ID: 929505891

View in Genome Browser
Species Human (GRCh38)
Location 2:42527745-42527767
Sequence CTCAAGACACTGAGGTAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1425
Summary {0: 1, 1: 0, 2: 17, 3: 206, 4: 1201}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929505891 Original CRISPR CTCAAGACACTGAGGTAGGA GGG Intronic
900670317 1:3849368-3849390 CTCAGGAGGCTGAGGTAGGAGGG - Intronic
900825348 1:4921684-4921706 CACCAGACACTGAGGTAGTCAGG - Intergenic
900875149 1:5337186-5337208 CTCAAGAGGCTGAGGTGGGAGGG + Intergenic
900904102 1:5538727-5538749 CTTAAGAGGCTGAGGTGGGATGG - Intergenic
900937032 1:5772769-5772791 CTCAAGAGGCTGAGGTGGGAGGG + Intergenic
901006129 1:6172431-6172453 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
901046107 1:6396674-6396696 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
901312086 1:8277373-8277395 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
901441165 1:9279348-9279370 CACAGGAGACTGAGGTGGGAGGG + Intergenic
901487116 1:9571744-9571766 CTCAGGAGGCTGAGGCAGGAGGG - Intronic
901834435 1:11914864-11914886 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
902059711 1:13631823-13631845 CTCAGGAGACTGAGGTTAGAGGG - Intergenic
902262945 1:15240521-15240543 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
902276363 1:15342901-15342923 CTTGAGAGACTGAGGTGGGAGGG - Intronic
902324680 1:15692003-15692025 CTCAGGAGGCTGAGGCAGGAGGG + Intronic
902452420 1:16505511-16505533 CTGAAGACACCCAGGCAGGAAGG - Intergenic
902492478 1:16794591-16794613 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
902515859 1:16989317-16989339 CTCAAGAGGCTGAGGCAGGAGGG - Intronic
902545606 1:17187791-17187813 CTCAGGAGGCTGAGGTTGGAAGG + Intergenic
902591170 1:17475793-17475815 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
902972691 1:20065898-20065920 CTCAGGAGGCTGAGGCAGGAGGG + Intronic
902994933 1:20217056-20217078 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
903048783 1:20585591-20585613 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
903067241 1:20706986-20707008 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
903305617 1:22410791-22410813 CTCAGGAGGCTGAGGCAGGAGGG + Intergenic
903392437 1:22973914-22973936 CTCAGGAGGCTGAGGCAGGAGGG - Intergenic
903505278 1:23829900-23829922 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
903516925 1:23917321-23917343 CTCAGGAGGCTGAGGCAGGAGGG + Intergenic
903802942 1:25983274-25983296 CTCAGGAGGCTGAGGTAGGAGGG + Intronic
903921212 1:26802478-26802500 CTCGGGAGACTGAGGTGGGAGGG + Intergenic
903942967 1:26944314-26944336 CTCAGGAAGCTGAGGTGGGAGGG - Intronic
904080652 1:27870661-27870683 CTCAGGAGACTGAGGCAGGAGGG - Intergenic
904155686 1:28481134-28481156 GTCAAGAGGCTGAGGTGGGAGGG - Intronic
904206295 1:28857574-28857596 CTCAGGAGACTGAGGTGGGAGGG - Intronic
904790482 1:33016616-33016638 CTCCAGAGACTGAGGCGGGAGGG - Intronic
905078206 1:35293106-35293128 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
905393838 1:37654751-37654773 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
905398640 1:37685315-37685337 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
905598473 1:39229850-39229872 CTCAAGAGGCTGAGGTGGGAGGG - Intronic
905600202 1:39243507-39243529 CTCAGGAGTCTGAGGTGGGAGGG - Intronic
905640903 1:39589137-39589159 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
905766593 1:40606909-40606931 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
905821273 1:40993446-40993468 CTCAGGAGGCTGAGGCAGGAGGG - Intronic
905832789 1:41086660-41086682 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
906007450 1:42488419-42488441 CTCATGAGACTGAGGCAGGAGGG - Intronic
906121524 1:43395404-43395426 CTCAGGAGACTAAGGTGGGAGGG - Intronic
906408730 1:45562447-45562469 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
906494454 1:46294213-46294235 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
907011259 1:50965599-50965621 CTCCAGAGGCTGAGGTAGGAGGG + Intronic
907104228 1:51866112-51866134 CTCCAGAGGCTGAGGCAGGAGGG + Intronic
907149584 1:52271079-52271101 CTCAGGAGGCTGAGGCAGGAGGG + Intronic
907355884 1:53873568-53873590 CTCAGGACACTGAGGTGAGAGGG + Intronic
907399708 1:54217375-54217397 CTGAAGACACAGAGTCAGGAGGG - Intronic
907448993 1:54530293-54530315 CTCAGGAAGCTGAGGTGGGAGGG - Intergenic
908022902 1:59916623-59916645 CTCAGGAGGCTGAGGTGGGAAGG + Intronic
908076630 1:60526597-60526619 CTCAGGAGGCTGAGGTAGAAGGG - Intergenic
908409590 1:63849588-63849610 CTCCAGAGACTGAGTTGGGAAGG + Intronic
908455527 1:64300697-64300719 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
908561770 1:65313158-65313180 CTCAAGAGGCTGAGGCAGGAGGG - Intronic
909860379 1:80597338-80597360 CTCAGGAGGCTGAGGCAGGAGGG + Intergenic
910173576 1:84403892-84403914 CTCCAGAGGCTGAGGTGGGAGGG - Intronic
910330299 1:86065684-86065706 CTCAAGATGCTGAGGTGGGAGGG + Intronic
910584235 1:88861722-88861744 CTCAGGAGGCTGAGGCAGGAGGG + Intronic
910688908 1:89946207-89946229 CTCAGGAGGCTGAGGTTGGAGGG + Intergenic
910979621 1:92946645-92946667 ATCAAGAAACAGAGGTAGGCTGG + Intronic
911207677 1:95108753-95108775 CTCAAGTCAGTGGGGTAAGATGG - Intergenic
911487856 1:98525129-98525151 CTCAAGAGGCTAAGGCAGGAGGG - Intergenic
911611878 1:99967203-99967225 CTCAGGAGGCTGAGGCAGGAGGG + Intergenic
911625093 1:100114608-100114630 CTCCAAAGACTGAGGTGGGAGGG + Intronic
911847078 1:102767425-102767447 CTCAGGAGGCTGAGGTAGGAAGG - Intergenic
912928453 1:113933757-113933779 CTCGGGAGGCTGAGGTAGGAGGG + Intronic
913012772 1:114701080-114701102 TTCAGGAAACTGAGGCAGGAGGG - Intergenic
913023765 1:114813782-114813804 CTCAAGAAGCTGAAGTAGGAGGG - Intergenic
913226842 1:116708067-116708089 CTCAAAAGACAGAGCTAGGAGGG + Intergenic
913657448 1:120974883-120974905 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
913680071 1:121181514-121181536 CTCAGGAAACTCTGGTAGGAGGG - Intronic
913976421 1:143460611-143460633 CTCAGGAGGCTGAGGTAGGAGGG + Intergenic
914008797 1:143757965-143757987 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
914031905 1:143969167-143969189 CTCAGGAAACTCTGGTAGGAGGG - Intronic
914070821 1:144286226-144286248 CTCAGGAGGCTGAGGTAGGAGGG + Intergenic
914080855 1:144410410-144410432 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
914095714 1:144543091-144543113 CTGAAGACACCCAGGCAGGAAGG - Intergenic
914108334 1:144680128-144680150 CTCAGGAGGCTGAGGTAGGAGGG - Intergenic
914157539 1:145098800-145098822 CTCAGGAAACTCTGGTAGGAGGG + Intronic
914175769 1:145278942-145278964 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
914316510 1:146517830-146517852 CTCAGGAGGCTGAGGTGGGAAGG - Intergenic
914497846 1:148215531-148215553 CTCAGGAGGCTGAGGTGGGAAGG + Intergenic
914647427 1:149666618-149666640 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
914693943 1:150058399-150058421 CTCAGGAGGCTGAGGGAGGAGGG + Intergenic
914807270 1:151000884-151000906 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
915152261 1:153843400-153843422 CTCTAGTGGCTGAGGTAGGAGGG - Intronic
915381152 1:155441871-155441893 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
915609177 1:156977518-156977540 CTCAGGAGGCTGAGGCAGGAGGG - Intronic
915697747 1:157761499-157761521 CTCAGGAGACTGAGGTGAGAGGG + Intronic
916049143 1:161022929-161022951 CTCAGGAGGCTGAGGCAGGAGGG + Intronic
917343783 1:174007569-174007591 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
918003303 1:180518397-180518419 CTCAGGAGACTGAGGTGGGAGGG + Intergenic
918326004 1:183411409-183411431 CTCAGGAGGCTGAGGTGGGACGG - Intronic
918363900 1:183786294-183786316 TTCAGGAGACTGAGGTGGGAAGG + Intronic
918402767 1:184180275-184180297 CTAGAGATACTGAGGTGGGAGGG + Intergenic
918422066 1:184374230-184374252 CTCAAGAAGCTGAGGCAGGCCGG + Intergenic
918454161 1:184689722-184689744 CTCAAGAAGCTGAGGTTGGGAGG - Intergenic
918997065 1:191775162-191775184 CTCAGGAGGCTGAGGTGGGAAGG + Intergenic
919343376 1:196343276-196343298 CTAAAGCCACTGAGTTAGGCGGG - Intronic
919523451 1:198618124-198618146 CTCCAGAGACTGAGGCAGGCAGG + Intergenic
919733014 1:200926337-200926359 CTCAGGAGCCTGAGGTGGGAAGG - Intergenic
919740531 1:200978792-200978814 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
920467381 1:206200050-206200072 CTCAGGAAACTCTGGTAGGAGGG - Intronic
921405572 1:214775590-214775612 CTCAGGAAGCTGAGGTGGGAAGG + Intergenic
921791938 1:219300089-219300111 CTCAAGAGGCTGAGGTGGGATGG - Intergenic
922017002 1:221658258-221658280 CTCAGGAGGCTGAGGCAGGAGGG + Intergenic
922055593 1:222039553-222039575 CTCAGGAGACTGAGATAGGAGGG + Intergenic
922297514 1:224264353-224264375 CTCAGGAGGCTGAGGCAGGAAGG - Intronic
922305130 1:224337784-224337806 CTCAGGAGGCTGAGGCAGGAGGG - Intergenic
922429994 1:225541986-225542008 CTCAAGAGACTGAGGTGGGAGGG - Intronic
922431792 1:225562028-225562050 CTCAGGAGGCTGAGGCAGGATGG - Intronic
922638184 1:227198348-227198370 CTCAAGAGGCTGAGGTGGGAGGG + Intronic
922643276 1:227258065-227258087 CTCAGGAGACTGAAGTGGGAGGG + Intronic
922939700 1:229451289-229451311 CTCCAGAGGCTGAGGTAGGAGGG + Intronic
922976496 1:229788531-229788553 CTCAGGAGGCTGAGGTGGGAAGG + Intergenic
923123076 1:231012313-231012335 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
923152925 1:231250321-231250343 CTCGAGAGGCTGAGGCAGGAGGG + Intronic
923430412 1:233914398-233914420 AGCAAGACATTGATGTAGGAGGG - Intronic
923527970 1:234787941-234787963 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
923665671 1:235996547-235996569 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
923774217 1:236964076-236964098 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
923904010 1:238362343-238362365 CTCAAGAGGCTGAGGCAGGAGGG + Intergenic
924195739 1:241604945-241604967 CTCAGGAGGCTGAGGCAGGAGGG + Intronic
924227416 1:241933415-241933437 CTCAGGAGGCTGAGGTGGGATGG - Intergenic
924245041 1:242075638-242075660 CTCAGGACGCTGAGGCTGGAGGG - Intergenic
924257487 1:242197004-242197026 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
924415625 1:243853347-243853369 CTCAGGAGGCTGAGGCAGGAGGG - Intergenic
924446128 1:244133263-244133285 CTCAGGAGGCTGAGGTGGGAAGG - Intergenic
924720325 1:246616448-246616470 CTCGGGACACTGAGGTGGGAGGG + Intronic
924857125 1:247884679-247884701 CTCAAGAGACTGAGGTACGGGGG - Intergenic
1063206115 10:3832490-3832512 CTCAGGAGGCTGAGGTAGGAGGG + Intergenic
1063268030 10:4475551-4475573 CTCGGGAAACTGAGGTGGGAGGG + Intergenic
1063971150 10:11382075-11382097 CTCAGGAGGCTGAGGCAGGAGGG - Intergenic
1063997011 10:11629042-11629064 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1064066668 10:12188029-12188051 CTCAGGAAGCTGAGGCAGGAGGG + Intronic
1064071829 10:12236489-12236511 CTCGGGAGACTGAGGTGGGAGGG + Intronic
1064376445 10:14800859-14800881 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1064379561 10:14828915-14828937 CTCGAGAGGCTGAGGTGGGAGGG + Intronic
1064462011 10:15544188-15544210 CTCAGGAAGCTGAGGTGGGAGGG + Intronic
1064533912 10:16338641-16338663 CTCAGAAGACTGAGGTTGGAGGG + Intergenic
1065002158 10:21347007-21347029 CTCAGGAGTCTGAGGTGGGAGGG - Intergenic
1065113730 10:22464471-22464493 CTCAGGAGCCTGAGGTGGGAAGG - Intergenic
1065339166 10:24687106-24687128 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1065381122 10:25091543-25091565 CTCAGGAGACTGAGGTGGCAGGG - Intergenic
1065435769 10:25702623-25702645 CTCAAGAGGCTGAGACAGGATGG - Intergenic
1065764676 10:29016908-29016930 CTCAAGACACAGATGTACTAAGG - Intergenic
1065842527 10:29714850-29714872 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1065856238 10:29832563-29832585 CTCAGGAGGCTGAGGTAGGGAGG - Intergenic
1065961208 10:30735684-30735706 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1065984219 10:30933508-30933530 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1066084772 10:31965445-31965467 CTCAGGAGGCTGAGGTAGGAGGG + Intergenic
1066317474 10:34262372-34262394 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1066702483 10:38144868-38144890 CTCAAGAATCAGAGGTAAGAAGG + Intergenic
1066756352 10:38716484-38716506 AGCAAGACCCTGAGGAAGGAAGG - Intergenic
1066989984 10:42503845-42503867 CTCAAGAATCAGAGGTAAGAAGG - Intergenic
1067014077 10:42742736-42742758 CTGAAAACACTGATATAGGAGGG - Intergenic
1067097753 10:43313767-43313789 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1067134674 10:43597385-43597407 CTAGAGAGACTGAGGTGGGAGGG - Intergenic
1067136956 10:43618026-43618048 CTCCAGAGACTGAAGTGGGAAGG - Intergenic
1067141485 10:43660940-43660962 CTCAGGAAGCTGAGGTGGGAGGG - Intergenic
1067366161 10:45630856-45630878 CTCATGCCGCTGAGGCAGGAAGG + Intronic
1067736325 10:48854214-48854236 CTCAGGAGACTTAGGTAGGAGGG - Intronic
1068545427 10:58339211-58339233 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1068910386 10:62373812-62373834 CTCAGGACACTTGGCTAGGAAGG + Intergenic
1069489764 10:68851193-68851215 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1070074564 10:73122677-73122699 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1070085050 10:73228971-73228993 CTCAGGAGGCTGAGGTGGGAAGG - Intronic
