860195-56860217 AATTAAAACTACAATGAGGTTGG + Intronic
1127276561 15:57450570-57450592 AATTAAAACAACAATGAGGCTGG - Intronic
1127307116 15:57718236-57718258 AAATAAAACCACAATGAGGCCGG - Intronic
1127531792 15:59850677-59850699 GATCAGAACCAAACTCAGGAGGG - Intergenic
1127679530 15:61279747-61279769 AACCAGAACCACACAGTGGAAGG + Intergenic
1129024322 15:72554961-72554983 AATCAAAACCACCATGAAGGCGG - Intronic
1129338560 15:74869628-74869650 AACCAAGACCTCAATGAGGATGG - Intronic
1129600446 15:76995340-76995362 AATCAGCAGCAAAATGAGGAAGG - Exonic
1130007536 15:80114544-80114566 AATGAGAACCACAGTTGGGATGG + Intronic
1130328705 15:82903075-82903097 AATCAGAACTACAATTTAGAGGG + Intronic
1131129868 15:89891361-89891383 AATCAAAACCACAATGAGCTGGG + Intronic
1131905756 15:97140356-97140378 AATGAGCACCATAATGAGCACGG - Intergenic
1202959485 15_KI270727v1_random:110090-110112 AATCAAAACCACAATCCGGGAGG - Intergenic
1132980182 16:2734623-2734645 CATTAGAACCACAGTGAGGCCGG + Intergenic
1133597978 16:7311275-7311297 AAACAGAATCAAAATTAGGAAGG + Intronic
1133602087 16:7349593-7349615 CCTCAGAATCAAAATGAGGATGG + Intronic
1133668412 16:7993855-7993877 AATCAAAACCACAGTGAGGTCGG - Intergenic
1134801890 16:17092095-17092117 AATCAGAACAGCAAGGATGAAGG - Intergenic
1134802250 16:17095905-17095927 AATCAAAACTACTATGAGGCCGG - Intergenic
1135845262 16:25912939-25912961 AATCAGAATCACAAAGTGGAGGG + Intronic
1136486630 16:30576646-30576668 AATCAGAACTACAATGAAGCCGG - Intronic
1137345358 16:47652937-47652959 AATCAAAGCCACAATGAGGTTGG - Intronic
1138297693 16:55900932-55900954 AAACTGAAGCACAAAGAGGAAGG + Intronic
1138380489 16:56598314-56598336 AATTAAAACCACAATGAGGCCGG - Intergenic
1139114716 16:63936107-63936129 AAGCAGAAATACAATGAGTATGG - Intergenic
1140053527 16:71504226-71504248 AATCAAAACCAAAACGAGGCTGG + Intronic
1140891343 16:79287917-79287939 AATCGGAGCTACGATGAGGAGGG - Intergenic
1146107475 17:30053311-30053333 AATCAGAAACACATTTATGAAGG + Exonic
1146761049 17:35479106-35479128 ATTCAGAACCAGGTTGAGGAAGG - Exonic
1146987753 17:37237524-37237546 AACCAAAACCACAATGAGAGTGG - Intronic
1147200142 17:38795840-38795862 AATCAAAGTCACAATGAGGCCGG + Intronic
1147422551 17:40329748-40329770 AATCAAAAGCACAATGAGGCTGG - Intronic
1147958502 17:44151456-44151478 AACCAGAACCCCAAGGAGAAGGG - Intronic
1149628545 17:58098883-58098905 AATTAAAACCACAATGAGTGGGG - Intergenic
1150028385 17:61703356-61703378 AATCAAAACCACAATGTGGCTGG - Intronic
1150143490 17:62749768-62749790 ATTCAGAACCACTCGGAGGAGGG - Intronic
1150918326 17:69458403-69458425 AATCAGAATCCCAGTGGGGAGGG + Intronic
1150973363 17:70056100-70056122 AAACAGAATCAGACTGAGGAAGG + Intronic
1151652817 17:75480707-75480729 AATGAGGACCACACTCAGGAAGG - Intronic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1152439960 17:80300846-80300868 AATCAAAATCACAATGAGGCCGG - Intronic
1153478379 18:5521479-5521501 AAACAGCACCACGATGAGCATGG + Intronic
1153763850 18:8356501-8356523 AAACAGAAACACACTCAGGATGG + Intronic
