ID: 929506030

View in Genome Browser
Species Human (GRCh38)
Location 2:42528807-42528829
Sequence TCAACCCCCAGAACAAGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 195}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929506030 Original CRISPR TCAACCCCCAGAACAAGAAG AGG Intronic
900654439 1:3748090-3748112 TCATTTCCCAGAACAAGGAGTGG - Intergenic
901113712 1:6821106-6821128 ACAACTCTAAGAACAAGAAGGGG + Intronic
901872557 1:12146526-12146548 GTAGCCCACAGAACAAGAAGAGG - Intergenic
902229733 1:15020366-15020388 TCAGCACCCAGATCAAGAATAGG + Intronic
903268970 1:22176084-22176106 TCCACATCCAGAACAAGGAGGGG - Intergenic
907325961 1:53638731-53638753 CCCACACCCAGAACAAGGAGTGG + Intronic
910138466 1:83999325-83999347 TAAACCCCCAGAAGAGGCAGCGG - Intergenic
912243734 1:107939079-107939101 GCAGCCCCCAGAACCAGAATAGG - Intronic
912630813 1:111245259-111245281 GCAACACTCAGAACCAGAAGAGG + Intergenic
918074839 1:181162067-181162089 ACAACCCCCAGGACTGGAAGAGG - Intergenic
919462102 1:197890137-197890159 GCAGCCCCCAGAACCAGAACAGG - Intergenic
919825438 1:201500191-201500213 CCAACCCCCTGAACCAGCAGGGG + Intronic
921787338 1:219246237-219246259 GCAAGCCCCAGATCAATAAGAGG + Intergenic
923144799 1:231190514-231190536 TGACCCCCCAGAAACAGAAGGGG - Intronic
1064292941 10:14052138-14052160 GCAACCACCAGAACTAGGAGAGG + Intronic
1066420152 10:35257833-35257855 TCTAATCCCAGAAGAAGAAGGGG - Intronic
1067350460 10:45471253-45471275 TAAATCCCCAGAACAATGAGGGG + Intronic
1069776039 10:70927742-70927764 CCAGCACCCAGAACAGGAAGTGG - Intergenic
1071025184 10:81104487-81104509 GCAGCCCTCAGAACCAGAAGAGG + Intergenic
1071735635 10:88296331-88296353 TCAACCTACAGAGCAGGAAGAGG - Intronic
1071910841 10:90231148-90231170 TAAACCCCCAAAACGAGCAGAGG + Intergenic
1073714622 10:106089914-106089936 GCAGCCCTCAGAACCAGAAGAGG + Intergenic
1075835552 10:125449805-125449827 TCATCACCCAGCACGAGAAGGGG + Intergenic
1075858975 10:125657373-125657395 TCAGCCCCCAGAACCAGAGTAGG + Intronic
1076319703 10:129568864-129568886 TCAACCTACAGAATAAGGAGAGG - Intronic
1077905641 11:6530732-6530754 TGAACCCCCTGTACAAGAGGAGG - Intronic
1078343165 11:10516423-10516445 TCTAGCCCCTGATCAAGAAGCGG + Intronic
1078908110 11:15706226-15706248 CCAGCCCCCAGAACCAGAATAGG - Intergenic
1080184593 11:29466091-29466113 TCAACTCACCAAACAAGAAGGGG + Intergenic
1083207791 11:61163159-61163181 TCAGCCCCCAGAACCAGAATAGG - Intergenic
1084367677 11:68713321-68713343 TCAAGCCCCAGCACAACAAAGGG - Exonic
1084950430 11:72662328-72662350 TCAACTCCCAGCACCATAAGGGG + Intronic
1087200772 11:95342201-95342223 TCTAACTCCAGAGCAAGAAGAGG - Intergenic
1087216467 11:95500555-95500577 GCAACACTCAGAACCAGAAGAGG + Intergenic
1087291523 11:96325904-96325926 TCTACCCACAGAGCTAGAAGAGG - Intronic
1088425323 11:109696003-109696025 TCAGACCCCAGACCAAGAACAGG + Intergenic
1089662472 11:119994385-119994407 TTAACCCCCAGAATCAGAATGGG + Intergenic
1090846741 11:130535893-130535915 GCAGCCCCCAGAACCAGAACAGG - Intergenic
1091435043 12:465757-465779 TCAACTCCCAGGACAGGGAGTGG - Intronic
1091435060 12:465818-465840 TCAACTCCCAGGACAGGGAGTGG - Intronic
1091435079 12:465879-465901 TCAACCCCCAGGACAGGGAGTGG - Intronic
1091435113 12:466003-466025 TCAACTCCCAGGACAGGGAGTGG - Intronic
1091435130 12:466064-466086 TCAACTCCCAGGACAGGGAGTGG - Intronic