1070797998 10:79228382-79228404 ATCAAGAGACTGGGGGAGGAGGG + Intronic
1070876856 10:79822369-79822391 CTCAGGACGTTGAGGCAGGAAGG - Intergenic
1070974331 10:80593915-80593937 CTCAGGAGACTGAGGTAGGAGGG - Intronic
1071545987 10:86529915-86529937 CTCAGGAGGCTGAGGTGGGAAGG + Intergenic
1071946515 10:90652041-90652063 GTGAAGACAGTGAGGTAGAAGGG + Intergenic
1071973725 10:90934009-90934031 CTCGAGATGCTGAGGTGGGAGGG + Intergenic
1072288452 10:93939955-93939977 CTCAGGAGGCCGAGGTAGGAGGG - Intronic
1072481317 10:95811493-95811515 CTCAGGAGGCTGAGGCAGGAGGG - Intronic
1072519504 10:96218584-96218606 CTCCAGAGGCTGAGGTGGGAAGG + Intronic
1073091173 10:100940941-100940963 CTCAGGAAGCTGAGGCAGGAGGG - Intronic
1073145092 10:101275382-101275404 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1073236488 10:102021182-102021204 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1073643210 10:105273893-105273915 CTCCTGAGGCTGAGGTAGGAAGG + Intergenic
1073719150 10:106146267-106146289 CTCAAGACTATGATGAAGGAAGG + Intergenic
1073849967 10:107603396-107603418 CTCAAGAGGCTGAGGTGGGAGGG + Intergenic
1074064066 10:109996806-109996828 GTCACACCACTGAGGTAGGAAGG - Intronic
1074134819 10:110617181-110617203 CTCAGGAGGCTGAGGCAGGAGGG + Intergenic
1074548796 10:114424009-114424031 CTCAAGAGGCTGAGGCGGGAAGG - Intergenic
1074812989 10:117124101-117124123 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1075076476 10:119354507-119354529 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1075116876 10:119634398-119634420 CTCAGGAGCCTGAGGTGGGAGGG - Intergenic
1075211321 10:120493661-120493683 CTAAACACACTGGGGTAGGATGG - Intronic
1075257770 10:120939182-120939204 CTGGTGACACTGAGGCAGGAGGG - Intergenic
1075547086 10:123363147-123363169 GGGAAGACCCTGAGGTAGGAAGG + Intergenic
1076891198 10:133284468-133284490 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1076896653 10:133316539-133316561 CTTAGGACACAGAGATAGGAAGG + Intronic
1077212288 11:1376961-1376983 CTCAGGAGGCTGGGGTAGGAGGG + Intergenic
1078002064 11:7505033-7505055 CTCAGGAGGCTGAGGTAGGAGGG - Intronic
1078200872 11:9181628-9181650 CTTGAGAGGCTGAGGTAGGAGGG + Intronic
1078260574 11:9703407-9703429 CTGAAGGCTCTGAGGCAGGAAGG - Intronic
1078582379 11:12548390-12548412 CTCATGTCCCTGAGGTGGGAGGG + Intergenic
1078599446 11:12717357-12717379 GTCAAGACACTCAGGAATGAAGG - Intronic
1078765036 11:14288086-14288108 CTCAAGAGGCTGATGTGGGAAGG - Intronic
1079001271 11:16758870-16758892 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1079165465 11:18037248-18037270 CTCGGGATACTGAGGTGGGAGGG + Intronic
1079934724 11:26602642-26602664 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1080010052 11:27449472-27449494 CTCAAAAGGCTGAGGCAGGAGGG + Intronic
1080389497 11:31831740-31831762 CTCAGGAGGCTGAGGTAGGAGGG - Intronic
1080556272 11:33420334-33420356 CTCTAGAAGCTGAGGTGGGAGGG - Intergenic
1080660782 11:34294220-34294242 CTCAGGAGGCTGAGGTGGGATGG + Intronic
1081291742 11:41334741-41334763 CTCCAGAGACTGAGGTGGCAGGG + Intronic
1081651994 11:44830387-44830409 CGCAAGACACTGGGGTGTGATGG - Intronic
1081828052 11:46077733-46077755 CTGAAGAATCTGAGGTAGGCAGG - Intronic
1081985816 11:47303344-47303366 CTCAGGAGGCTGAGGTAGAATGG - Intronic
1082011182 11:47450465-47450487 CCCAGGAGACTGAGGTGGGAGGG - Intergenic
1082771197 11:57208897-57208919 CTCAAGAGGCTGAGGCAGGAGGG + Intergenic
1082877220 11:58000638-58000660 CTCAAGAGGCTGAGGTGGGAGGG - Intergenic
1083496157 11:63055891-63055913 CTCAGGAGGCTGAGGCAGGAAGG - Intergenic
1083628251 11:64082841-64082863 CACCAGACACCGAGGTAGGCAGG + Intronic
1083809315 11:65094701-65094723 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1083868082 11:65469305-65469327 CTCAGGAGGCTGAGGCAGGAGGG - Intergenic
1083882496 11:65555445-65555467 GTGGAGACACTGAGCTAGGAAGG - Intronic
1084330824 11:68429143-68429165 CTCAAGAGGCTGAGGCAGGAGGG + Intronic
1084366315 11:68702788-68702810 CTCAGGAGGCTGAGGCAGGAGGG + Intergenic
1084427541 11:69093911-69093933 CTGAAGACAGTGAGGATGGACGG + Intergenic
1084499703 11:69528018-69528040 CTCAGGAGACTGAGGTGGGAGGG + Intergenic
1084716071 11:70874448-70874470 CTCAGGAGGCTGAGGCAGGAGGG - Intronic
1084991931 11:72933999-72934021 TTCAGGAGGCTGAGGTAGGAGGG + Intronic
1085042172 11:73333022-73333044 CTCAAGACAAAGAGGTTGGTGGG - Intronic
1085062332 11:73459189-73459211 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1085291995 11:75407574-75407596 CTCGGGAGGCTGAGGTAGGATGG - Intronic
1085469344 11:76747141-76747163 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1085745939 11:79114185-79114207 CACAAGACATTGAGAGAGGAGGG - Intronic
1086061433 11:82703578-82703600 GTGCAGACACTGAGCTAGGAGGG - Intergenic
1086081481 11:82907645-82907667 CTCAGGAGGCTGAGGTGGGAAGG - Intronic
1086103451 11:83125803-83125825 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1086900139 11:92358063-92358085 CTCAGGAAGCTGAGGCAGGAAGG + Intronic
1087032610 11:93720702-93720724 CTCAGGAGACTGAGGTGGGAGGG - Intronic
1087319482 11:96640362-96640384 CTCAAGACTGTGAGGAAAGAAGG - Intergenic
1087807633 11:102572229-102572251 CGCAAGACCTTGAGGTAGGTAGG - Intergenic
1088117737 11:106331915-106331937 CTCAGAAGACTGAGGTGGGAGGG - Intergenic
1088207343 11:107408327-107408349 GTAAAGGCACTGAGGCAGGAGGG + Intronic
1088259910 11:107934324-107934346 CTCAGGAGGCTGAAGTAGGAGGG + Intronic
1088482989 11:110313608-110313630 CTCAAGAGGCTGAGGTGGGCCGG + Intergenic
1088645991 11:111916960-111916982 CTCAGAAGGCTGAGGTAGGAGGG - Intronic
1088701827 11:112419873-112419895 CTCAAGAGGCTGAGGCAGAAGGG + Intergenic
1089225472 11:116917060-116917082 CTCAAGAGGCTGAGATGGGAGGG - Intronic
1089546229 11:119228213-119228235 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1089641956 11:119853614-119853636 CTCAGGAGACTGAGGTGGGAGGG - Intergenic
1090287265 11:125510778-125510800 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1090492994 11:127181893-127181915 CTCAGGAGACTGAGGTGGGAGGG + Intergenic
1090828467 11:130404500-130404522 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1090892257 11:130934371-130934393 CTCAAGAGGCTGAGATGGGAGGG - Intergenic
1091232515 11:133997940-133997962 AGCAAGACACCGAGGTGGGAAGG + Intergenic
1091291676 11:134443852-134443874 CTCAAGCCATTGGGGTAGGGGGG - Intergenic
1091477969 12:795993-796015 CTCAAGAGGCTGCGGTGGGAAGG - Intronic
1091742961 12:2973177-2973199 CTCAAGAGGCTGAGGTGGGAGGG - Intronic
1091748086 12:3005399-3005421 CTCAGGAAGCTGAGGCAGGAGGG - Intronic
1092133307 12:6127600-6127622 CTCAGGAGGCTGAGGTAGGAGGG + Intergenic
1092152002 12:6255653-6255675 CTCAGGAGGCTGAGGCAGGAGGG + Intergenic
1092267861 12:6996876-6996898 GTAAAGACACAGCGGTAGGAAGG + Intronic
1093075200 12:14751057-14751079 CTCAGGAGACTGAGGACGGAGGG - Intergenic
1093123575 12:15301507-15301529 CTCAAGAAACTGGGGTTAGAAGG + Intronic
1093157969 12:15710975-15710997 CTCAAGAGACTAAGTTAGGGAGG - Intronic
1093424449 12:19012201-19012223 CTCAGGAGGCTGAGGCAGGAGGG - Intergenic
1093454999 12:19356409-19356431 CTCAAGAAGCTGAGATAGGGTGG + Intronic
1093767188 12:22978510-22978532 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1093955849 12:25217784-25217806 CTCAAAAGGCTGAGGCAGGAGGG + Intronic
1094129477 12:27060113-27060135 CTCGAGAGGCTGAGGCAGGAGGG - Intronic
1094537184 12:31332195-31332217 ATCAGGACAATGAGGAAGGATGG + Intergenic
1094801680 12:34044769-34044791 CTCATGAAAGTGAAGTAGGAAGG - Intergenic
1095114813 12:38340675-38340697 CTCAGGAAAGTGAAGTAGGAAGG - Intergenic
1095219538 12:39593358-39593380 CTTAAGAGGCTGAGGTGGGAGGG - Intronic
1095524520 12:43109361-43109383 CTCAGGAGGCTGAGGCAGGAGGG - Intergenic
1095684835 12:45021972-45021994 TGCAAGACACTGTGGTAGGTAGG - Intronic
1095894321 12:47265336-47265358 CTCAGGAGGCTGAGGCAGGAGGG - Intergenic
1096000307 12:48124199-48124221 ATGAAGAAACTGAGGAAGGAGGG + Intronic
1096068897 12:48763279-48763301 CTCAGGAAGCTGAGGTGGGAAGG - Intergenic
1096084355 12:48855663-48855685 CCCAGGAGGCTGAGGTAGGAGGG + Intergenic
1096164942 12:49414708-49414730 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1096190824 12:49617434-49617456 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1096321717 12:50619951-50619973 CTCAGGAGGCTGAGGCAGGAGGG + Intronic
1096338472 12:50776202-50776224 CTCAGGAGGCTGAGGCAGGAGGG + Intronic
1096362743 12:51002238-51002260 TTCAAGAGACAGAGGTAGGAAGG + Intronic
1096410279 12:51372314-51372336 CTCGAGAGGCTGAGGTGGGAGGG - Intronic
1096645235 12:53030112-53030134 CTTAGGAGACTGAGGTAGGAGGG + Intronic
1096645257 12:53030270-53030292 CTTAGGAGACTGAGGTAGGAGGG + Intronic
1096688641 12:53306047-53306069 ACCAAGACACTGAGGTAAGGTGG + Exonic
1096696118 12:53349743-53349765 CTCAAGAGGCTGAGGTAGGCCGG + Intergenic
1096857545 12:54495610-54495632 CTCAGGAGGCTGAGGTGGGATGG - Intergenic
1096972210 12:55676134-55676156 CTCAAGAGGCTGAAGCAGGAAGG + Intergenic
1096988641 12:55780038-55780060 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1097051865 12:56228492-56228514 CTCAGGAGGCTGAGGCAGGAGGG - Intronic
1097122444 12:56745301-56745323 CTCAGGAGGCTGAGGTAGAAGGG + Intronic
1097797160 12:63875021-63875043 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1097801404 12:63918522-63918544 CTCAGGAGACTGATGTGGGAGGG - Intronic
1097921186 12:65076143-65076165 CTCAGGAGGCTGAGGCAGGAGGG - Intronic
1098349409 12:69541715-69541737 CTCGGGAGACTGAGGCAGGATGG + Intronic
1098357188 12:69622968-69622990 CTCAGGAGGCTGAGGCAGGAGGG - Intergenic
1098449149 12:70599860-70599882 CTCAGGAGGCTGAGGCAGGAGGG + Intronic
1098521655 12:71440261-71440283 GTGAAGACGCTGAGGTTGGAAGG - Exonic
1098529761 12:71528348-71528370 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1098903794 12:76140648-76140670 TTCAAGGCAGTAAGGTAGGAAGG - Intergenic
1099340874 12:81432342-81432364 CTCGTTACACTGAGGCAGGAGGG - Intronic
1099972585 12:89515375-89515397 CTCAAGGGGCTGAGGCAGGAGGG - Intronic
1100236240 12:92663839-92663861 CTCAAGAGGCTGAGATAGAAAGG + Intergenic
1100473881 12:94917900-94917922 ATTGAGACACTGAGGCAGGAGGG + Intronic
1100522058 12:95384757-95384779 CTCAGGAGGCTGAGGCAGGAGGG - Intergenic
1101039529 12:100740318-100740340 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1101133836 12:101718550-101718572 CTCAGGAGGCTGAGGCAGGAGGG + Intronic
1101212611 12:102549685-102549707 CTTGAGACACTGGGGAAGGAAGG - Intergenic
1101458493 12:104863325-104863347 TTCAAGAAACTGAGGCAGGAGGG + Intronic
1101463885 12:104926974-104926996 CTCAAGAGGCTGAGGTGGGAGGG + Intronic
1101466078 12:104950610-104950632 CTCAGGAGACTGAGGTGGTAGGG - Intronic
1101576695 12:106003945-106003967 CTCAGGAGGCTGAGGCAGGAGGG + Intergenic
1101685463 12:107015449-107015471 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1101928355 12:108991836-108991858 CTCAAAAGGCTGAGGCAGGAGGG + Intronic
1101928432 12:108992431-108992453 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1101939683 12:109090641-109090663 CTCAGGAGGCTGAGGCAGGAGGG - Intronic
1101977636 12:109375258-109375280 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1102019007 12:109668764-109668786 CTCAGGAGGCTGAGGCAGGAGGG + Intergenic
1102080829 12:110096796-110096818 CACAAGAGACTGAGGTGGGTGGG - Intergenic
1102102669 12:110292677-110292699 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1102318645 12:111911805-111911827 CACAAGAGGCTGAAGTAGGAGGG - Intergenic
1102397148 12:112596247-112596269 CTCAGGAGGCTAAGGTAGGAGGG - Intronic
1102836351 12:116064080-116064102 CTCAGGAGGCTGAGGTAGGAGGG + Intronic
1102845135 12:116172850-116172872 TGCAAGACACTGTGGCAGGAAGG - Intronic
1102994219 12:117335947-117335969 CTCAGGAGGCTGAGGCAGGAGGG - Intronic
1103060837 12:117857164-117857186 CTCAGGAGACTGAGGTGGGAGGG - Intronic
1103081358 12:118026489-118026511 CTCAGGAGGCTGAGGCAGGAGGG + Intronic
1103084261 12:118050090-118050112 CTCAGGAGGCTGAGGCAGGAGGG + Intronic
1103094726 12:118123607-118123629 CTCCAGAGGCTGAGGTAAGAGGG - Intronic
1103097372 12:118142950-118142972 CTCGGGAGCCTGAGGTAGGAGGG - Intronic
1103199309 12:119073726-119073748 CTCTGGAGGCTGAGGTAGGAGGG - Intronic
1103349521 12:120274152-120274174 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1103351860 12:120289449-120289471 CTCAGGAGGCTGAGGCAGGAGGG - Intergenic
1103544535 12:121690541-121690563 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1103654514 12:122459554-122459576 CCCAGGACACTGATGTTGGAGGG + Intergenic
1103755105 12:123198700-123198722 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1103842030 12:123872701-123872723 CTCAAGAGACTGAGGAAGAAGGG + Intronic
1104195282 12:126531239-126531261 CTCAAGAGGCTGAGGCAGGAGGG - Intergenic
1104583223 12:130026269-130026291 CTCAGGAGGCTGAGGCAGGAGGG - Intergenic
1104695254 12:130858692-130858714 CTCAGGAGTCTGAGGTGGGAGGG + Intergenic
1104976594 12:132554837-132554859 CTCAAGAGGCTGAGGAGGGATGG + Intronic
1104982186 12:132578235-132578257 CTCAGGAGGCTGAGGCAGGAGGG + Intronic