1154281902 18:13010928-13010950 ATTCAAAACCACAATGAGGCTGG + Intronic
1154452047 18:14486271-14486293 AATCAAAACCACAATCCGGGAGG - Intergenic
1154957757 18:21276065-21276087 AAACAGAATGAGAATGAGGAAGG - Intronic
1155200544 18:23513736-23513758 AATCAAAACCACAATTAAGATGG - Intronic
1156011072 18:32498606-32498628 AGTCAGAAACAAAATGAAGATGG - Intergenic
1156581439 18:38381247-38381269 AGTTAGAACCACAGTGAGGCAGG + Intergenic
1157124368 18:44941940-44941962 AATGGGACCCACAATCAGGAGGG - Intronic
1157791831 18:50538972-50538994 AGTTAAAACCAAAATGAGGATGG - Intergenic
1160149524 18:76388494-76388516 TTTCAGATCCACAAGGAGGAAGG + Intronic
1161184206 19:2905467-2905489 AATCACAATCATAATTAGGAGGG - Intronic
1162664435 19:12197630-12197652 AATCAAAACTACAATGAGGCCGG - Intergenic
1164255562 19:23525124-23525146 AATCACAATCTCAATGTGGATGG + Intergenic
1165463211 19:35956810-35956832 AATCAAAACTACTATGAGGCCGG - Intergenic
1165557671 19:36648875-36648897 AGTCACAACCACAATGAGGCTGG - Intronic
1166793554 19:45412453-45412475 AATCAAAACTACAGTGAGGCTGG - Intronic
927069272 2:19508952-19508974 TATCAGAACCTCACTCAGGAAGG - Intergenic
927403967 2:22746982-22747004 AATCCAAACCACAAAGAAGAGGG - Intergenic
927659176 2:24977959-24977981 AACCATAACCACACTGAAGAAGG - Intergenic
929270856 2:39970383-39970405 AATCAGAACCTCTATGGGTAAGG - Intergenic
929497028 2:42454061-42454083 AATCAGAACCACAATGAGGATGG + Intronic
929958471 2:46478670-46478692 AATCCCACCCACATTGAGGAGGG - Intronic
930141605 2:47956301-47956323 AATCAAAACCACAATGGGGCAGG + Intergenic
930395514 2:50818943-50818965 AATCAAAACCACAAGGAGGAGGG + Intronic
930515264 2:52399755-52399777 AATTAGATCCAGAAGGAGGAAGG - Intergenic
931737571 2:65210921-65210943 AATTAAAACCACAATGAGGCCGG - Intergenic
932134951 2:69220214-69220236 AATCTGAGCCACAAAGAGGAAGG - Intronic
932512985 2:72313979-72314001 ACTGAGAACCACATTGAGAAAGG + Intronic
932888101 2:75565256-75565278 AATCAGAATCTCTATGAGTAGGG + Intronic
933277828 2:80302485-80302507 CACCAGGACCACGATGAGGAAGG + Exonic
934748613 2:96776907-96776929 AATTAAAACCACAATGAGGTGGG - Intronic
934900571 2:98156521-98156543 ACTCTGAACCACAAAGAGCAGGG - Intronic
935271584 2:101439107-101439129 AATTAAAACCACAATGAGGCCGG - Intronic
935418188 2:102840600-102840622 AATTAAAACAAAAATGAGGAAGG + Intronic
936280049 2:111131082-111131104 TATCAGAACCTTAATTAGGAAGG + Intronic
936495527 2:113017322-113017344 AGTCAGAACCACAGGGAAGATGG + Intergenic
936806410 2:116337525-116337547 AATCATAAAAATAATGAGGAGGG + Intergenic
936891392 2:117373922-117373944 AAGAAAAACCACCATGAGGAGGG + Intergenic
937073231 2:119081669-119081691 AATCAAAACCACAGTGAGGATGG - Intergenic
939434878 2:142162605-142162627 AATTAAAACCACAATGAGGTTGG + Intergenic
939826415 2:147021108-147021130 AATCAGTACCCCATTGAAGAAGG + Intergenic
941388045 2:164877490-164877512 AACCAGAACCATGATGAGGGTGG + Intergenic
941418901 2:165257832-165257854 AATCAAAACCACAATGAGGCTGG - Intronic