1104988989 12:132614196-132614218 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1105222815 13:18349205-18349227 CTCAGGAGGCTGAGGTAGGAGGG - Intergenic
1105284027 13:18989912-18989934 CTCAGGAGGCTGAGGCAGGAGGG + Intergenic
1105375955 13:19844727-19844749 CTCAGGAGACTGAAGCAGGAGGG - Intronic
1105527611 13:21190680-21190702 CTCAGGAAGCTGAGGTGGGAGGG - Intergenic
1105787981 13:23768625-23768647 CTCAGGAGGCTGAGGTAAGAAGG + Intronic
1106014111 13:25851948-25851970 CTCAGGAAACTGAGGCAGGACGG - Intronic
1106034609 13:26032386-26032408 CTCAGGAGGCTGAGGCAGGAAGG + Intergenic
1106177856 13:27346672-27346694 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1106282623 13:28289383-28289405 TTCAGGAGACTGAGGTGGGAAGG - Intronic
1106507795 13:30386695-30386717 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1106522587 13:30511043-30511065 CTCATCACACTGAGGTAATACGG + Intronic
1106736879 13:32597139-32597161 CTCAGGAGGCTGAGATAGGAGGG - Intronic
1107046452 13:35998048-35998070 CTAAAGCCACTGAGGAAGGTGGG - Intronic
1107423369 13:40270243-40270265 CTCTAGAGGCTAAGGTAGGAGGG - Intergenic
1108058455 13:46508715-46508737 CTTGGGAGACTGAGGTAGGAGGG - Intergenic
1109044761 13:57395310-57395332 CTCAAGACAGAGAACTAGGAGGG - Intergenic
1109158592 13:58943804-58943826 CCCATGAAACTGAGTTAGGAAGG - Intergenic
1109588796 13:64447521-64447543 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1110229080 13:73149699-73149721 CTCAGGAGGCTGAGGCAGGAGGG + Intergenic
1110323070 13:74182203-74182225 CTCAATTCACTGCGTTAGGAAGG + Intergenic
1112306031 13:98274404-98274426 CAGAAGAGACTGAGGGAGGAAGG + Intronic
1112435787 13:99390393-99390415 CTCCTGCCACTGAGGAAGGATGG + Intergenic
1113095791 13:106662691-106662713 CTCAGGAGACTGAGGCAGGAGGG - Intergenic
1113353934 13:109559671-109559693 CTCAGGAGGCTGAGGTGGGAAGG - Intergenic
1113475332 13:110576475-110576497 CTCCAGAGGCTGAGGCAGGAGGG + Intergenic
1113494783 13:110718306-110718328 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1113830857 13:113294666-113294688 CTTAGGACGCTGAGGTGGGAAGG + Intergenic
1113977679 13:114241940-114241962 CTCAGGAGGCTGAGGCAGGAGGG + Intronic
1114995681 14:28348993-28349015 CTTAAGACGCTGAGGTGGGAGGG - Intergenic
1115159446 14:30376992-30377014 CTCAGGAGGCTGAGGTGGGAAGG - Intergenic
1115247401 14:31310275-31310297 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1115374036 14:32652943-32652965 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1115579342 14:34742861-34742883 CTCAGGAGACTGAGGTGGGAGGG + Intergenic
1115637534 14:35304968-35304990 CTCAGGAGACTGAAGTGGGAGGG + Intronic
1116404490 14:44551378-44551400 CTCAGGAGGCTGAGGCAGGAGGG + Intergenic
1116847260 14:49876801-49876823 CTCAGGAGGCTGAGGCAGGAGGG - Intergenic
1117129736 14:52673843-52673865 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1117371092 14:55078984-55079006 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1117372958 14:55095638-55095660 CTCAGGAGGCTGAGTTAGGAGGG - Intergenic
1117701646 14:58419806-58419828 CTCAAGAGGCTGAGGTAGGAAGG + Intronic
1118028274 14:61793348-61793370 CTCAAGAGGCTGAGGCGGGAGGG - Intronic
1118203624 14:63701086-63701108 CTCTGGAGGCTGAGGTAGGAGGG - Intronic
1118214772 14:63798499-63798521 CTCGAGAGGCTGAGGCAGGAGGG - Intergenic
1118252263 14:64172823-64172845 CTCAGGAGGCTGAGGCAGGAGGG + Intronic
1118267417 14:64308120-64308142 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1118293546 14:64547918-64547940 CTCAGGAGACTGAGGCAGAATGG + Intergenic
1118352784 14:64985599-64985621 CTCAGGAGGCTGAGGCAGGAGGG + Intronic
1118832532 14:69447803-69447825 CTTAGGAGACTGAGGTGGGAGGG + Intronic
1119005588 14:70924693-70924715 CTCAGGATGCTGAGGTGGGAGGG - Intronic
1119114771 14:72009110-72009132 CTCAGGAGGCTGAGGCAGGAGGG + Intronic
1119462122 14:74815140-74815162 CTCAGGAGGCTGAGGCAGGAGGG - Intronic
1119523018 14:75300136-75300158 CTCAGGAGGCTGAAGTAGGAGGG - Intergenic
1119675071 14:76547506-76547528 CTCAGGAGGCTGAGGTAAGAGGG - Intergenic
1119829058 14:77684653-77684675 CTCAAGAGGCTGAGGTGGGGAGG - Intronic
1119841672 14:77798139-77798161 CTCCACAGACTGAGGCAGGAGGG + Intergenic
1119849619 14:77857912-77857934 CTAAAGCCTCTGAGGCAGGATGG - Intronic
1119988983 14:79173422-79173444 TTCAGAAGACTGAGGTAGGAGGG + Intronic
1120369649 14:83616717-83616739 CTCAAGAAAATGAGATAGGCAGG + Intergenic
1120808453 14:88777865-88777887 CTCAGGAGGCTGAGGTAGGAGGG + Intronic
1120977907 14:90265749-90265771 TCCAAGAGGCTGAGGTAGGAGGG + Intronic
1121410105 14:93743822-93743844 CTCAAGACACTTTGGTGGGCGGG - Intronic
1121677879 14:95769199-95769221 TGCAAGAGACTGTGGTAGGAAGG + Intergenic
1121726264 14:96153156-96153178 CAAAAGACACAAAGGTAGGAAGG + Intergenic
1121937305 14:98031837-98031859 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1122216773 14:100209723-100209745 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1122237211 14:100338371-100338393 CTCAGGAGGCTGAGGCAGGAAGG - Intronic
1122878657 14:104680155-104680177 CTGCACACACTGAGGTGGGAGGG - Intergenic
1123440616 15:20288556-20288578 AGCAAGACCCTGAGGAAGGAAGG - Intergenic
1123819984 15:24019101-24019123 CACAGGAGACTGAGGTGGGAGGG - Intergenic
1124025731 15:25963951-25963973 CTCGGGAGGCTGAGGTAGGAGGG - Intergenic
1124034693 15:26044431-26044453 CTCAGGAGGCTGAGGCAGGAGGG - Intergenic
1124207087 15:27730350-27730372 TTCAAGACACTGGGAAAGGAGGG + Intergenic
1124403221 15:29368767-29368789 CTCAGGAGGCTGAGGCAGGAGGG + Intronic
1124908781 15:33897772-33897794 CTTGAGAGGCTGAGGTAGGAGGG + Intronic
1124933620 15:34148478-34148500 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1124938315 15:34193742-34193764 CTCAGGACGCTGAGGCAGGAGGG + Intronic
1125479621 15:40070972-40070994 CTCGAGAGGCTGAGGTGGGATGG + Intergenic
1125493887 15:40171437-40171459 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1125503956 15:40256115-40256137 CTCAAGCGACTGAGGTGGGAGGG + Intronic
1125607610 15:40950368-40950390 CTCAGGAGACCGAGGCAGGAGGG - Intergenic
1125819916 15:42620371-42620393 CTCCAGAGGCTGAGGCAGGAGGG + Intronic
1125824171 15:42661550-42661572 CTCCAGAGGCTGAGGCAGGAGGG - Intronic
1125867974 15:43071987-43072009 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1125897041 15:43311177-43311199 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1125994131 15:44140773-44140795 CTCAAGAGGCTGAGGTAGGAGGG + Intronic
1126000311 15:44203414-44203436 CTCAGGAGGCTGAGGTAGGAGGG - Intergenic
1126612544 15:50544252-50544274 CTCAGGAGGCTGAGGCAGGAGGG + Intronic
1126626622 15:50691519-50691541 CTCAGGAGGCTGAGGCAGGAGGG + Intergenic
1127082274 15:55392626-55392648 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1127273149 15:57419037-57419059 CTCAGGAGGCTGAGGCAGGAAGG - Intronic
1127483301 15:59396909-59396931 CTCGAGAGGCTGAGGTGGGAGGG - Intronic
1128227363 15:66011376-66011398 ATGAAGACACTGAGGTCTGAAGG - Intronic
1128283574 15:66417461-66417483 CTTGAGAAACTGAGGTGGGAGGG + Intronic
1128486916 15:68101574-68101596 CTCAGGAGGCTGAGGCAGGAGGG - Intronic
1128521583 15:68378533-68378555 CTCAAGAGGCTGAGGCAAGAGGG + Intronic
1128544580 15:68558480-68558502 CTCAGGAGGCTGAGGCAGGAAGG - Intergenic
1128602675 15:69011025-69011047 CTCGGGAGACTGAGGCAGGAGGG + Intronic
1128802822 15:70507697-70507719 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1129027804 15:72595285-72595307 CTCAGGAGGCTGAGGCAGGAGGG - Exonic
1129099880 15:73251403-73251425 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1129274350 15:74435243-74435265 CTCAGGACTCTGAGGGAAGAAGG - Intergenic
1129395826 15:75245555-75245577 TTCAAGAGGCTGAGGTGGGAAGG + Intergenic
1129425643 15:75460577-75460599 CTCAAGAGGCTGAGGCAGGAAGG + Intergenic
1129503965 15:76065621-76065643 ATGAGGACACTGAGGTACGAGGG - Intronic
1129551102 15:76450298-76450320 ATCAAGACACTGAATTAAGAAGG + Intronic
1129786253 15:78312145-78312167 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1130283329 15:82536010-82536032 TTCAGGAGACTGAGGTGGGAGGG - Intergenic
1130308976 15:82736060-82736082 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1130315835 15:82795722-82795744 CTCAGGAGGCTGAGGTAGGAGGG + Intronic
1130343847 15:83023485-83023507 CTCAGGAGGCTGAGGCAGGAGGG - Intronic
1130377561 15:83343100-83343122 CTCAGGAGGCTGAGGTGGGAAGG + Intergenic
1130518220 15:84642572-84642594 TTCAAGAGGCTGAGGTGGGAGGG - Exonic
1130918189 15:88322423-88322445 CTCAGGAGGCTGAGGCAGGAGGG + Intergenic
1131139025 15:89962291-89962313 CTCAGGAGGCTGAGGCAGGAGGG - Intergenic
1131183956 15:90259280-90259302 CTCAGGAGGCTGAGGTGGGATGG + Intronic
1131240927 15:90742741-90742763 CTCAGGAGGCTGAGGTGGGAAGG - Intronic
1131611328 15:93967545-93967567 CTCCAGAGGCTGAGGTGGGAGGG - Intergenic
1131679922 15:94710569-94710591 CTCAGGAAGCTGAGGCAGGAAGG - Intergenic
1132427137 15:101727310-101727332 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1132471882 16:109074-109096 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1132773552 16:1578817-1578839 CTCAGGAGACTGAGGCAGGAGGG - Intronic
1132807973 16:1784196-1784218 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1133301371 16:4784660-4784682 CTCAGGAGGCTGAGGCAGGAGGG + Intronic
1133447282 16:5872626-5872648 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1133528898 16:6633901-6633923 CTCAGGAGGCTGAGGTAGGTGGG + Intronic
1133681431 16:8123824-8123846 CTCAGGAGACTGAGGTAAGAGGG + Intergenic
1133737342 16:8626229-8626251 CTCAAGAGGCTAAGGTGGGAGGG - Intronic
1133745655 16:8684609-8684631 CTCAGGAGGCTGAGGCAGGAGGG + Intronic
1133932939 16:10247088-10247110 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1134049551 16:11127760-11127782 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1134126476 16:11619672-11619694 CTCAGGAAGCTGAGGCAGGATGG - Intronic
1134173129 16:11984762-11984784 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1134189661 16:12111445-12111467 CTCAAGTCTCTGAGGTAAGAAGG - Intronic
1134461195 16:14430708-14430730 CTCAGGAAGCTGAGGTTGGAAGG + Intergenic
1134476604 16:14579460-14579482 CTCAAGAGACTGAGGTGGAAGGG + Intronic
1134621962 16:15696265-15696287 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1134635961 16:15792164-15792186 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1135031480 16:19042280-19042302 CTCGAGAGACTGAGGCAGGAGGG - Intronic
1135088769 16:19495602-19495624 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1135117493 16:19735956-19735978 CTCAAGAGGCTGAGGCAGGAAGG + Intronic
1135202502 16:20450642-20450664 CTCAGGAGGCTGAGGTGGGATGG + Intergenic
1135216602 16:20577224-20577246 CTCAGGAGGCTGAGGTGGGATGG - Intergenic
1135260202 16:20974125-20974147 CTCAGGAGACTGAGGTGGGAGGG - Intronic
1135344363 16:21676033-21676055 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1135529388 16:23239665-23239687 CTTGAGAAGCTGAGGTAGGAGGG - Intergenic
1135661864 16:24303808-24303830 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1135755788 16:25096806-25096828 CTCAGGAGGCTGAGGTGGGAAGG + Intergenic
1135803241 16:25518575-25518597 CTCAGGAAGCTGAGGCAGGAGGG + Intergenic
1135927470 16:26708182-26708204 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1136137254 16:28264019-28264041 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1136143789 16:28303620-28303642 CTCAGGAGACTGAAGTGGGAGGG - Intronic
1136242931 16:28955704-28955726 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1136602206 16:31299964-31299986 CTCAGGAGACTGAGGTGGGAGGG - Intronic
1136726319 16:32360374-32360396 AGCAAGACCCTGAGGAAGGAAGG + Intergenic
1137514317 16:49129903-49129925 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1137553733 16:49457118-49457140 CTCAGGAGACTGAGGCAGGAGGG + Intergenic
1137627074 16:49915959-49915981 CTCAGGAGGCTGAGGCAGGAGGG + Intergenic
1137813051 16:51371268-51371290 CTCAGGAGAGTGAGGTGGGAAGG + Intergenic
1137875998 16:51997369-51997391 CTCAACCCTGTGAGGTAGGAAGG - Intergenic
1137935891 16:52635130-52635152 CAAAAGACACTGAGGATGGATGG - Intergenic
1138012102 16:53391147-53391169 GTCAGTACACTGAAGTAGGAAGG - Intergenic
1138086967 16:54142191-54142213 CTCAGGAGGCTGAGGTAGGAGGG + Intergenic
1138112778 16:54337715-54337737 CTCAAGAGGCTGAGGTGGGAGGG + Intergenic
1138218298 16:55225011-55225033 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1138462265 16:57157199-57157221 CTCAGGAGGCTGAGGTAGGTAGG + Intronic
1138479828 16:57294891-57294913 CTCAGGAGACTGAGGCAGGAGGG + Intergenic
1138686360 16:58729417-58729439 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1138689906 16:58757561-58757583 CTCAGGAAGCTGAGGTAGGAGGG - Intergenic
1138756340 16:59490654-59490676 CTAAAGACACAGAGTCAGGAAGG + Intergenic
1138831518 16:60380633-60380655 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1139018919 16:62724496-62724518 CACAGGAGGCTGAGGTAGGAGGG + Intergenic
1139249322 16:65479880-65479902 CTGAAGAAATAGAGGTAGGAGGG + Intergenic
1139462281 16:67132157-67132179 CACCAGACCCTGAGGTATGAAGG - Intronic
1139633325 16:68243757-68243779 CTCAGGAGGCTGAGGTGGGAAGG + Intergenic
1139647270 16:68340471-68340493 CTCAGGAGACTGAGGCAGGAGGG + Intronic