941807734 2:169725839-169725861 AATCAAAACTACAATTAGGCAGG + Intronic
942579136 2:177397581-177397603 AATGCAAACCACAATGAGGTTGG - Intronic
944429536 2:199618001-199618023 AATCAGAACATGAATGTGGAAGG + Intergenic
944980585 2:205115224-205115246 AATCAGAACCAGGAAAAGGAAGG - Intronic
945396473 2:209324844-209324866 AATCATAACCATAAAGAGCAAGG + Intergenic
946382120 2:219355849-219355871 GATCAAAACCACAATTAGGCTGG + Intergenic
947385930 2:229590531-229590553 AATCCTAACCACCATGATGATGG + Intronic
947706614 2:232281635-232281657 AATCAGAACCACAAAAGGGAGGG + Intronic
1169103637 20:2974680-2974702 AATCAAAACCAAAATGAGGCCGG - Intronic
1169205271 20:3736300-3736322 AATCAGAATCAGAAGAAGGATGG - Intronic
1170282119 20:14661260-14661282 AATCAAAACCACAACGAGATAGG - Intronic
1172284169 20:33729519-33729541 AAACACAAACACAATAAGGAAGG - Intergenic
1172380890 20:34490372-34490394 AATCAAAACCACAGTGAGGCTGG + Intronic
1174665881 20:52257279-52257301 AATCAAAACCCCATTGAGGCCGG + Intergenic
1174923231 20:54727644-54727666 AAGGAGAAAAACAATGAGGATGG - Intergenic
1175465505 20:59188369-59188391 AATCAAAACCACAATGAGATAGG - Intergenic
1175607038 20:60319502-60319524 CAACAGAACCGCAAGGAGGAAGG - Intergenic
1176822146 21:13667068-13667090 AATCAAAACCACAATCCGGGAGG + Intergenic
1177353233 21:19972247-19972269 AATCAAAACTACGATGAGGCTGG - Intergenic
1177403603 21:20637907-20637929 AATCTTAACCTCAATGATGATGG - Intergenic
1177713311 21:24807734-24807756 ACTCAGAACCACACAGAGAAAGG + Intergenic
1178699092 21:34818468-34818490 ATTCAGAACCAGAAGGAGGGGGG - Intronic
1180480652 22:15750350-15750372 AATCAAAACCACAATCCGGGAGG + Intergenic
1180920788 22:19520604-19520626 GACCAGAGCCACAATGGGGACGG - Exonic
1182250571 22:28996942-28996964 GATCAAAACCCCAATGAGGATGG - Intronic
1182606348 22:31507776-31507798 AATCAAAGCCACAATGAGGCTGG + Intronic
1182607256 22:31515677-31515699 AATAGGAATCACAATGAGGCTGG - Intronic
1182817906 22:33183260-33183282 AATCAAAACCATAATGAGATAGG + Intronic
1183237284 22:36629026-36629048 AATCAGAAATACAATGTTGAGGG + Intronic
949691415 3:6644161-6644183 AAGCAAAACCACAATAAGAATGG + Intergenic
949856951 3:8470544-8470566 AATAAGAAAGACAATGAGGATGG + Intergenic
950574209 3:13821628-13821650 ACTCAGAAACACAGTGTGGAGGG + Intronic
950651070 3:14406997-14407019 AATCAGAACCTCCAGGGGGATGG + Intronic
952954215 3:38546772-38546794 GATCAAAACTACAATGAGGCCGG + Intergenic
953052463 3:39358073-39358095 AATCAAAACTACAATGAGGCTGG + Intergenic
953301793 3:41784512-41784534 AATCACAACCACAATGAGAGGGG - Intronic
954349483 3:50030996-50031018 AATCAAAACCACAATGATATAGG + Intronic
955370374 3:58346209-58346231 AATCTGAACAACAGTGAGGGGGG + Intronic
955601618 3:60651950-60651972 ACTCATAACCACAAAGAGAATGG + Intronic
955902586 3:63773252-63773274 AATAAGAGCAACAATGAGGTAGG + Intergenic
956661862 3:71606844-71606866 AGTTAAAACCACAATGAGAACGG + Intergenic
956685023 3:71818345-71818367 AATTAAAACCACAGTGGGGAGGG - Intergenic
959132504 3:102374587-102374609 AATCAGAACAGCAAGGAGGATGG - Intronic