1139772494 16:69289812-69289834 CTCAGGAGGCTGAGGTAGGAGGG + Intronic
1139909733 16:70390313-70390335 CTCAGGAGGCTGAGGCAGGAGGG - Intronic
1140271869 16:73473227-73473249 CTCAGGATGCTGAGGTGGGAGGG + Intergenic
1140600374 16:76468590-76468612 CTCAGGAGGCTGAGATAGGATGG - Intronic
1140635347 16:76906613-76906635 CTCAAGTCACACAGGTGGGAAGG + Intergenic
1140645595 16:77026595-77026617 CTCAGGAGCCTGAGGTAGGAGGG - Intergenic
1140713692 16:77702280-77702302 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1140760876 16:78107725-78107747 CTCAAGAGGCTGAAATAGGAGGG + Intronic
1140836737 16:78801399-78801421 CTCAGGAGGCTGAGGCAGGAAGG + Intronic
1141068166 16:80930715-80930737 CTCAGGAGACTGAGGCAGAATGG + Intergenic
1141985632 16:87577864-87577886 CTCAAGAGGCTGAGGCAGGATGG + Intergenic
1142176406 16:88647429-88647451 CTCCAGAGGCTGAGGTAAGAGGG + Intronic
1203000114 16_KI270728v1_random:157383-157405 AGCAAGACCCTGAGGAAGGAAGG - Intergenic
1203131714 16_KI270728v1_random:1693784-1693806 AGCAAGACCCTGAGGAAGGAAGG - Intergenic
1142598931 17:1043743-1043765 CTGAAGACCCTGTGGTGGGAGGG - Intronic
1143569710 17:7748601-7748623 CTCAGGAAGCTGAGGTGGGAGGG - Intronic
1143613166 17:8032146-8032168 CTCAGGAGGGTGAGGTAGGAAGG + Intergenic
1143774308 17:9187721-9187743 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1143879195 17:10016840-10016862 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1143955972 17:10669443-10669465 CTCAGGAGGCTGAGGCAGGAAGG + Intergenic
1144083034 17:11781896-11781918 CTGAAGGCACTGAGGCTGGAAGG - Intronic
1144125818 17:12202125-12202147 CTCAATAAACCGAGGTACGAAGG + Intergenic
1144309019 17:13995216-13995238 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1144551455 17:16244780-16244802 CTCGGGAGACTGAGGCAGGAGGG - Intronic
1144624047 17:16835543-16835565 CACAAAACACTGCGGAAGGAAGG - Intergenic
1144779521 17:17800809-17800831 CCCAAGCCACTGAGGCAGGAAGG - Intronic
1144882379 17:18437172-18437194 CACAAAACACTGCGGAAGGAAGG + Intergenic
1145101709 17:20082487-20082509 CTGAAGAGGCTGAGGTGGGAGGG + Intronic
1145149855 17:20507214-20507236 CACAAAACACTGCGGAAGGAAGG - Intergenic
1145981241 17:29012965-29012987 ATCAAGAAACTGAGGGAGGCTGG + Intronic
1146202072 17:30867290-30867312 CTCAGGAGCCTGAGGTGGGAGGG + Intronic
1146438054 17:32869823-32869845 CTCAGGAGGCTGAAGTAGGAGGG + Intronic
1146636236 17:34507529-34507551 CTCAGGGAACTGAGGTGGGAGGG - Intergenic
1146746830 17:35338413-35338435 CTCAGGAAGCTGAGGTGGGATGG + Intergenic
1146940453 17:36840495-36840517 CTCAGGAGGCTGAGGCAGGAGGG - Intergenic
1147060009 17:37868189-37868211 CTCAAGAGGCTGCGGTGGGAGGG - Intergenic
1147223880 17:38959751-38959773 CTCAGGATGCTGAGGTGGGAGGG - Intronic
1147324173 17:39662540-39662562 CTCAGGACTCAGAGGTAAGAAGG - Intronic
1147461619 17:40575654-40575676 CTCGGGAGGCTGAGGTAGGAGGG - Intergenic
1147630567 17:41928029-41928051 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1147669234 17:42167218-42167240 CTCAGGGCACTCAGGTAGTAGGG - Intronic
1147697068 17:42363549-42363571 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1147777922 17:42916468-42916490 CTCAGGAGGCTGAGGTGGGAAGG + Intergenic
1147930810 17:43979568-43979590 CTCAGGAGACTGAGACAGGAGGG + Intronic
1147992313 17:44342157-44342179 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1148119366 17:45198662-45198684 CTCAAGAGGCTGAGGTGGGAGGG + Intergenic
1148180909 17:45604096-45604118 CTCAGGAGGCTGAGGTGGGAAGG - Intergenic
1148267998 17:46241820-46241842 CTCAGGAGGCTGAGGTGGGAAGG + Intergenic
1148372668 17:47112418-47112440 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1148409282 17:47450676-47450698 CTCAAGAGGCTGCGGTGGGAGGG - Intergenic
1148522362 17:48291025-48291047 CTCAGGAGGCTGAGGCAGGAGGG + Intronic
1148729350 17:49822333-49822355 CTCAGGAGGCTGAGGCAGGAGGG - Intronic
1148761621 17:50005364-50005386 CTCAGGAGGCTGAGGTGGGAAGG + Intergenic
1149032935 17:52104304-52104326 CTCGGGAGGCTGAGGTAGGAGGG - Intronic
1149039468 17:52170824-52170846 CTCAAGAGGCTGAGGTGGGGGGG + Intergenic
1149339961 17:55675319-55675341 CTCAGGAGGCCGAGGTAGGATGG + Intergenic
1149876485 17:60238862-60238884 CTCACGAAGCTGAGGTGGGAGGG + Intronic
1149897413 17:60439251-60439273 CTCAAGAGGCTGAGGCAGAAGGG - Intergenic
1149897554 17:60440762-60440784 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1150016488 17:61562604-61562626 CTCAGGAGGCTGAGGTAGAAAGG - Intergenic
1150048532 17:61936593-61936615 CTCAAGAGGCTGAGGCAGAATGG + Intergenic
1150876034 17:68971401-68971423 CTCGAGAGGCTGAGGTGGGAGGG - Intergenic
1150950724 17:69800543-69800565 CTCCAGACACTGAGGTACTTGGG + Intergenic
1151173959 17:72271551-72271573 CTCAGGAGGCTGAGGTGGGAAGG + Intergenic
1151490266 17:74428707-74428729 CTCGAGAGGCTGAGGCAGGAGGG + Intronic
1151751793 17:76043154-76043176 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1151840157 17:76611889-76611911 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1151883336 17:76908372-76908394 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1151978092 17:77493487-77493509 CTCAAGAGACTAAGGTGTGAGGG - Intronic
1152052881 17:77995963-77995985 CACAAGATTCTGAGGTGGGAGGG + Intergenic
1152121650 17:78422603-78422625 CTCAGGAGGCTGAGGCAGGAGGG - Intronic
1152497647 17:80685381-80685403 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1152593471 17:81225310-81225332 ATCAAGACAATGTGGTAGGCCGG - Intergenic
1153018659 18:607062-607084 CTCATGGGGCTGAGGTAGGAGGG - Intronic
1153151998 18:2106247-2106269 CTCCAGAGACTGAGATGGGACGG + Intergenic
1153469754 18:5430669-5430691 CTCAGGAGGCTGAGGGAGGAGGG - Intronic
1153678010 18:7472765-7472787 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1153842534 18:9019857-9019879 CTTCAGAGACTGAGGTAGGAGGG + Intergenic
1153921355 18:9793179-9793201 CTCAGGAAGCTGAGGCAGGAGGG - Intronic
1154099955 18:11463646-11463668 CTTAAGAGGCTGAGGTGGGAGGG + Intergenic
1154147519 18:11878675-11878697 CTCAGGAGGCTGAGGCAGGAGGG - Intronic
1154250605 18:12741248-12741270 CTCAGGAAGCTGAGGCAGGAGGG - Intergenic
1154274994 18:12950927-12950949 CTCAAGAGGCTGAGGCAGGAGGG - Intronic
1154984646 18:21537425-21537447 CTCAGGAGACTGGGGCAGGAGGG + Intronic
1155052332 18:22159511-22159533 CTCAAAGAAGTGAGGTAGGAGGG - Intergenic
1155087955 18:22475859-22475881 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1155474580 18:26225448-26225470 CTCGGGAATCTGAGGTAGGAGGG + Intergenic
1155621580 18:27785942-27785964 CTTAAGACCCTGAGGAAGGGAGG + Intergenic
1155929737 18:31693858-31693880 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1156199601 18:34815000-34815022 CTCAAGAGTCTGAGGTAGGTAGG + Intronic
1156247952 18:35321016-35321038 CTCAAGAGGCTAAAGTAGGAGGG + Intergenic
1156295629 18:35787534-35787556 CTCAGGAGGCTGAGGCAGGAGGG - Intergenic
1156549444 18:37999987-38000009 CTCAAGAAGCTGAGGTGGGAGGG + Intergenic
1157471150 18:47989946-47989968 CTCAAGAGGCTAAGGTAGGAGGG - Intergenic
1157511174 18:48275987-48276009 CTCAAGATACAGAGGGAGGAGGG + Intronic
1157941290 18:51931620-51931642 GTGAAGACACTGAGGCATGATGG + Intergenic
1157960950 18:52152709-52152731 ATAAAGACACTGAAATAGGAAGG + Intergenic
1158070759 18:53467894-53467916 GTCAAGACACTGAGGAAGCAGGG + Exonic
1158504962 18:58039304-58039326 CTCAAGGAGCTGAGGCAGGAGGG - Intergenic
1158551839 18:58442786-58442808 TTCAAGAGACTGAGGCAAGAGGG - Intergenic
1159050555 18:63417593-63417615 CTTAAGTCACTGATGTAGGGGGG - Intronic
1159447433 18:68557945-68557967 CTCAAGCGGCTGAGGCAGGAGGG + Intergenic
1159956315 18:74520715-74520737 CTCAGGACACTGACGTAGGAGGG + Exonic
1159959420 18:74543976-74543998 CTCAGGAGGCTGAGGCAGGAGGG + Intronic
1160911647 19:1476722-1476744 CTCAGGAGGCTGAGGCAGGAGGG - Intronic
1161093970 19:2377980-2378002 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1161164853 19:2780976-2780998 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1161254725 19:3301472-3301494 CTCAGGAGGCTGAGGCAGGAGGG - Intergenic
1161330714 19:3685967-3685989 CTCAGGAGGCTGAGGCAGGACGG - Intronic
1161360395 19:3845685-3845707 CTCAGGAGGCTGAGGAAGGAGGG + Intronic
1161533811 19:4806437-4806459 CTCCAGAGGCTGAGGTGGGAGGG - Intergenic
1161589372 19:5122179-5122201 CTCTAGACACTGAGACAGGCAGG - Intronic
1161711432 19:5850828-5850850 CTCCAGAGCCTGAGGCAGGAGGG + Intronic
1161935113 19:7366868-7366890 CTCTGGAAACTGAGGTGGGAGGG - Intronic
1161974669 19:7601633-7601655 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1162038459 19:7955174-7955196 CTGAGGACACTGAGGTGGGAGGG + Intergenic
1162065978 19:8125820-8125842 CTCAAGTCACTGCGGGTGGAGGG + Intronic
1162394386 19:10408265-10408287 CTCAGGAGGCTGAGGCAGGAGGG - Intronic
1162460955 19:10813716-10813738 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1162542016 19:11302824-11302846 CTCAAGAGGCTGAGGTGGGAAGG - Intronic
1162559990 19:11411501-11411523 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1162577960 19:11510281-11510303 CTCAGGAGGCTGAGGCAGGAGGG - Intronic
1163086189 19:14981183-14981205 CTCAGGAGGCTGAGGCAGGAGGG + Intronic
1163111638 19:15164886-15164908 CTCCAGAAACTGAGGTGGGAGGG - Intronic
1163181972 19:15610512-15610534 CTCGAGAGGCTGAGGCAGGAAGG + Intergenic
1163315832 19:16539927-16539949 CTCAAGAGGCTGAGGCTGGAGGG - Intronic
1163405482 19:17119445-17119467 CACAGGACACTGAGGCAGCAGGG + Intronic
1163406022 19:17122978-17123000 CTCAAGAGGTTGAGGTGGGAGGG + Intronic
1163586468 19:18167026-18167048 CTCGGGAGGCTGAGGTAGGAGGG + Intronic
1163651102 19:18518391-18518413 CTCAGGAGACTGAAGCAGGAGGG + Intronic
1163705219 19:18808451-18808473 CTCAGGAGGCTGAGGCAGGAGGG - Intergenic
1163760617 19:19134492-19134514 CTCAGGAGATTGAGGCAGGAGGG + Intronic
1163816903 19:19471992-19472014 CTCAAGCCACTCAAGTAGGTGGG + Intronic
1164141977 19:22477920-22477942 ATCAAGACAATGTGGTAGGCTGG - Intronic
1164662994 19:29994886-29994908 CTCAGGAGGCTGAGGCAGGAAGG - Intronic
1164673564 19:30087462-30087484 CACATGACACTGGGGTAAGATGG + Intergenic
1164936243 19:32216790-32216812 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1164985511 19:32645544-32645566 CTCAAGAGGCTGAGGTGGGAGGG - Intronic
1165552377 19:36598402-36598424 CTCAGGAGGCTGAGGTAGGAGGG + Intronic
1165562521 19:36692478-36692500 CTCAGGAGGCTGAGGCAGGAGGG - Intronic
1165640815 19:37384388-37384410 CTTAGGAGACTGAGGTAGGAGGG + Intronic
1165641532 19:37392495-37392517 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1165667973 19:37650224-37650246 CTCAGGAGGCTGAGGTAGGAGGG - Intronic
1165684791 19:37810075-37810097 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1165779405 19:38423416-38423438 CTCAGGAGGCTGAGGCAGGAGGG + Intronic
1165911455 19:39230939-39230961 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1165954026 19:39490489-39490511 CTCAGGAGGCTGAGGCAGGAGGG - Exonic
1165960112 19:39526894-39526916 CTCAGGAGGCTGAGGCAGGAAGG - Intergenic
1166071657 19:40391512-40391534 CTCAAGAGGCTGAGGTCGGCAGG + Intergenic
1166073487 19:40400088-40400110 CTCAGGAGGCTGAGGCAGGAGGG - Intronic
1166642241 19:44503608-44503630 CTCAGGAGGCTGAGGCAGGAAGG + Intronic
1166685816 19:44795407-44795429 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1166704697 19:44902308-44902330 CTCAGGAGGCTGAGGTGGGAAGG - Intronic
1166723963 19:45014275-45014297 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1166877497 19:45906431-45906453 CTCTAGAGGCTGAGGTGGGAGGG - Intergenic
1167016559 19:46844690-46844712 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1167039482 19:47014430-47014452 CTCAGGAGGCTGAGGCAGGAGGG - Intergenic
1167090278 19:47339423-47339445 CTCAGGAGGCTGAGGCAGGAGGG - Intronic
1167109591 19:47451414-47451436 CTCGAGAGGCTGAGGCAGGAGGG - Intronic
1167219346 19:48187831-48187853 CTCAAGAGGCTGAGGCACGAGGG + Intronic
1167434152 19:49469355-49469377 CTCAGGAAGCTGAGGTGGGACGG - Intronic
1167750772 19:51378979-51379001 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1167793008 19:51692373-51692395 CTCATGAGTCTGAGGGAGGAAGG + Intergenic
1168155643 19:54472177-54472199 CTCATGAGTCTGAGGGAGGAGGG - Intronic
1168155698 19:54472326-54472348 CTCATGAGTCTGAGGGAGGAGGG - Intronic
1168155917 19:54472923-54472945 CTCATGAGTCTGAGGGAGGAGGG - Intronic
1168518975 19:57033419-57033441 CTCAGGAGGCTGAGGCAGGAGGG + Intergenic
1168726454 19:58585181-58585203 CTCAGGAGGCTGAGGCAGGAAGG + Intergenic
926779633 2:16457694-16457716 CTCAGGAGGCTGAGGTTGGAGGG - Intergenic
926838682 2:17053403-17053425 CTCAAGAGGCTGAGGCAGGAGGG - Intergenic
927558936 2:24055316-24055338 GTCAGGACACTGAAGCAGGAGGG - Intronic
927589308 2:24339361-24339383 CTCAGGAAGCTGAGGTGGGAGGG + Intronic
927609541 2:24524399-24524421 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
927749822 2:25657610-25657632 CTCAGGAGGCTGAGGTGGGAAGG + Intronic
927756315 2:25711187-25711209 CTCAGGAGGCTAAGGTAGGAGGG - Intergenic
927838959 2:26424842-26424864 CTCAGGAGGCTGAGGCAGGAGGG + Intronic
927839750 2:26432389-26432411 CTCAGGAGGCTGAGGTTGGAGGG + Intronic
927968411 2:27287308-27287330 CTCAGGGGGCTGAGGTAGGAGGG - Intronic
928004169 2:27548498-27548520 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
928062617 2:28130558-28130580 CTTGGGAGACTGAGGTAGGAGGG - Intronic
928138675 2:28708677-28708699 CTAAAGAGGCTGAGGTAGGATGG + Intergenic
928141471 2:28733040-28733062 CTCAGGAGGCTGAGGCAGGAGGG - Intergenic
928153335 2:28853281-28853303 CTCGAGAGGCTGAGGTGGGAGGG - Intronic
928183013 2:29082996-29083018 CTCAAGAAGCTGAGGTGAGAGGG - Intergenic
928532260 2:32204919-32204941 CTCAGGAGACTGAGGTGGGAGGG - Intronic
928595457 2:32855468-32855490 CTCCAAACACTGAGTCAGGATGG - Intergenic
928640139 2:33289606-33289628 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
928949894 2:36805194-36805216 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
928972649 2:37047099-37047121 CTCAAGAGGCTGAGGTGAGAGGG + Intronic
929505891 2:42527745-42527767 CTCAAGACACTGAGGTAGGAGGG + Intronic
929607535 2:43244926-43244948 CTCATGACACAGGGGTAGGGAGG - Intronic
929826007 2:45310242-45310264 CTCAGGATACTGAGAGAGGATGG - Intergenic
930228744 2:48822319-48822341 CTCAAGCCACTGCTCTAGGAGGG - Intergenic
930673108 2:54172107-54172129 CTCAGGAGGCTGAGGCAGGAAGG + Intronic
930799628 2:55429610-55429632 CTCAGGAGGCTGAGGTAGGAGGG - Intergenic
931432116 2:62216511-62216533 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
931543807 2:63358562-63358584 CTCATGAGGCTGAGGTGGGAGGG - Intronic
931563139 2:63585932-63585954 CTCAAGAGGCTGAGGTGGGAGGG - Intronic
931687371 2:64805966-64805988 CTCAGGAGGCTGAGGCAGGAGGG + Intergenic
931726560 2:65117171-65117193 CTCAAGAGGCTGAGGCAAGAGGG - Intronic
932041835 2:68307427-68307449 CTCCAGAGACTGAGGTGGGAGGG - Intronic
932238483 2:70139710-70139732 CTCAGGACGCTGAGGTGGGATGG + Intergenic
932243476 2:70176734-70176756 CTCAGGAAGCTGAGGCAGGAGGG - Intronic
932266879 2:70375312-70375334 CTCAGGAGGCTGAGGTAAGAGGG - Intergenic
932362416 2:71119943-71119965 CTCAGGAGGCTGAGGTAGGAGGG + Intronic
932381758 2:71290504-71290526 CTCGGGAGGCTGAGGTAGGAGGG - Intronic
932382870 2:71301634-71301656 CTCAGGAGGCTGAGGCAGGAGGG - Intronic
932400287 2:71475874-71475896 CTCGAGATGCTGAGGTGGGAGGG - Intronic
932507582 2:72250943-72250965 CTCCAGAGGCTGAGGTAAGAGGG - Intronic
933030803 2:77326499-77326521 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
933848122 2:86342283-86342305 CTCAGGAAGCTGAGGCAGGAGGG - Intergenic
933904531 2:86877227-86877249 TTCAGGAGACTGAGGCAGGAGGG + Intergenic
934100889 2:88651970-88651992 CTCAAGACTAGGAGGCAGGAAGG + Intergenic
934181123 2:89621586-89621608 CTCAGGAGGCTGAGGTAGGAGGG + Intergenic
934291423 2:91695827-91695849 CTCAGGAGGCTGAGGTAGGAGGG + Intergenic
934319649 2:91960742-91960764 AGCAAGACCCTGAGGAAGGAAGG - Intergenic
934721214 2:96578257-96578279 CTCAAGAGACTGAGGTGGGAAGG - Intergenic
934762801 2:96865633-96865655 CTGGGGACACCGAGGTAGGAGGG + Intronic
934970796 2:98762570-98762592 CTCCAGACTCTGAGAGAGGAGGG + Intergenic
935033706 2:99347111-99347133 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
935229142 2:101080881-101080903 CTCAGGAGGCTGAGGTGGGACGG - Intronic
935444921 2:103146185-103146207 CTCAGGAGGCTGAAGTAGGAGGG - Intergenic
935643385 2:105311475-105311497 CTCAGGAGGCTGAGGTAGGAGGG + Intronic
935718404 2:105958998-105959020 CTCAGGAGGCTGAGGCAGGAGGG - Intergenic
936005328 2:108882044-108882066 CTCGAGAAGCTGAGGCAGGAGGG + Intronic
936071384 2:109374064-109374086 CTCATGGCCCTGAGGGAGGAGGG - Intronic
936398168 2:112145377-112145399 CTCCAGAGGCTGAGGCAGGAGGG - Intronic
936764160 2:115825198-115825220 ACAAAGACACTGAGGTAGAAAGG - Intronic
937035839 2:118781206-118781228 CTCAGGAGTCTGAGGTAGGAGGG - Intergenic
937197625 2:120173788-120173810 CTCAGGAAGCTGAGGCAGGAGGG - Intronic
937368296 2:121280928-121280950 ATGAAGACACTGAGGCTGGAGGG + Intronic
937931517 2:127208773-127208795 CCCCAGCCACTGAGGAAGGATGG - Intronic
938004127 2:127773869-127773891 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
938012227 2:127838063-127838085 CTCGAGAGGCTGAGGCAGGAAGG - Intergenic
938594439 2:132773050-132773072 CACAAGACACTGAGGCATCATGG - Intronic
938844868 2:135197900-135197922 CACAGGAGGCTGAGGTAGGAGGG - Intronic
940225639 2:151398561-151398583 CTCAGGAGACTGAGGTTGGAGGG - Intergenic
940687273 2:156868579-156868601 CTCAGGAGGCTGAGGCAGGAGGG - Intergenic
940717968 2:157249346-157249368 CTCAAAACATTGAGGGAGGAAGG - Intergenic
940807229 2:158201515-158201537 CTCAGGAGGCTGAGGTGGGACGG - Intronic
940878763 2:158924660-158924682 CTCAGGAGGCTGAGGTGGGAAGG - Intergenic
940901911 2:159133460-159133482 CTCAGGAGGCTGAGGTAGGAGGG - Intronic
941068700 2:160932030-160932052 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
941241634 2:163045933-163045955 TTCAAGACACTGGGATAGAATGG + Intergenic
941342310 2:164322581-164322603 CTCATGAGGCTGAGGTGGGAGGG - Intergenic
941790994 2:169551687-169551709 CTCAGGAGGCTGAGGCAGGAGGG + Intronic
941821236 2:169845313-169845335 CTCAGAAAGCTGAGGTAGGAGGG + Intronic
942082274 2:172411938-172411960 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
942284578 2:174402578-174402600 CTCAAGAGGCTGAGGTGGGGAGG + Intronic
942737997 2:179138761-179138783 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
942842520 2:180379647-180379669 CGCAAGAGGCTGAGGCAGGAGGG + Intergenic
943184289 2:184586707-184586729 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
943228691 2:185215518-185215540 GTCAAGAAACTGAGGCAGGGAGG - Intergenic
943979664 2:194531994-194532016 CTCAGGAGATTGAGGCAGGAGGG - Intergenic
944109448 2:196116479-196116501 CTCAGGAGGCTGAGGCAGGAGGG - Intergenic
944194448 2:197037832-197037854 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
944550673 2:200841828-200841850 CTCCAGAGGCTGAGGCAGGAAGG + Intergenic
944708157 2:202311744-202311766 CTCAGGAGGGTGAGGTAGGAGGG + Intergenic
945074813 2:206027594-206027616 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
945214073 2:207414548-207414570 CTCAGGAGGCTGAGATAGGAGGG + Intergenic
945293042 2:208144509-208144531 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
945450107 2:209984651-209984673 CTCAAGGCAATGGGGGAGGAAGG - Intronic
946006707 2:216531457-216531479 CTCAGGAGGCTGAGGAAGGAGGG - Intronic
946261225 2:218492895-218492917 CTCTAGATGCTGAGGTGGGAAGG + Intronic
946454162 2:219809413-219809435 CTCAGGAGACTGAGACAGGAGGG + Intergenic
946735467 2:222750237-222750259 CTCAAGAGGCTGAGGTGGGAAGG - Intergenic
946838929 2:223800422-223800444 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
946842726 2:223834647-223834669 CTCAAGAAGCTGAGGTAGGAGGG + Intronic
947162349 2:227227262-227227284 CACAAGGCACTGGGGGAGGAGGG - Intronic
947401890 2:229739565-229739587 CTCGGGAGGCTGAGGTAGGAAGG + Intergenic
947507193 2:230716892-230716914 CTCAAGAGGCTGAGGCAGGAGGG + Intronic
947858687 2:233342864-233342886 CTTCAGAAGCTGAGGTAGGAGGG - Intronic
948182262 2:235991465-235991487 CTCGGGAGACTGAGGTGGGAAGG + Intronic
948263880 2:236623770-236623792 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
948372661 2:237499850-237499872 CTCAGGAGACTGAGGTGGGAGGG - Intronic
948404568 2:237707323-237707345 CTCAGGAGGCTGAGGCAGGAGGG + Intronic
948440601 2:237984885-237984907 CTCAGGAGTCTGAGGTGGGAAGG - Intronic
948656308 2:239478697-239478719 TTCAAGAGGCTGAGGCAGGAGGG + Intergenic
949079019 2:242081941-242081963 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1168996758 20:2138917-2138939 CTCAGGAGGCTGAGGCAGGAGGG + Intronic
1169076695 20:2764401-2764423 CTCAAGTGGCTGAGGCAGGAGGG - Intergenic
1169079303 20:2785955-2785977 CTCAGGAGGCTGAGGCAGGAGGG + Intergenic
1169133356 20:3179826-3179848 CTCAGGAGACTGAGGCAGGCAGG - Intergenic
1169290020 20:4341538-4341560 GTCAAGACACTGAGATATTAGGG - Intergenic
1169377399 20:5077197-5077219 CTCGGGAAACTGAGGTGGGAGGG + Intronic
1169416073 20:5417238-5417260 CTCAGGAAGCTGAGGTGGGAGGG + Intergenic
1169623746 20:7539452-7539474 CTCAGGAAGCTGAGGCAGGAAGG + Intergenic
1169960920 20:11159358-11159380 CTCAGGAGGCTGAGGTGGGAAGG - Intergenic
1170193965 20:13671594-13671616 CTCAGGACACTGGGGGAGAAGGG - Intergenic
1170462095 20:16586993-16587015 ATCAAGTCACTGAGGGAAGATGG - Intergenic
1170507197 20:17039561-17039583 CTCAGGAGGCTGAGGCAGGAGGG - Intergenic
1170590272 20:17766096-17766118 GCCAAGACCCTGAGGCAGGATGG + Intergenic
1170602980 20:17855797-17855819 CTCCAGAGGCTGAGGTGGGAGGG + Intergenic
1170611940 20:17921631-17921653 CTCCAGAGGCTGAGGTGGGAGGG + Intergenic
1170640386 20:18146735-18146757 CTCAGGAGACTGATGTGGGAGGG + Intronic
1170683817 20:18550715-18550737 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1170891212 20:20377423-20377445 CTCAGGAGACTGAGGTGGGAGGG - Intergenic
1171001527 20:21421143-21421165 CTCAAGAGGCTGAGGTGGGATGG - Intergenic
1171541873 20:25965382-25965404 CTCAGGAAGCTGAGGTGGGAGGG - Intergenic
1171799179 20:29594931-29594953 CTCAGGAAGCTGAGGTGGGAGGG + Intergenic
1172302643 20:33860783-33860805 CTCAGGAGGCTGAGGCAGGAGGG + Intergenic
1172451362 20:35026320-35026342 CTCAAGAGGCTGAGGTGGGAGGG - Intronic
1172466049 20:35155262-35155284 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1172494717 20:35371906-35371928 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1172628848 20:36364985-36365007 CTCAGGAGGCTGAGGCAGGAGGG + Intronic
1172733566 20:37109074-37109096 CTCAAGAGGCTGAGGGAGGTAGG + Intronic
1172953713 20:38739963-38739985 CTCAAGAGGCTGAGCTGGGAGGG - Intergenic
1173198180 20:40933156-40933178 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1173485333 20:43436873-43436895 CTCAGGAGGCTGAGGCAGGAGGG + Intergenic
1173960315 20:47066222-47066244 CTCAGGAGGCTAAGGTAGGAGGG + Intronic
1174000020 20:47367760-47367782 CTCTAGAGGCTGAGGCAGGAAGG + Intergenic
1174005283 20:47405980-47406002 CTCAGGATGCTGAGGAAGGAGGG - Intergenic
1174015674 20:47486192-47486214 CTCAAGAGGCTGAGGCTGGAGGG + Intergenic
1174201660 20:48810474-48810496 CTCAGGAGGCTGAGGTGGGAAGG + Intronic
1174244240 20:49164406-49164428 CTCCAGAGGCTGAGGCAGGAGGG - Intronic
1174377668 20:50137172-50137194 CTCACGAGTCTGAGGTGGGAGGG - Intronic
1174710299 20:52697437-52697459 CTCAAGAGGCTGAGGCAGGAGGG - Intergenic
1174798695 20:53544158-53544180 CTCGGGAGGCTGAGGTAGGAGGG + Intergenic
1174830372 20:53806713-53806735 CTCAAGAGGCTGTGGCAGGAGGG + Intergenic
1175047375 20:56119803-56119825 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1175170033 20:57073936-57073958 CACAGGACACAGAGGTTGGAAGG - Intergenic
1175196901 20:57250421-57250443 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1175325190 20:58120978-58121000 CTCAGGAGGCTGAGGCAGGAAGG + Intergenic
1176134678 20:63517070-63517092 CTCAGGAAGCTGAGGCAGGAGGG - Intergenic
1176273616 20:64249773-64249795 CTCTGGAGGCTGAGGTAGGAAGG - Intergenic
1176668484 21:9709608-9709630 ATCAAGACGCAGAGGAAGGAAGG + Intergenic
1176731364 21:10501621-10501643 CTCAGGAGGCTGAGGTAGGAGGG - Intergenic
1176962396 21:15174105-15174127 CTCAGGAAACTGAGGAGGGAGGG - Intergenic
1176984534 21:15420785-15420807 CTCAGGTCACTGAGGGAGGATGG + Intergenic
1177152640 21:17470172-17470194 CTCAGGAGGCTGAGGCAGGAGGG - Intergenic
1177154172 21:17484951-17484973 CTCAGGAGGCTAAGGTAGGAGGG - Intergenic
1177819139 21:26012113-26012135 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1178021606 21:28414771-28414793 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1178430267 21:32512594-32512616 CTCAAGCCTCTGAGGTACAATGG - Intronic
1178826860 21:36024525-36024547 CTCAGGAGACGGAGGCAGGATGG + Intergenic
1178976921 21:37228079-37228101 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1179404771 21:41116227-41116249 CTCGGGAGGCTGAGGTAGGAGGG + Intergenic
1179512196 21:41880321-41880343 CTCAGGAGGCTGAGGCAGGAGGG + Intergenic
1180152194 21:45955142-45955164 CTTAAGAGGCTGAGGTGGGAGGG - Intergenic
1180618469 22:17144355-17144377 CTCAGGAGGCTGAGGCAGGAGGG - Intronic
1180657215 22:17432741-17432763 CTCAGGAGGCTGAGGTAGGAGGG - Intronic
1180694915 22:17745540-17745562 CTCATGAGACTGAGGCGGGAAGG + Intronic
1180753009 22:18138179-18138201 CACTGGACGCTGAGGTAGGAGGG - Intronic
1180906500 22:19416429-19416451 CTCAGGAGACTGAGGTGGGAGGG - Intronic
1181160935 22:20959150-20959172 CTCAGGAGAATGAGGTGGGAGGG + Intergenic
1181275617 22:21686052-21686074 CTCAGGAGGCTGAGGTCGGAGGG + Intronic
1181294024 22:21820438-21820460 CTCAGGAGGCTGAGGCAGGAGGG - Intronic
1181476559 22:23171418-23171440 CTCCAGAGGCTGAGGTGGGAGGG - Intergenic
1181588328 22:23866809-23866831 CTCAGGAGGCTGAGGCAGGAGGG + Intronic
1181733536 22:24864884-24864906 CTCAGGCCACAGAGCTAGGAAGG - Intronic
1181832679 22:25574382-25574404 CTCAGGAAGCTGAGGTGGGAGGG + Intronic
1181836130 22:25610357-25610379 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1182238714 22:28897426-28897448 CTCAAGAGGCTAAGGCAGGAGGG - Intronic
1182281414 22:29219672-29219694 CTCAGGAGGCTGAGGCAGGAGGG + Intronic
1182448002 22:30400785-30400807 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1182469809 22:30541723-30541745 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1182523425 22:30899296-30899318 CTCAGGAGGCTGAGGCAGGAAGG + Intronic
1182533674 22:30983106-30983128 CTCATGAGGCTGAGGCAGGAGGG - Intergenic