960286470 3:115835608-115835630 AATCAAAACCACAATGAGAAAGG + Intronic
960319709 3:116219877-116219899 AATCAAAATCACAATGAGCCGGG + Intronic
960796862 3:121496474-121496496 AATCAGTACCTTAATGAGAAAGG + Intronic
961445814 3:126980967-126980989 AGTTAAAACCACAATGAGGCTGG + Intergenic
961581970 3:127890781-127890803 AATCAGAATCAGAATGAGTCAGG - Intergenic
962702301 3:138011564-138011586 AAAGAGAACCAGACTGAGGAGGG + Intronic
962784695 3:138757107-138757129 CATAAAAACCACAATGAGGCTGG + Intronic
964366428 3:155955281-155955303 TATCAAAACCACAATGAGGCTGG - Intergenic
964458495 3:156895316-156895338 AATCAAAACCACAATGAGGCTGG + Intronic
964699579 3:159550352-159550374 AATCAGAACTAAAAGGAGAAAGG - Intronic
965276069 3:166684252-166684274 AATCAAAACCACAGTGAAGCTGG - Intergenic
965667529 3:171111124-171111146 AATTAAAACCACAATGAGCCAGG + Intronic
965830691 3:172784714-172784736 AAGCAAAACCAGAATGTGGACGG + Exonic
968237876 3:197048172-197048194 AACCAAAACCATAATGAGGCTGG + Intronic
970556033 4:17233241-17233263 AATCAGAACAACAATGATACTGG + Intergenic
971285562 4:25285837-25285859 AATCAAAACTACAGTGAGGCTGG - Intergenic
971381861 4:26106539-26106561 CATCCGAGCCACAATCAGGAAGG - Intergenic
971922966 4:32968073-32968095 AAGCAAAACCACAATGAAGCTGG + Intergenic
971943841 4:33249532-33249554 AATCAGAATCACACTGGAGAGGG + Intergenic
972763478 4:42130182-42130204 AATCAAAACCACAATGAGGCTGG + Intronic
974044826 4:56890014-56890036 AATCAAAACCACAATGAGGCCGG + Intergenic
974753145 4:66167546-66167568 AATTATAACCAAAATGAGTATGG - Intergenic
975290373 4:72671180-72671202 GGTCAGAACCATAATCAGGAAGG + Intergenic
976136450 4:81942538-81942560 AATCAAAACCTAAATGAGGCCGG + Intronic
976995096 4:91421812-91421834 AAAAAAAACCACAATGAGAAAGG + Intronic
978209574 4:106119938-106119960 AATCAAAACCACAATGTGAGAGG + Intronic
978710968 4:111780636-111780658 AATCAAAACCACAATGAGGCTGG + Intergenic
978852298 4:113353749-113353771 AAGCAGAAACAAAAAGAGGAAGG + Exonic
979452212 4:120885835-120885857 GATCAGAACCACAAAGGGAATGG + Intronic
979581869 4:122370361-122370383 AATTAAAACCACAATGAGGCTGG + Intergenic
980333127 4:131435257-131435279 AATTAAAACCACAATGAGATAGG - Intergenic
981611699 4:146600138-146600160 CAACAGAACCACAATGATGAAGG - Intergenic
982230163 4:153201258-153201280 AATCAAAAACACAATGAGGCTGG - Intronic
982691926 4:158558216-158558238 AATGAGGACACCAATGAGGAAGG - Intronic
984184823 4:176531137-176531159 AAGCAGAACCCCAATGAGCTAGG - Intergenic
985085061 4:186304902-186304924 AATGAGACCCAAAATGAGAAAGG - Intergenic
986259740 5:6133973-6133995 ACCCAGAACCACCATGGGGAAGG + Intergenic
988187152 5:27880767-27880789 AATCAGAACAACTAGAAGGAAGG + Intergenic
989324946 5:40181449-40181471 AGTCAAAACCACAATGAGAAAGG + Intergenic
989538126 5:42587403-42587425 AATCAAAACCAAAAAGAGAAAGG - Intronic
990947524 5:61264407-61264429 AAACAGAACCCCAAACAGGAAGG + Intergenic
993746878 5:91611003-91611025 AATCATAACCCCAAACAGGAAGG - Intergenic
995230981 5:109763076-109763098 AATCTGATCCACAATCAGAAGGG - Intronic