1182611262 22:31549470-31549492 CTCAGGAGGCTGAGGCAGGAGGG - Intronic
1182734288 22:32520243-32520265 CTCTAGAGACTGAGGCAGGAGGG - Intronic
1182751809 22:32647552-32647574 CTCAGGAGTCTGAGGCAGGAGGG - Intronic
1182927772 22:34142390-34142412 CTCAGGAGGCTGAGGTAGGAGGG - Intergenic
1183014841 22:34977582-34977604 TACAAGTCACTGAGGTGGGAAGG + Intergenic
1183137304 22:35901403-35901425 CTCAGGAGGCTGAGGCAGGAGGG + Intronic
1183873691 22:40760694-40760716 CTCAGGAGACTGAGGCAGGAGGG + Intergenic
1183973333 22:41495132-41495154 CTCAAGAGGCTGAGGCAGGAGGG - Intronic
1184475042 22:44715758-44715780 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1184784570 22:46665475-46665497 CTCCAGACACTCAGGGATGAGGG - Intronic
1185096733 22:48811017-48811039 CTCTAGAGGCTGAGGCAGGAGGG + Intronic
1185157564 22:49203356-49203378 CTCAAGATGCAGAGGAAGGAAGG + Intergenic
1185354642 22:50360468-50360490 CTCAGGAAACTGAGGCAGGAGGG - Intronic
949416055 3:3815088-3815110 ATCAAGACAGGAAGGTAGGATGG - Intronic
949539221 3:5019145-5019167 CTCAGGAGACTGAGATGGGAGGG + Intergenic
950036014 3:9886237-9886259 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
950803468 3:15575647-15575669 CTCAGGAGGCTGAGGTAGGAGGG - Intronic
951111094 3:18805118-18805140 CTCAGGAGGCTGAGGTGGGATGG + Intergenic
951787860 3:26442860-26442882 CTTAGGAGGCTGAGGTAGGAGGG - Intergenic
952169630 3:30792463-30792485 CTCAGGAGGCTGAGGTAGGAAGG + Intronic
952311356 3:32193315-32193337 CTCAGGAGGCTGAAGTAGGAGGG - Intergenic
952329030 3:32346926-32346948 CTCAGGAGCCTGAGGTGGGAGGG - Intronic
952613906 3:35246038-35246060 CTCAGGAGGCTGAGGCAGGAAGG - Intergenic
952768058 3:36972269-36972291 CTCAGGAAGCTGAGGTGGGAGGG + Intergenic
952787315 3:37167865-37167887 CTCGAGAGACTGAGGTGGGAAGG + Intronic
952948679 3:38499710-38499732 CTCAGGAGGCTGAGGCAGGAGGG - Intronic
952996108 3:38883901-38883923 CTCCAGGGAATGAGGTAGGATGG + Intronic
953426783 3:42801920-42801942 CTCAGGAGGCTGAGGCAGGAGGG + Intronic
954282407 3:49591694-49591716 CTCAAGAGGCTGAGGTAGGGAGG - Intronic
954310098 3:49760008-49760030 CTCAGGAAGCTGAGGTGGGAAGG - Intronic
954318906 3:49817563-49817585 CTGAGGAGGCTGAGGTAGGAGGG + Intergenic
954319104 3:49819042-49819064 CTCAAGAGGCTGGGGTGGGAGGG - Intergenic
954381915 3:50223801-50223823 CTCAGGAGGCTGAGGCAGGAGGG - Intergenic
954393385 3:50279250-50279272 CTCAAGACAGTGAGGTCAGTGGG - Intronic
954393810 3:50281784-50281806 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
954485269 3:50844321-50844343 CTCAGGAGGCTGAGGGAGGACGG - Intronic
954756871 3:52845450-52845472 CTCAAGAGGCTGAGGTATCAGGG - Intronic
954769494 3:52953343-52953365 CTTAAGAGGCTGAGGTGGGAGGG + Intronic
954789138 3:53117995-53118017 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
954966234 3:54613593-54613615 CTTAAGACTCAGAGGTAAGATGG - Intronic
955289850 3:57681514-57681536 CTCAGGAGGCTGAGGCAGGAGGG + Intronic
955658453 3:61270223-61270245 CTCAGGAGGCTGAGGCAGGAGGG - Intergenic
955773612 3:62410995-62411017 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
956184059 3:66545611-66545633 CTCAGGAGGCTGAGGCAGGAGGG - Intergenic
956963402 3:74430498-74430520 CTCCAGAGGCTGAGGTAGGAGGG + Intronic
958136662 3:89502999-89503021 CTCAGGAGGCTGAGGCAGGAGGG + Intergenic
958257775 3:91344851-91344873 CTCAAGAGGCTAAGGTGGGAGGG + Intergenic
959553382 3:107689633-107689655 CTAAATACACTGAGGAGGGAGGG - Intronic
959608865 3:108271470-108271492 CTCAGGAAGCTGAGGCAGGAGGG + Intergenic
960031944 3:113062947-113062969 ATCAGGACAGTGAGGGAGGAGGG - Intergenic
960132939 3:114076729-114076751 CTGAAGAACCTGAGGTAAGAAGG - Exonic
960299811 3:115988542-115988564 CTCAGGAGGCTGAGGCAGGAGGG - Intronic
961153849 3:124662309-124662331 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
961505204 3:127366135-127366157 CTCAGGAGGCTGAGGTGGGAAGG + Intergenic
961553873 3:127684577-127684599 CTCTAGAGGCTGAGGTGGGAAGG + Intergenic
961677634 3:128577393-128577415 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
961754096 3:129116930-129116952 CTGAGGACACTGAGGTGGGGAGG + Intronic
962492289 3:135906374-135906396 CTCCAGAGGCTGAGGTGGGAGGG - Intergenic
962594722 3:136929173-136929195 CTCAGGAAGCTGAGGTGGGAGGG - Intronic
962790671 3:138808571-138808593 CTCAAGAGGCTGAGGTGGGGTGG + Intronic
962956966 3:140275386-140275408 CTCAGGAGGCTGAGGCAGGAAGG - Intronic
963027284 3:140932600-140932622 CTCAGGAGACTGAGGCAGGAGGG + Intergenic
963299538 3:143583043-143583065 CTCAGGAGGCTGAGGTGGGACGG + Intronic
963338358 3:144003187-144003209 CTCAGGAGTCTGAGGTGGGAGGG + Intronic
964446871 3:156768293-156768315 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
964527380 3:157629941-157629963 GTCAAGACACTGAGGCAGGGTGG + Intronic
964618418 3:158695264-158695286 CTCAGGAGGCTGAGGCAGGAGGG + Intergenic
964929046 3:161993434-161993456 CTCAGGATGCTGAGGTATGAAGG - Intergenic
965755281 3:172020133-172020155 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
966376993 3:179306590-179306612 GTCAAGAGGCTGAGGTGGGAGGG - Intergenic
966411135 3:179647079-179647101 CTGAGGAGGCTGAGGTAGGAAGG + Intergenic
966576058 3:181503909-181503931 CTCAGGAGGCTGAGGCAGGAGGG + Intergenic
966710964 3:182972631-182972653 CTTAGGAGACTGAGGCAGGAGGG + Intronic
966811708 3:183852050-183852072 CTCAAGAGGCTGTGGAAGGAGGG + Intronic
966905461 3:184521168-184521190 CTCCAGAGGCTGAGGTGGGAGGG - Intronic
967042258 3:185704555-185704577 CTCAGGAAGCTGAGGTGGGAGGG - Intronic
967048222 3:185756865-185756887 GTCTAGAGACTGAGGTGGGAAGG + Intronic
967860936 3:194151079-194151101 CTCAGAAGGCTGAGGTAGGAGGG + Intergenic
968036803 3:195554436-195554458 CTCCAGAGGCTGAGGTAGGGAGG + Intergenic
968091105 3:195898731-195898753 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
968166143 3:196466826-196466848 CTCAAGAGGCTGAGGTGGGAGGG - Intergenic
968347772 3:198025477-198025499 CTCAGGAGGCTGAGGTGGGAAGG - Intronic
968784296 4:2608284-2608306 CTCAGGAGACTGAGGCAGAAGGG - Intronic
969409949 4:7021487-7021509 CTCAGGAGGCTGAGCTAGGAGGG + Intronic
969636447 4:8372200-8372222 CTCAAGAGGCTGAGGTAGGGTGG - Intronic
969748134 4:9089944-9089966 CTCAAGAGGCTGAAGCAGGAGGG + Intergenic
970199683 4:13590973-13590995 CTCAAGGGACTGAGGTAGGATGG + Intronic
971415128 4:26419084-26419106 CTCAGGAGGCTGAGGTGGGACGG - Intronic
971994251 4:33943634-33943656 CTCAGCACATTGAGGTTGGAGGG + Intergenic
972306406 4:37834224-37834246 CTCAGGAGGCTGAGGTAGGGGGG + Intronic
972496993 4:39643332-39643354 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
972514645 4:39800466-39800488 CTCAAGAGGCTGAGGTGGGAGGG + Intergenic
972729428 4:41778900-41778922 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
972752567 4:42006577-42006599 CTCAAGATGTTGAGGTAGGAGGG + Intronic
973187314 4:47345526-47345548 TTGAAGACCCTGTGGTAGGAAGG + Intronic
973325130 4:48852985-48853007 CTCAGGAGACTGAGGCAGAATGG - Intronic
974139715 4:57869927-57869949 CTCAAGCGACTGAGATGGGAGGG + Intergenic
975454694 4:74576387-74576409 CTCAGGAGGCTGAGGCAGGAGGG - Intergenic
975460767 4:74650976-74650998 CTCAGGAGGCTGAGGGAGGATGG + Intergenic
975574685 4:75850935-75850957 CTCGACACACTGATGTAGGTAGG + Intergenic
975574815 4:75852023-75852045 CTCAGGAGGCTGAGGCAGGAGGG + Intergenic
976076752 4:81307582-81307604 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
976172776 4:82321444-82321466 CTCAAGAGGCTGAGGCAGGAGGG + Intergenic
976261098 4:83145676-83145698 CTCAGGAGGCTGAGGTGGGAAGG - Intergenic
976400256 4:84598713-84598735 TTCAGGAAGCTGAGGTAGGAGGG - Intronic
976435853 4:85017164-85017186 CTCAGGAGACTGAGGTGGGAGGG + Intergenic
976476923 4:85494988-85495010 CTCGAGAGGCTGAGGTAGAATGG + Intronic
976661283 4:87543221-87543243 AGCAAGACCCTGAGGAAGGAAGG - Intergenic
976709660 4:88055442-88055464 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
977269424 4:94898052-94898074 TTCAGGAGGCTGAGGTAGGAGGG - Intronic
977526763 4:98155652-98155674 CTCAGGATGCTGAGGTGGGAGGG + Intergenic
977940003 4:102847749-102847771 CTCAGGAGGCTGAGGCAGGAGGG - Intronic
978558473 4:110006235-110006257 CTCAAGAGACTGAAGCAGGAGGG + Intronic
978840687 4:113208607-113208629 CTCAGAAAGCTGAGGTAGGAGGG - Intronic
978860964 4:113448621-113448643 CTCAGGAAGCTGAGGTAGAAAGG + Intergenic
979028891 4:115613856-115613878 CTCCAGAAGCTGAGGTTGGAAGG + Intergenic
980017243 4:127664358-127664380 CTCAAAACATTGAGGTTGAAAGG - Intronic
980036967 4:127895819-127895841 CTCAAGAATCTGAGGTGGGAGGG + Intronic
980046769 4:127997995-127998017 CTCAGGAGGCTGAGGTTGGAGGG - Intronic
980224889 4:129969966-129969988 CTCAGGAAGCTGAGGCAGGAGGG - Intergenic
980981855 4:139661217-139661239 CTCAGGAGACTGAGGTGGGAGGG + Intergenic
981541662 4:145852873-145852895 CTCAGGAGGCTGAGGCAGGAGGG - Intronic
982035859 4:151345155-151345177 CTTAGGAGACTGAGGTGGGAGGG - Intergenic
982134196 4:152258322-152258344 CTCAGGACACTTAAGTGGGAAGG - Intergenic
982254320 4:153437331-153437353 CTCAGGAAGCTGAGGTCGGAGGG - Intergenic
982360175 4:154511252-154511274 TTCATGACACTCAGGGAGGAAGG + Intergenic
982627874 4:157790681-157790703 CTGAAGTCAATGAGGTGGGAAGG - Intergenic
982754311 4:159200358-159200380 CTCAGGAGGCTGAGGTGGGAAGG + Intronic
983236941 4:165190205-165190227 CTCAGGAGACTGAGGCAGGAGGG + Intronic
983647133 4:170003420-170003442 CTCAATACACAGATGAAGGAGGG + Intronic
983902046 4:173146261-173146283 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
983921283 4:173347948-173347970 CTCATGACACTGAGGCAGAAGGG + Intergenic
984145141 4:176051293-176051315 CTCAAGGAACTGATATAGGAAGG - Intergenic
984674899 4:182535630-182535652 CTCCAGAGACTGAGGTAGGAGGG + Intronic
984804855 4:183742669-183742691 CTCGGGAGGCTGAGGTAGGAGGG - Intergenic
985022917 4:185711075-185711097 CTCAAGAGGCTGAGGTGGGAGGG - Intronic
985286979 4:188345530-188345552 CTCAGGAGGCTGAGGCAGGAGGG + Intergenic
985299319 4:188471464-188471486 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
985406295 4:189641900-189641922 ATCAAGACGCAGAGGAAGGAAGG - Intergenic
986539002 5:8824637-8824659 CTCAAGGAACTGATGTAAGAAGG + Intergenic
987157798 5:15108600-15108622 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
987372614 5:17207262-17207284 CTCCAGAGGCTGAGGCAGGAGGG + Intronic
987385606 5:17326365-17326387 CTCAGGAGGCTGAGGCAGGAGGG + Intergenic
987471710 5:18339012-18339034 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
987591716 5:19937165-19937187 TTTAAGAAACTGAGGTGGGAAGG + Intronic
987617592 5:20296367-20296389 CTCAGGAGGCTGAGGCAGGAGGG - Intronic
988136320 5:27175911-27175933 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
988436473 5:31180881-31180903 CTCAGGAGGCTGAGGCAGGAGGG + Intergenic
988528835 5:32009622-32009644 CTCATGAGGCTGAGGCAGGAGGG + Intronic
989074952 5:37554812-37554834 CTCGAGAGGCTGAGGCAGGAGGG - Intronic
989120149 5:37997081-37997103 ACCAAGACACTGAGGAAGGCGGG + Intergenic
989174733 5:38512530-38512552 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
989376757 5:40771393-40771415 CTCAGGAGGCTGAGGCAGGAGGG + Intronic
989391203 5:40902669-40902691 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
990029507 5:51239982-51240004 CACAAGACCCTGAGTTAGGTAGG - Intergenic
990249517 5:53898758-53898780 CTCAGGAGGCTGAGGTTGGAAGG - Intronic
990296826 5:54410309-54410331 CTCAGGAGGCTGAGGCAGGAGGG + Intergenic
990298956 5:54431589-54431611 CTCAAGAGGCTGAGGTGGAAGGG + Intergenic
990397914 5:55403091-55403113 CTCAGGAGGCTGAGGTAGGAAGG + Intronic
990480517 5:56206081-56206103 CTCGGGAGGCTGAGGTAGGAGGG - Intronic
991350924 5:65720187-65720209 CTCAGGAGGCTGAGATAGGAGGG - Intronic
991426390 5:66496601-66496623 CTCCATACACAGAGGTAGGGAGG + Intergenic
991715250 5:69445779-69445801 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
991723026 5:69511517-69511539 CTCAGGAGACTGAGGTAGGAGGG - Intronic
991919718 5:71643272-71643294 CTCAGGAGGCTGAGGTAAGAGGG + Intronic
992057802 5:73009642-73009664 CTCAGGAGGCTGAGGTGGGAAGG - Intronic
992238006 5:74732060-74732082 CTCAGGATGCTGAGGTGGGAAGG - Intronic
992426984 5:76667985-76668007 CTCAAGAGGCTGAGGTTGGGAGG - Intronic
992472768 5:77074853-77074875 CTAAAGAAACTGAGCTAGAAAGG - Exonic
992862233 5:80922904-80922926 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
992963082 5:81974721-81974743 CTCAGGAGGCTGAGGCAGGAGGG - Intronic
993011411 5:82487854-82487876 CTCAGGAGGCTGAGGCAGGAGGG - Intergenic
993610906 5:90052995-90053017 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
993896447 5:93541169-93541191 TTCACCACATTGAGGTAGGAGGG + Intergenic
994337348 5:98583188-98583210 GTCAAGACACTTAGGTTGGCAGG + Intergenic
994344540 5:98669012-98669034 CTCCATCCACTGAGGAAGGATGG - Intergenic
994362464 5:98868217-98868239 CTCGAGAGGCTGAGGCAGGAGGG + Intronic
994595050 5:101821531-101821553 CTCAAGAGGCTGAGGCAGGAGGG - Intergenic
995348567 5:111149038-111149060 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
995378677 5:111507993-111508015 CTGTAGACAATGAGGTATGATGG - Intronic
996538182 5:124600737-124600759 CTCAGGAAGCTGAGGTGGGAGGG + Intergenic
996626815 5:125580089-125580111 CTCGAGAGGCTGAGGTGGGAGGG - Intergenic
997003434 5:129789491-129789513 CTCAAAAAACTGAGGATGGAAGG + Intergenic
997161850 5:131617199-131617221 CTCAGGAGGCTGAGGCAGGAGGG + Intronic
997512692 5:134464454-134464476 CTCAGGATGCTGAGGCAGGAGGG - Intergenic
997556245 5:134801161-134801183 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
997811988 5:136979444-136979466 CTCATTACACCGAGGTATGAAGG + Exonic
997954226 5:138265801-138265823 CTCAGGAGGCTGAGGTAGGTAGG - Intronic
998016353 5:138735292-138735314 CCCAGGAAACTGAGGTGGGAGGG - Intronic
998086572 5:139330896-139330918 CTCAGGAGACTGAGGTAGGAGGG - Exonic
998188561 5:140002074-140002096 CTCAGGAGGCTGAGGCAGGAGGG + Intronic
998236014 5:140399780-140399802 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
998801759 5:145875919-145875941 CTCAGGAGGCTGAGGCAGGAGGG + Intergenic
998867203 5:146517308-146517330 CTTAAGAGACTGAGGTGAGAGGG + Intergenic
999171911 5:149602592-149602614 CTCAGGAGGCTGAGGCAGGAGGG - Intronic
999300432 5:150486822-150486844 CCCGAGACCCTGAGGGAGGAGGG - Intronic
999301872 5:150496269-150496291 CTCGGGAGGCTGAGGTAGGAGGG + Intronic
999749136 5:154613571-154613593 CTCATGAGGCTGAGGTGGGAGGG + Intergenic
999804575 5:155069895-155069917 CTCAGGAGGCTGAGGTAGGAGGG - Intergenic
999992201 5:157059879-157059901 CTCAGGAGGCTGAGGCAGGAGGG + Intergenic
1000311637 5:160050731-160050753 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1000339163 5:160264051-160264073 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1000470306 5:161631796-161631818 CTCAAGTGGCTGAGGTGGGAGGG - Intronic
1000850569 5:166335151-166335173 CTGAAAACACTGAGGTAGCTGGG - Intergenic
1001157415 5:169285016-169285038 CTCAGGAGGCTGAGGTGGGAAGG - Intronic
1001356822 5:171034928-171034950 CTCAGGAGGCTGAGGCAGGAGGG - Intronic
1001391738 5:171385186-171385208 CTCAGGAGGCTGAGGTAGGTGGG - Intergenic
1001458852 5:171890413-171890435 CTCAGGAGGCTGAGGTAGGACGG + Intronic
1001499405 5:172217591-172217613 CTCATGAGACTAAGGCAGGAGGG - Intronic
1001568101 5:172713447-172713469 CCCAAGGGCCTGAGGTAGGAAGG + Intergenic
1001750783 5:174129484-174129506 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1001911778 5:175525714-175525736 CTCAGGATGCTGAGGCAGGAGGG - Intronic
1001939978 5:175733516-175733538 CTCCAGACACTGGGAAAGGAAGG - Intergenic
1002038913 5:176496234-176496256 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1002335283 5:178473400-178473422 CTCTGGAGGCTGAGGTAGGAGGG - Intronic
1002619036 5:180473812-180473834 CTCAGGAGGCTGAGGTAGGAGGG + Intergenic
1002860085 6:1072433-1072455 CTGAAGATACTGAGGTCAGAGGG + Intergenic
1003156453 6:3600548-3600570 CTCAAGAGGCTGAGGTGGGGAGG - Intergenic
1003553616 6:7120929-7120951 CTCGAGAGGCTGAGGCAGGAGGG - Intronic
1003596095 6:7475527-7475549 CTCAGGAGGCTGAGATAGGAGGG - Intergenic
1003906962 6:10710298-10710320 CTCAAGAGGCGGAGGTGGGAAGG + Intergenic
1004577838 6:16915459-16915481 CTCAGGAGGCTGAGGCAGGAGGG - Intergenic
1004818641 6:19341156-19341178 CTCAGGAGACTGGGGTAGGAGGG - Intergenic
1004904531 6:20224496-20224518 CTCAGGAGTCTGAGGTGGGAGGG - Intergenic
1004934587 6:20495132-20495154 CTCAGGAGACTGAGGCGGGAAGG - Intergenic
1004971345 6:20913880-20913902 CTCAGGAGGCTGAGGCAGGAAGG + Intronic
1005846994 6:29789654-29789676 CTCAGGACGCTGAGATAAGAGGG - Intergenic
1005851442 6:29825992-29826014 CTCTGAAGACTGAGGTAGGAGGG + Intergenic
1005863830 6:29923394-29923416 CTCAAGAGGCTGAGGTCAGAGGG - Intergenic
1006389727 6:33751295-33751317 CTGAAGATACTGGGGTAGAAGGG + Intergenic
1006557247 6:34878142-34878164 CTCAGGAGACTGAGGTGGGAGGG + Exonic
1006649488 6:35539081-35539103 CTCAAGAGGCTGAGGTGGGAGGG - Intergenic
1006664192 6:35677889-35677911 CTCAAGAGGCTGAGGTGGGAGGG - Intronic
1006760529 6:36456693-36456715 CTCAGGAGGCTGAGGCAGGAAGG - Intronic
1006922045 6:37633589-37633611 CTGCAGACACTGTGGTGGGAGGG + Exonic
1006964225 6:37965868-37965890 CTCAGGAGGCTGAGGTGGGAAGG - Intronic
1007225056 6:40308051-40308073 CTGAAGACTCTTAGGTAGGGAGG - Intergenic
1007654236 6:43442620-43442642 CTCAGGAGGCTGAGGTGGGAAGG + Intronic
1007674852 6:43585049-43585071 CTCAGGAAGCTGAGGTGGGAGGG + Intronic
1007877903 6:45127204-45127226 CTCAGGAGGCTGAGGCAGGAGGG + Intronic
1007941117 6:45782493-45782515 CTCAGGAAATTGAGGTGGGAAGG - Intergenic
1008085827 6:47243022-47243044 CTCAAGACCTTGAAGTAAGAAGG + Intronic
1008314579 6:50024911-50024933 ATCAAGAAACTGAGGAAGGTTGG + Intergenic
1008936027 6:56993803-56993825 CTCAGGAGGCTGAGGCAGGAGGG - Intronic
1008997527 6:57676059-57676081 CTCAAGAGGCTAAGGTGGGAGGG - Intergenic
1009186032 6:60575392-60575414 TTCAAGAGGCTAAGGTAGGAGGG - Intergenic
1009812698 6:68689262-68689284 GTCAAGGCACTGAGGCAGGCAGG + Intronic
1010136824 6:72564716-72564738 CTTAAGACACTAAGGTAGAAGGG - Intergenic
1010149020 6:72708627-72708649 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1010385778 6:75277796-75277818 CTCAAGAGGCTGAGGTGGAAGGG + Intronic
1011577254 6:88816306-88816328 CTCACTAGACTGAAGTAGGATGG - Intronic
1011720538 6:90151390-90151412 CTCAGGAGACTGAGGCAGGAGGG - Intronic
1011818694 6:91224518-91224540 CTCCAGAGGCTGAGGTGGGAGGG - Intergenic
1012067090 6:94561430-94561452 CTGAGGCCACAGAGGTAGGAAGG - Intergenic
1012553742 6:100488108-100488130 CTCAAGAAAGTGAGTTTGGAGGG - Intergenic
1012868381 6:104644814-104644836 CTGAGGACACGGAGGTAGCAAGG - Intergenic
1012872163 6:104685182-104685204 CTCAAGCCACTGAGATATTAGGG + Intergenic
1013223538 6:108101784-108101806 CTCAGGAAGCTGAGGTAGGAGGG - Intronic
1013511990 6:110853413-110853435 CTCAGGAGGCTGAGGCAGGAGGG - Intronic
1013518625 6:110912440-110912462 CTCAGGAGGCTGAGGTAGGGAGG - Intergenic
1013837191 6:114346331-114346353 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1014026006 6:116646680-116646702 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1014063686 6:117101572-117101594 CTCAAGAGGCTGAGGTGGGAGGG - Intergenic
1014153109 6:118081525-118081547 CTCAAGAGGCTGAGGCAAGAGGG + Intronic
1014474829 6:121859608-121859630 CTCAGGAGACTGAGGTGGGAGGG - Intergenic
1014742897 6:125167154-125167176 CTCAAGAGGCTGAGGTGGGAGGG + Intronic
1015561412 6:134520282-134520304 CTCAAGAGGCTGAGGCGGGAGGG - Intergenic
1015615530 6:135070537-135070559 CTCAGGAGGCTGAGGTGGGAAGG - Intronic
1015624538 6:135166670-135166692 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1015765284 6:136709822-136709844 CTCAAGAGGCAGAGGCAGGAGGG + Intronic
1016943631 6:149506700-149506722 CTTAGGAGACTGAGGTGGGAAGG - Intronic
1017016834 6:150108011-150108033 CTCAGGAGGCTGAGGCAGGAGGG - Intergenic
1017147364 6:151246867-151246889 CTCAGGAGGCTGAAGTAGGAGGG - Intronic
1017249989 6:152270041-152270063 CCCAAGACACTGAACTAGGCAGG + Intronic
1017307912 6:152940542-152940564 TTCAAGGCCCAGAGGTAGGAGGG - Intergenic
1017566821 6:155695880-155695902 CTTAAGAAGCTGAGGTAAGAGGG + Intergenic
1017614010 6:156225312-156225334 CTCAAAACACTGAGGATAGAAGG + Intergenic
1017815736 6:158015312-158015334 CTTAAGACAATGAGGTAGAGAGG + Intronic
1018406837 6:163494296-163494318 CTCAAGTCACTGATATAGGAAGG - Intronic
1018880011 6:167868301-167868323 CTCAAGAGGCTGAGGTTGGAGGG + Intronic
1019670740 7:2276835-2276857 CTCAGGAGACTGAGGTGGGAGGG + Intronic
1020056717 7:5122661-5122683 CTCAGGAGGCTGAGGTGGGAAGG + Intergenic
1020063998 7:5173669-5173691 CTCGAGAGGCTGAGGTGGGAGGG - Intergenic
1020089637 7:5331800-5331822 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1020171187 7:5846301-5846323 CTCAGGAGGCTGAGGTGGGAAGG - Intergenic
1020209411 7:6147353-6147375 CTCAGGAGGCTGAGGCAGGAGGG + Intronic
1020477945 7:8621019-8621041 GTTATGACACTGAGGTAGGCTGG + Intronic
1020537504 7:9419520-9419542 CTCAAGAGGCTGAGGCAGGAGGG + Intergenic
1021115563 7:16742695-16742717 CTCAAGAGGCTGAGCTGGGAGGG + Intergenic
1021378386 7:19936878-19936900 CTCAAGAGACTGAAGTGAGAAGG - Intergenic
1021549919 7:21860063-21860085 CCCAAGAGGCTGAGGTGGGAGGG + Intronic
1021561288 7:21971277-21971299 CTCGAGAAGCTGAGGTGGGAGGG - Intergenic
1021800530 7:24301667-24301689 CTTACTACACTGAGGTAGTAAGG - Intergenic
1021922719 7:25502807-25502829 CTCAGGAGACTGAGATGGGAGGG - Intergenic
1022005920 7:26265541-26265563 CTCAGGAGACTGAGGTGGGAGGG - Intergenic
1023180196 7:37474770-37474792 CTCAGGAGGCTGAGATAGGAGGG - Intergenic
1023250375 7:38253888-38253910 CTCGAGAGGCTGAGGCAGGAGGG + Intergenic
1023251680 7:38269992-38270014 CTCGAGAAGCTGAGGCAGGAGGG + Intergenic
1023254719 7:38301735-38301757 CTCAAGAGGCTGAGGCAGGAGGG - Intergenic
1023402918 7:39803467-39803489 CTCGGGAGGCTGAGGTAGGAAGG - Intergenic
1023770205 7:43550178-43550200 CTCAGGAGGCTGAGGCAGGAGGG + Intronic
1023849592 7:44142798-44142820 CTCCAGAGGCTGAGGCAGGAAGG - Intergenic
1024182871 7:46915353-46915375 CTCAGGAGGCTGAGGCAGGAGGG - Intergenic
1024637969 7:51306085-51306107 CTCAAGACACTCGGGAAGCAAGG - Intronic
1024646714 7:51377175-51377197 CTCGGGAGGCTGAGGTAGGAAGG + Intergenic
1024868059 7:53926437-53926459 CTCAGGAGGCTGAGGTAGGAGGG + Intergenic
1025083421 7:56003827-56003849 CTCAAGAGGCTGAGGTGGGAGGG - Intergenic
1025625223 7:63215395-63215417 CTCAAGAGGCTGTGGTGGGAGGG + Intergenic
1025843391 7:65173186-65173208 CTCAGGAGGCTGAGGTGGGAAGG - Intergenic
1025879654 7:65522781-65522803 CTCAGGAGGCTGAGGTGGGAAGG + Intergenic
1025893783 7:65679807-65679829 CTCAGGAGGCTGAGGTGGGAAGG - Intergenic
1026070663 7:67116579-67116601 CTTGAGACACTGAGATAAGAGGG + Intronic
1026118190 7:67514000-67514022 TTCGGGACGCTGAGGTAGGAAGG - Intergenic
1026134958 7:67651863-67651885 CTCAAGACGCTGAGGTGGGAGGG - Intergenic
1026212362 7:68317035-68317057 CTCAGGAGGCTGAGGTGGGAAGG - Intergenic
1026325508 7:69305977-69305999 CTCAGGAGACTGAGGCAGAAGGG - Intergenic
1026350659 7:69512523-69512545 CTCAGGAGGCTGAGGTGGGATGG + Intergenic
1026418234 7:70205288-70205310 CTCAGGAGACAGAGGCAGGAGGG - Intronic
1026588158 7:71674621-71674643 CTCAGGAGTCTGAGGTGGGAGGG - Intronic
1026669836 7:72380337-72380359 CTTAAGAAACAGAGGTAGGCTGG + Intronic
1026706235 7:72695698-72695720 CTTGAGACACTGAGATAAGAGGG - Intronic
1026823203 7:73563817-73563839 CTCAGGAGGCTGAGGCAGGAGGG - Intergenic
1026910234 7:74087294-74087316 CTCAAGAGGCTGAGGTGGCAGGG + Intronic
1026971551 7:74471566-74471588 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1027148467 7:75715281-75715303 CTCAGGAGGCTGAGGCAGGAGGG + Intronic
1027195536 7:76027514-76027536 CTCAGGAGGCTGAGATAGGAGGG + Intronic
1027560349 7:79720580-79720602 CACCAGACCCTGAAGTAGGAGGG - Intergenic
1028179959 7:87707564-87707586 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1028564850 7:92218486-92218508 CTCAGGAGACTGAGGTGGGAAGG - Intronic
1028566821 7:92242923-92242945 CTCAGGAGGCTGAGGCAGGAGGG - Intronic
1028595400 7:92543131-92543153 CTCAAAAGGCTGAGGCAGGAGGG + Intergenic
1028847333 7:95496738-95496760 CTCAGGAGACTGAGGTAGGAGGG + Intronic
1029087425 7:98022262-98022284 CTCAGGAGACTGAGGTGGGAGGG + Intergenic
1029241102 7:99163494-99163516 CTCAGGAGGCTGAGGTAGAAGGG - Intergenic
1029303921 7:99604883-99604905 CTCAAAAGGCTGAGGTTGGAGGG + Intronic
1029428522 7:100513521-100513543 CTCAAGAGGCTGAGGTGGGAGGG + Intergenic
1029454810 7:100663907-100663929 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1029631350 7:101752800-101752822 CTCAGGAAGCTGAGGTAGGAGGG - Intergenic
1029656132 7:101925823-101925845 CTCAGAAGGCTGAGGTAGGAGGG + Intronic
1029982269 7:104890193-104890215 CTCAAGAGCCTGAGTTGGGAGGG + Intronic
1030844309 7:114390660-114390682 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1031135473 7:117879385-117879407 TTCAGGAGGCTGAGGTAGGAGGG - Intergenic
1031268055 7:119607470-119607492 CTGAAGACACTGGGGTAGGATGG + Intergenic
1032104054 7:129010273-129010295 CTCAAGAGGCTGAGGCAGGAAGG - Intronic
1032165092 7:129539275-129539297 CTCAGGAGGCTGAGGTGGGAAGG - Intergenic
1032414306 7:131724734-131724756 CTCAGGAGGCTGAGGCAGGAAGG - Intergenic
1032462759 7:132124056-132124078 CTCCAGGCCCTGAGGTGGGAAGG - Exonic
1032835025 7:135664456-135664478 CTAAAGAGGCTGAGGTGGGAAGG - Intronic
1033259615 7:139831411-139831433 TTCAAGACAATGAAGCAGGAAGG - Intronic
1033507795 7:142023166-142023188 CTCCAGACACTGAGGTACGAGGG - Intronic
1033568823 7:142606931-142606953 CTCGGGAAACTGAGGCAGGAGGG + Intergenic
1033677891 7:143561718-143561740 CTCAGGAGGCTGAGGTAGGAGGG + Intergenic
1033693946 7:143767719-143767741 CTCAGGAGGCTGAGGTAGGAGGG - Intergenic
1034027144 7:147717777-147717799 CTCAAGAGGCGGAGGTGGGAGGG + Intronic
1034123479 7:148649908-148649930 CTCAGGAAACTGAGGTGGGAGGG + Intergenic
1034519041 7:151604529-151604551 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1034533698 7:151713685-151713707 CTCAGGAAGCTGAGGCAGGAGGG - Intronic
1034598227 7:152219893-152219915 CTCAGGAGGCTGAGGTAGGAGGG + Intronic
1034604020 7:152293964-152293986 CTCAAGAGGTTGAGGTGGGAGGG - Intronic
1034642995 7:152619838-152619860 CTTAGGAGACTGAGGTGGGAAGG + Intergenic
1035576295 8:708799-708821 CTCAAGAGGCTGAGGTGGGAGGG - Intronic
1035962283 8:4150342-4150364 CTGCAGACACTGAGTTAGAATGG - Intronic
1036194571 8:6702546-6702568 CTCAGGAGGCTAAGGTAGGAGGG - Intergenic
1036458939 8:8934787-8934809 CTTGGGACACTGAGGCAGGAGGG + Intergenic