995516181 5:112956154-112956176 AATCAGAACTTCAGTAAGGAGGG + Intergenic
995526735 5:113056112-113056134 AATCAGAACCAATAGGAGGTGGG - Intronic
995695459 5:114874117-114874139 AAACAGAACCTCAGTGTGGATGG + Intergenic
995732164 5:115257214-115257236 AATAAGAACAACAAGAAGGATGG + Intronic
995809262 5:116086255-116086277 GATCAGAACCAAAGTGAGGCAGG - Intronic
995964436 5:117887224-117887246 AATCAAAACCACAATAAGGTAGG - Intergenic
996044108 5:118850948-118850970 AATCAAAACCACAATGGGGCTGG + Intronic
996306757 5:122055770-122055792 AATTAAAAACACAATGAGGATGG + Intronic
996430568 5:123371602-123371624 AACTAGAACCACAGGGAGGATGG + Intronic
996491709 5:124105657-124105679 AATAGGGACCAAAATGAGGAGGG + Intergenic
997609103 5:135199579-135199601 ATTCAGAACCACACTGATGTGGG - Intronic
998936720 5:147236795-147236817 AATCAGAAAGAGAAAGAGGAAGG - Intronic
999754655 5:154655358-154655380 TTTTAGAACCCCAATGAGGAAGG + Intergenic
1001168797 5:169396541-169396563 AATCAAAACCACAATGACACCGG - Intergenic
1001324715 5:170714064-170714086 AATCAGAGACACCATGAGGGAGG + Intronic
1001759461 5:174195244-174195266 AATCAGAACCACCATGAGACTGG + Intronic
1003145740 6:3508847-3508869 AAACAGAAGAAAAATGAGGAGGG - Intergenic
1003982078 6:11399476-11399498 AATCAAAACCACAATGAGCTGGG + Intergenic
1004440764 6:15650576-15650598 AATCAAAACCACAATGAGGCCGG - Intronic
1005526963 6:26660236-26660258 AATCAGAAACATAATCAGCAAGG - Intergenic
1005875774 6:30008603-30008625 AATGATACCCACAATGGGGATGG - Intergenic
1006476592 6:34259208-34259230 AATCAGAACCACAATGGGTCAGG + Intergenic
1006553423 6:34844569-34844591 AATCAAAACTACAATGAGGCTGG - Intronic
1006601997 6:35232423-35232445 AATCAGATCTACAATGAGAGTGG - Intronic
1006703164 6:35993727-35993749 AATAAAAACCACAATTAGGTTGG + Intronic
1007829056 6:44624490-44624512 AATGAGAACCTGAAGGAGGAGGG + Intergenic
1008003565 6:46386300-46386322 AATCAAAACCACAAGGAGGCCGG + Intronic
1008200921 6:48589149-48589171 ACTCAGAAGGACAAAGAGGAAGG + Intergenic
1008219622 6:48839668-48839690 TATCAAAACCACACTGAGCAAGG - Intergenic
1008326394 6:50187350-50187372 AGGCAGAATGACAATGAGGATGG - Intergenic
1008384363 6:50871510-50871532 AAGCAAAACCAAAATGAAGATGG - Intergenic
1009309185 6:62127803-62127825 AATCATAACCAGAATGTTGAGGG - Intronic
1011330284 6:86197307-86197329 AATGAGAATCACAATGAGGGGGG + Intergenic
1011666215 6:89636975-89636997 AATCAAAACTACTATGAGGTCGG - Exonic
1012538841 6:100335795-100335817 GTCCAGGACCACAATGAGGAAGG + Intergenic
1012556002 6:100512366-100512388 AATCAGAACCTCAAGGAGGCGGG - Intronic
1014709067 6:124785430-124785452 AATCATACCAACAGTGAGGATGG - Intronic
1015421629 6:133017168-133017190 CATCAGAAGCCCAATTAGGAAGG + Intergenic
1015860206 6:137669252-137669274 ACTCAGACACACAATGAGAATGG - Intergenic
1016341979 6:143072085-143072107 AATTAAAACCACAATGAGCCAGG - Intronic
1016488447 6:144569707-144569729 GATCAGAGATACAATGAGGAAGG + Intronic
1016783439 6:147985496-147985518 AATCAGTATCACAATGATGAGGG - Intergenic