1036577730 8:10044350-10044372 CTCAGGAGGCTGAGGTGGGATGG - Intergenic
1036948818 8:13121654-13121676 CTCAGGAGGCTGAGGCAGGAGGG - Intronic
1037537986 8:19845003-19845025 CTCAGAAGGCTGAGGTAGGAGGG - Intronic
1037572266 8:20168257-20168279 CTCAAGAAGCTGAGGCAAGAGGG + Intronic
1037724834 8:21474519-21474541 CTCAGGAGGCTGAGGAAGGAGGG - Intergenic
1037778497 8:21851296-21851318 CTCAGGAGACTGAGGTCGGCAGG + Intergenic
1037848198 8:22303501-22303523 CTCCAGAGACTGAGGGAGGTGGG - Intronic
1037861530 8:22408926-22408948 CTCAGGAGGCTGAGGCAGGAGGG - Intronic
1038301557 8:26355345-26355367 CTCAGGAGACTGAGGTAGGGAGG - Intronic
1038310052 8:26439540-26439562 CTCAGGAGACTGAGGTAGGGAGG - Intronic
1038458908 8:27699445-27699467 CTCATGAAGCTGAGGTGGGAGGG - Intergenic
1038671522 8:29586819-29586841 CTCAGGAGACTAAGGCAGGAGGG + Intergenic
1038843427 8:31206915-31206937 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1039529938 8:38251823-38251845 CTCAGGACCCTGAGGTAGGTAGG - Intronic
1039702934 8:39979927-39979949 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1039812464 8:41061774-41061796 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1040732041 8:50459680-50459702 CAATAGACACTGAGGCAGGAGGG - Intronic
1040888344 8:52289552-52289574 CTCATGACACTGGGGTATTATGG - Intronic
1040901379 8:52420114-52420136 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1041176698 8:55204116-55204138 CTCCAGAGACTGCGGTGGGAGGG - Intronic
1041538118 8:58951359-58951381 TTCAGGACACTGGGGGAGGAGGG + Intronic
1041646934 8:60262608-60262630 CTCAGGAAGCTGAGGCAGGAGGG + Intronic
1041660833 8:60399406-60399428 CTCAGGAGGCTGAGGCAGGAGGG + Intergenic
1041704554 8:60832127-60832149 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1041731885 8:61070730-61070752 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1042139721 8:65665729-65665751 CTCAGGAAGCTGAGGGAGGAGGG - Intronic
1042413509 8:68492335-68492357 CTCAAGAGGCTGAGGTGGGAGGG - Intronic
1042507912 8:69580715-69580737 CTCACATCACTGAGGTAGAAGGG + Intronic
1042595985 8:70448910-70448932 CTCAGGAGACTAAGGTGGGAGGG - Intergenic
1042615523 8:70644577-70644599 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1042782975 8:72512117-72512139 CTTAAAATACTGAGGTGGGAGGG - Intergenic
1043039494 8:75243296-75243318 CTCAAGACACTTAGGCAAGTTGG - Intergenic
1043159040 8:76822545-76822567 CTCAGGATACTGAGGTGGGGAGG - Intronic
1043932338 8:86105404-86105426 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1043966017 8:86476801-86476823 CTCAGGAGGCTGAGGCAGGAAGG - Intronic
1044105369 8:88198425-88198447 ATAAATAGACTGAGGTAGGAAGG - Intronic
1044143401 8:88683066-88683088 CTGGAGACACTGAAGTAGGGTGG + Intergenic
1044565667 8:93659100-93659122 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1044649709 8:94481486-94481508 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1044672719 8:94699530-94699552 CTCCGGAGGCTGAGGTAGGAGGG + Intronic
1045011997 8:97966447-97966469 CTCCAGAGGCTGAGGTGGGAGGG + Intronic
1045118528 8:99011011-99011033 CTCAAGACTTTGAGGCAGGTTGG - Intergenic
1045648016 8:104318083-104318105 CTCAGGAGGCTGAGGCAGGAAGG - Intergenic
1045679874 8:104647072-104647094 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1045964419 8:108007830-108007852 CTCCAGAGGCTGAGGCAGGAGGG + Intronic
1046325672 8:112641728-112641750 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1047122824 8:121925538-121925560 CTCAGGAAACTGAGGTGGGAGGG + Intergenic
1047396371 8:124502894-124502916 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1047467770 8:125135013-125135035 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1048085232 8:131170171-131170193 CTCAAGAGACTGAGGCAGAAAGG - Intergenic
1048962457 8:139591921-139591943 CTCAGGAAGGTGAGGTAGGAGGG + Intergenic
1049549239 8:143249168-143249190 CTCAGGAAGCTGAGGTGGGAAGG + Intronic
1050183860 9:2950439-2950461 CTCAGGAGGCTGAGGTGGGATGG + Intergenic
1050541174 9:6671676-6671698 CTCCAGAGACTGAGGTAGGAGGG - Intergenic
1050624202 9:7486404-7486426 CTCTAGAGGCTGAGGTGGGAGGG - Intergenic
1050656499 9:7834158-7834180 GTCAACTCACTGAGGAAGGAGGG - Intronic
1050662088 9:7893648-7893670 CTCAAGACCATGAGCTAAGAGGG + Intergenic
1050706211 9:8401270-8401292 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1050827013 9:9959586-9959608 CTGAAGAGAATGAGGTAGAAAGG + Intronic
1051267104 9:15319729-15319751 CTCAGGAGACTGAGGCAGGAGGG - Intergenic
1051407007 9:16748403-16748425 CTCCAGAGGCTGAGGTGGGAGGG + Intronic
1051658525 9:19405400-19405422 CTCATGAGGCTGAGGTGGGAGGG + Intergenic
1051665190 9:19462268-19462290 CTCAGGAGGCTGAGGCAGGAGGG - Intergenic
1051997374 9:23234106-23234128 CTCAGGAGGCTGAGGCAGGAGGG - Intergenic
1052582829 9:30382597-30382619 CTCAGGAGGCTGAGGTAGGATGG + Intergenic
1052716672 9:32126422-32126444 CTCAAGACACAGAGATTGGCTGG - Intergenic
1052959548 9:34283260-34283282 CTCAGGAGACTGAGGTGGGAAGG + Intronic
1053171600 9:35890853-35890875 CTCAGGAGGCTGAGGTGGGAAGG - Intergenic
1053202204 9:36160383-36160405 CTCAGGAAGCTGAGGTGGGAGGG + Intronic
1053327644 9:37169953-37169975 CTCAAGAGGCTGAGGCTGGAGGG + Intronic
1053408102 9:37895307-37895329 CTCAGGAGGCTGAGGCAGGAGGG - Intronic
1053929831 9:43107347-43107369 CTCAAAAGGCTGAGGCAGGAGGG - Intergenic
1054151383 9:61608603-61608625 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1054767086 9:69051204-69051226 CTCAGGAGCCTGAGGTGGGAGGG - Intronic
1054935704 9:70685511-70685533 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1055474613 9:76649476-76649498 CTCAGGAGGCTAAGGTAGGAGGG + Intronic
1055533622 9:77213606-77213628 CTCAAGAGGCTGAGGCAGGAAGG - Intronic
1055638559 9:78300821-78300843 CTCAGGATGCTGAGGCAGGAGGG - Intronic
1056131014 9:83586514-83586536 CTCAGGCCACAGAGGCAGGAAGG + Intergenic
1056388708 9:86120415-86120437 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1056412324 9:86342231-86342253 CTCGGGAGACTGAGGTTGGAGGG - Intronic
1056530757 9:87485488-87485510 CTCAGGAGGCTAAGGTAGGAGGG - Intergenic
1056673969 9:88657267-88657289 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1057215429 9:93225286-93225308 CTCAAGAGGCTGAGGTGGGAGGG + Intronic
1057647982 9:96894833-96894855 CTCAGGAGGCTGAGGCAGGAGGG - Intergenic
1058285835 9:103176839-103176861 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1058444886 9:105046135-105046157 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1058491304 9:105502983-105503005 CTCAGGAGGCTGAGGCAGGAGGG - Intronic
1059072341 9:111151982-111152004 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1059257179 9:112941508-112941530 CTCTGGAGACTGAGGTGGGAAGG + Intergenic
1059258463 9:112952778-112952800 CTCAAGAGCTTGAGGTGGGAGGG + Intergenic
1059694557 9:116718672-116718694 CTCAAGACATTCAGGTGGGAGGG - Intronic
1059725454 9:117004225-117004247 CTCTAGAAGCTGAGGTGGGAGGG - Intronic
1060120621 9:120986142-120986164 CTCAAGAGACTAAGGTTGGTGGG - Intronic
1060145108 9:121245858-121245880 CTCAAGAGGCTGAGGCAAGAGGG - Intronic
1060313357 9:122484924-122484946 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1060387144 9:123241399-123241421 CTCAAGAGGCTGAGGTGGGAGGG + Intronic
1060459200 9:123833015-123833037 CTCAGGAAGCTGAAGTAGGAGGG + Intronic
1060501348 9:124158707-124158729 CTCAGGAGGCTGAGGCAGGAGGG + Intergenic
1060541841 9:124436210-124436232 CTCAGGAGACTGAGGTAGGAAGG + Intergenic
1060598615 9:124862953-124862975 CTCGGGAGACTGAGGTGGGAGGG - Intronic
1060706149 9:125803193-125803215 CTCAGGAAGCTGAGGTGGGAGGG - Intronic
1060863199 9:126973258-126973280 CTCAGGAGGCTGAGGCAGGAGGG + Intronic
1060872606 9:127054868-127054890 CGCAGGAGACTGAGGCAGGAAGG + Intronic
1060924467 9:127446431-127446453 CTTAGGATGCTGAGGTAGGAGGG - Intergenic
1061357855 9:130119929-130119951 CTTGAGAGGCTGAGGTAGGAGGG - Intronic
1061420071 9:130468517-130468539 CTCAGGAGGCTGAGGTAGGAGGG - Intronic
1062371049 9:136238908-136238930 CTTAGGACGCTGAGGCAGGAGGG + Intronic
1062679090 9:137767225-137767247 CTCAAGAGGCTGAGGCAGGAGGG - Intronic
1203657382 Un_KI270753v1:11337-11359 ATCAAGACGCAGAGGAAGGAAGG - Intergenic
1185448561 X:271233-271255 CCCAGGACACAGAGGGAGGAAGG + Intergenic
1185562881 X:1073156-1073178 CTCTAGAGGCTGAGGTGGGAGGG - Intergenic
1185863731 X:3604025-3604047 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1186020550 X:5250772-5250794 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1186027908 X:5334046-5334068 CTTGAGAGGCTGAGGTAGGAGGG + Intergenic
1186094671 X:6086737-6086759 CTCAGAAGACTGAGGTGGGAGGG - Intronic
1186148415 X:6648710-6648732 CTCGAGACGCTGAGGTGGGAGGG - Intergenic
1186175437 X:6921273-6921295 CTCAGGAGGCTGAGGCAGGAGGG + Intergenic
1186254615 X:7704708-7704730 TGCAAGACAATGAGGTTGGAAGG + Intergenic
1186272932 X:7909141-7909163 CTGAAGTCACTGAGCTTGGAAGG - Intronic
1186456225 X:9712162-9712184 CTCTAGATACTGAGGTTAGAAGG + Intronic
1186492868 X:9988185-9988207 CTCAAGAAGCTGAGGGAGGAGGG + Intergenic
1186567162 X:10675961-10675983 TTCAAGACACTGTGAAAGGAGGG - Intronic
1186752701 X:12638342-12638364 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1186802436 X:13106696-13106718 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1187407487 X:19016832-19016854 CTTGGGAGACTGAGGTAGGAGGG - Intronic
1187472616 X:19582445-19582467 CTGAAGATACCGAGGAAGGAGGG - Intronic
1187834488 X:23417578-23417600 CTCAGGAGACTGAGGCAGGAGGG - Intergenic
1187914840 X:24143823-24143845 CTCAGGAGGCTGAGGCAGGAGGG - Intergenic
1188321592 X:28745056-28745078 CTCAAGAAACTGAGGTAACTTGG - Intronic
1188376938 X:29442748-29442770 CTCAGGAGGCTGAGGTAGGAGGG + Intronic
1188541372 X:31254462-31254484 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1188623216 X:32251874-32251896 CCCAGGAAGCTGAGGTAGGAGGG + Intronic
1188932235 X:36125870-36125892 ATGATGACACTGAGGGAGGAAGG - Intronic
1188993501 X:36853407-36853429 CTCAGGAGGCTGAGGCAGGAGGG - Intergenic
1189504298 X:41595495-41595517 CTCAAGATGGGGAGGTAGGAGGG + Intronic
1189920826 X:45901574-45901596 ATCAAGAAAATGAGGTTGGAGGG + Intergenic
1190074876 X:47309657-47309679 CTCAAGAGGCTGAAGAAGGAGGG - Intergenic
1190103964 X:47545142-47545164 CTCAGGATGCTGAGGTGGGAGGG + Intergenic
1190111726 X:47594124-47594146 CTCAGGAGGCTGAGGTGGGAAGG + Intronic
1190130693 X:47746170-47746192 TTCAAGACACTGGGGCAGGCTGG + Intergenic
1190146130 X:47893169-47893191 GTTAAGAGACTGAAGTAGGAAGG + Intronic
1190361007 X:49648301-49648323 CTCAGGAGGCTGAGGCAGGAGGG - Intergenic
1190767573 X:53488333-53488355 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1191004252 X:55694027-55694049 CTCAGGAGGCTGAGGAAGGAGGG - Intergenic
1192095817 X:68209456-68209478 CTCAGGAGGCTGAGGTAGGAGGG + Intronic
1192115634 X:68408045-68408067 CTCAGGAGGCTGAGGCAGGAGGG - Intronic
1192119810 X:68444864-68444886 CTCAGGAGGCTGAGGTAGGTGGG + Intergenic
1192345283 X:70298161-70298183 CTCAGGAGGCTGAGGTAGGGTGG + Intronic
1192615439 X:72616258-72616280 CTCAGGAAACTGAAGTTGGAGGG + Intronic
1193064062 X:77238845-77238867 CTCAGGAGGCTGAGGTGGGAAGG + Intergenic
1193122861 X:77841781-77841803 CTCAGGAGGCTGAGGTGGGAGGG - Intronic
1193424759 X:81328310-81328332 CTTAAGATGCTGAGGTAGGAGGG + Intergenic
1194356199 X:92887590-92887612 CTCAGGAGGCTGAGGCAGGAGGG + Intergenic
1194425656 X:93734319-93734341 CTCCAGAGGCTGAGGTGGGAGGG - Intergenic
1195376348 X:104231612-104231634 CTTAAGAGGCTGAGGTAGGAGGG - Intergenic
1195383300 X:104290831-104290853 CTCGGGAGACTGAGGTGGGAAGG + Intergenic
1195420253 X:104667482-104667504 ACAAAGACACTGAGGTAGGTAGG + Intronic
1195873195 X:109508249-109508271 CTCAAGAAGCTGAGGTTGGGAGG + Intergenic
1196086840 X:111692894-111692916 CTCCAGAGGCTGAGGTGGGAGGG - Intronic
1196100208 X:111839822-111839844 CTCAGGAGACTGAGGCAGGAGGG - Intronic
1196310493 X:114158484-114158506 CACAAGAGGCTGAGGTGGGAGGG + Intergenic
1196408555 X:115392426-115392448 CTCAGGAGATTGAGGTGGGAGGG + Intergenic
1196426640 X:115576461-115576483 CTCAGGAGGCTGAGGTGGGAGGG + Intronic
1196790790 X:119462606-119462628 CTCAGGAGTCTGAGGCAGGAGGG - Intergenic
1197043310 X:121966655-121966677 CTGAAGAGACAGAGGTAGAAAGG + Intergenic
1197213177 X:123845015-123845037 CTCAGGAGGCTGAGGTGGGAGGG + Intergenic
1197359370 X:125480397-125480419 CTCAAGAGGCTGAGGTGGGAGGG - Intergenic
1197448946 X:126587395-126587417 CTCAGGAGGCTGAAGTAGGAGGG - Intergenic
1197651185 X:129066340-129066362 CTCAGAAGACTGAGATAGGAGGG + Intergenic
1197775485 X:130116225-130116247 CTCGGGAGGCTGAGGTAGGAGGG - Intergenic
1198234310 X:134722161-134722183 CTCAGGAGACTGAGGCAGGAGGG - Intronic
1199221156 X:145316897-145316919 CTCAGGAGGCTGAGGTGGGAGGG - Intergenic
1199271066 X:145883192-145883214 GTAAAGACTCTGAGGTGGGATGG - Intergenic
1199761637 X:150908961-150908983 CTTAAGAGGCTGAGGCAGGAGGG + Intergenic
1200112172 X:153746348-153746370 CTCAGGAGGCTGAGGTAGGAGGG - Intergenic
1200231829 X:154447738-154447760 CTCAAGTGGCTGAGGTGGGAGGG - Intronic
1200664547 Y:6004587-6004609 CTCAGGAGGCTGAGGCAGGAGGG + Intergenic
1201551598 Y:15222703-15222725 CTCAGGAAGCTGAGGTAGGAAGG - Intergenic
1201594900 Y:15657736-15657758 CTCAGGAGGCTGAGGCAGGAAGG - Intergenic