1017431248 6:154373361-154373383 AATCAAAACCACCATGAGGCCGG + Intronic
1017473424 6:154763157-154763179 AATGAAAAGCAGAATGAGGAGGG - Intronic
1017593479 6:156002827-156002849 AATCTGAACAATAATGAGTATGG - Intergenic
1018468733 6:164078204-164078226 AATCAGAATCCCAAAGAGGAAGG - Intergenic
1018683629 6:166284718-166284740 AACCAAGACCACAAAGAGGAGGG - Intergenic
1019363744 7:619756-619778 AAACAGAAGCACAAAGAAGAGGG - Intronic
1019367240 7:640464-640486 AATCAAAACCACAAAGAGGCTGG + Intronic
1020423759 7:8040188-8040210 AATTAAAACCACAATGAGGGAGG + Intronic
1021049154 7:15961056-15961078 AATCAAAACCACAATGAGAATGG + Intergenic
1021064796 7:16159896-16159918 AATCAAAACCACAATGAGAATGG - Intronic
1022441759 7:30439018-30439040 AATCAAAACCACAATGAGACAGG + Intronic
1023521113 7:41050832-41050854 CATCAGGACCACGGTGAGGATGG - Intergenic
1024003006 7:45203282-45203304 AATGAGAACAACAAGAAGGAGGG + Intergenic
1024662132 7:51507133-51507155 AATCAAAACCACAATTAGAATGG - Intergenic
1026309103 7:69168297-69168319 ATTAAGAGCCAGAATGAGGACGG + Intergenic
1027550210 7:79583563-79583585 AATCAAAACCACAATGAGATGGG - Intergenic
1027917142 7:84339590-84339612 GCTCAGAACCACAATGATGGGGG - Intronic
1029702377 7:102255690-102255712 AATCAGAAGCACAGTGTGTACGG + Exonic
1029802489 7:102964012-102964034 AATTGAAACCACAATGAGGTCGG + Intronic
1031211981 7:118840921-118840943 AATTAAAACCACATTGAGAAAGG - Intergenic
1031637374 7:124118341-124118363 AATCAAAACTACAATGAGATAGG + Intergenic
1031651150 7:124291245-124291267 AATCAAAACTACAATCAGGCTGG - Intergenic
1031995460 7:128227487-128227509 AATCAGAAGCACCATCAGGAAGG - Intergenic
1032661240 7:133986145-133986167 AATCAGAATATCAATGAGCATGG + Intronic
1034711312 7:153193748-153193770 AACTAAAACCACAATGAGGCTGG + Intergenic
1035444347 7:158929596-158929618 AGTCACAACCACAGTGAAGAAGG - Intronic
1038225051 8:25648054-25648076 AATCAAAACCACAATGAGGCTGG - Intergenic
1038330952 8:26608962-26608984 ACTCAGAAACACAATGAGTGAGG - Intronic
1038439847 8:27564103-27564125 AATCAAAACCACAGTGAGAATGG - Intergenic
1038684725 8:29705877-29705899 AATTAAAACCACAATGAGACTGG - Intergenic
1039138764 8:34358498-34358520 AATCAGAACAGAAATGATGAAGG - Intergenic
1039580846 8:38665835-38665857 AATCAGAATCCCAGGGAGGAAGG - Intergenic
1039889976 8:41679170-41679192 AATCAGACACACAAAGAGGCAGG - Intronic
1040579191 8:48682365-48682387 AATCAGAACTATGATGAGCATGG - Intergenic
1043604664 8:81985786-81985808 AATCAAAACCACAATGAGATAGG - Intergenic
1044293040 8:90495172-90495194 AATTAAAAACACAATGAGGTAGG + Intergenic
1044657824 8:94566675-94566697 AATCAAAACCACAATGAGCCTGG + Intergenic
1045527577 8:102954395-102954417 AATTAAAACCAAAATGAGGCCGG - Intronic
1045784618 8:105905621-105905643 AAACAGAAGCAAAATGAGGAAGG + Intergenic
1046117490 8:109801499-109801521 AATCAGTACCAAATTGAGGAAGG - Intergenic
1047748225 8:127861000-127861022 TATCAGTACACCAATGAGGAGGG - Intergenic
1047847224 8:128819598-128819620 AATCAGAACCCCAATGGGAAAGG - Intergenic
1048105060 8:131398837-131398859 CATCAGAACCACATGAAGGAAGG - Intergenic
1048814154 8:138316208-138316230 AATTAAAACCACAATGAGGCCGG + Intronic
1049862286 8:144907680-144907702 AATAAAAACCACAATGAGGCTGG - Intergenic
1050186183 9:2976871-2976893 AATCAAAACCACAATTAAAATGG + Intergenic
1051876477 9:21799811-21799833 TATCACAGCCACAATGAGTAGGG - Intergenic
1051953826 9:22665116-22665138 AATTAAAACCACAATGAAGCCGG - Intergenic
1052726378 9:32232958-32232980 AATCAAAACCACGGTGAGGCTGG + Intergenic
1052919945 9:33957331-33957353 AACCATCACCACAATTAGGACGG + Intronic
1053116521 9:35509051-35509073 AATCAGAATCAGAATGAGGCTGG + Intronic
1055617789 9:78091208-78091230 AATCAGAACCAAAAAATGGACGG + Intergenic
1057471298 9:95359295-95359317 AATAAAAACCACAATGAGGCCGG + Intergenic
1059199459 9:112400620-112400642 AAACAGAACCACAAACTGGATGG + Intronic
1061327331 9:129872010-129872032 AATCAAAACCACAACGAGGCTGG - Intronic
1061722241 9:132559462-132559484 AATCAAAATCACAATGAGATGGG + Intronic
1061998620 9:134204289-134204311 AATCAGAAACAGAAGGAGCAGGG - Intergenic
1203525222 Un_GL000213v1:82498-82520 AATCAAAACCACAATCCGGGAGG - Intergenic
1186141692 X:6581352-6581374 AAACAGATTCACAATGAGCAAGG - Intergenic
1186519134 X:10189841-10189863 AGTCAGAACCAGAATCAGCAAGG + Intronic
1186540605 X:10396268-10396290 AATCACAACAACATTGAGGAAGG - Intergenic
1187087615 X:16057980-16058002 AATCAAAACCATAATGAGGCTGG + Intergenic
1187171479 X:16856232-16856254 AATTAAAACCACAATGAGCTGGG + Intronic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1188918461 X:35941585-35941607 AATCAGGATCATAAGGAGGAAGG - Intronic
1189189526 X:39088484-39088506 AATCAAAACTACAATGATGGGGG + Intergenic
1191075878 X:56452698-56452720 AATCAAAACCACAATGAGATAGG + Intergenic
1191096887 X:56682287-56682309 AATCAAAACCACAGTGAGGTAGG + Intergenic
1191815090 X:65235403-65235425 AAGCAAAACCACAATGAGGTAGG - Intergenic
1193117841 X:77792833-77792855 AATTAAAACCACAATCAGGCCGG + Intergenic
1194815592 X:98437583-98437605 AATCAAAACTACAATGAGAAAGG - Intergenic
1195805574 X:108761667-108761689 AATCAAAACCTCAATGAGGTTGG - Intergenic
1196362161 X:114874803-114874825 AATCAAAACCATAATGAGGCCGG - Intronic
1196583131 X:117398484-117398506 AATCAAAACTACTATGAGGCCGG + Intergenic
1197740390 X:129887919-129887941 AAACAAAACCACATTGATGAGGG + Intergenic
1198146791 X:133865757-133865779 AGTCTGAAGCACAATTAGGAGGG + Intronic
1198204487 X:134452936-134452958 AATCTGAAGCACAATTAGGGTGG + Intergenic
1198666958 X:139035209-139035231 GATCAGAACCACACTCAGAAAGG + Intronic
1198949433 X:142053953-142053975 AATTAAAACCACAATGAGGCCGG - Intergenic
1199340115 X:146667723-146667745 AATAAAAATCACAATAAGGATGG - Intergenic
1200086242 X:153608025-153608047 AATCAAAACTAGAATGAGGCTGG + Intergenic
1200312864 X:155097433-155097455 AATCAAAACCATAATGAGTTAGG + Intronic
1200760899 Y:7038245-7038267 AATAAGAACCACAGAAAGGATGG - Intronic
1201991906 Y:20036366-20036388 AATCAAAACCACAGTTAGAATGG + Intergenic