1091746547 12:2996358-2996380 GCAACCATCAGAGCAAGAAGTGG - Intronic
1093007096 12:14062646-14062668 TCCACCCACAGAACCATAAGGGG + Intergenic
1094350863 12:29523250-29523272 GCAACCCCCTGAACCAGAACAGG + Intronic
1096993903 12:55827307-55827329 TCAACCCCCAGTACATGGAAAGG + Exonic
1098353770 12:69590308-69590330 TCATCCCCCAGTATACGAAGGGG - Intronic
1098663649 12:73131881-73131903 TCCAGCCCAAGGACAAGAAGAGG - Intergenic
1098745666 12:74234360-74234382 GCAAAACCCAGAACAAGAAAAGG + Intergenic
1100952001 12:99861190-99861212 GCAGCCCTCAGAACCAGAAGAGG - Intronic
1101328346 12:103736579-103736601 TCAACACACAGAACAAGCAGAGG - Intronic
1101412089 12:104478067-104478089 GCAACCCCCCTAACAGGAAGTGG + Intronic
1101578576 12:106020792-106020814 ACAACACTCAGAACCAGAAGAGG + Intergenic
1101840739 12:108325833-108325855 TCCACTCCCTGAACAAGGAGGGG + Intronic
1103643369 12:122370987-122371009 TCAACCCCCAGGGTTAGAAGAGG - Intronic
1105811110 13:23996427-23996449 TCAGTCTCCAGAACCAGAAGAGG + Intronic
1107780693 13:43898994-43899016 TCAATCACCAGAACAGCAAGGGG + Intergenic
1111255347 13:85660694-85660716 ACAACAGCCAGAACCAGAAGAGG + Intergenic
1111997718 13:95181301-95181323 TGAGGCCCCAGCACAAGAAGAGG + Intronic
1113097887 13:106685450-106685472 TCAACTCCGACAATAAGAAGTGG + Intergenic
1113402252 13:110004958-110004980 TCAACCACCAGATCAAGACTTGG + Intergenic
1113560712 13:111278408-111278430 GCAACCCAGAGAACACGAAGTGG - Intronic
1115338950 14:32272178-32272200 TCAGCCCCCAGATGAAGATGGGG - Intergenic
1115365633 14:32553786-32553808 TCAACCCTCAGAAAAAGATTGGG - Intronic
1116049261 14:39782990-39783012 TCAATCCACAGAAAAATAAGTGG - Intergenic
1117613540 14:57508601-57508623 GCAGCCACCAGATCAAGAAGTGG - Intergenic
1118889993 14:69900952-69900974 TCCAACCCAAAAACAAGAAGAGG - Intronic
1119751253 14:77079127-77079149 TCCACTCCCAGATCCAGAAGTGG - Intergenic
1119774556 14:77240305-77240327 CCCACCTCTAGAACAAGAAGAGG - Intronic
1123910114 15:24957281-24957303 TCAACTCCCAGAAGATGAAGAGG - Intronic
1124668375 15:31614353-31614375 TCAAGCCACAGATCCAGAAGTGG + Intronic
1124827855 15:33116501-33116523 TCAGCCCCCAGAACAAGAATAGG - Intronic
1126663215 15:51052326-51052348 TCCAGCCCCAGAAAAAGGAGAGG - Intergenic
1127393403 15:58524741-58524763 GCAACCCACAGAACAAAAAATGG - Intronic
1128034120 15:64508210-64508232 CCAACCCCCAAAACAAGGATGGG - Intronic
1128067441 15:64774124-64774146 CCAACCCCCAGCACAAGGGGAGG + Intronic
1131249868 15:90823211-90823233 TCAAGTCCCAGAACAGGATGGGG + Intergenic
1132316729 15:100895684-100895706 TCCCCCCCCAGAAGGAGAAGTGG + Intronic
1132354232 15:101159378-101159400 TCCACCCCCAGCCCAGGAAGGGG - Intergenic
1132516859 16:370042-370064 TCAACCCCAAGAACGGGCAGCGG - Exonic
1132935213 16:2476500-2476522 TCAACCCTCAGAATAAAAGGCGG - Intronic
1132995182 16:2819042-2819064 TGCACCCCCAGACCAAGCAGGGG - Intronic
1137351618 16:47718474-47718496 TGAACCCCATGAACCAGAAGTGG + Intergenic
1137383690 16:48022184-48022206 CCAACCCCAAGATCAAGAACCGG + Intergenic
1138353440 16:56359103-56359125 GCAGCCCCCAGAGCCAGAAGAGG - Intergenic
1138448063 16:57077220-57077242 CCCACTCCCAGAAAAAGAAGGGG - Intronic
1139118140 16:63982171-63982193 GCAGCCCCCAGAACCAGAATAGG + Intergenic
1139600847 16:67986013-67986035 GCAGCCCCCAGAACTGGAAGAGG + Intergenic
1141660195 16:85437272-85437294 TCAACCCCCAAAAGAAGTGGGGG + Intergenic
1146263285 17:31435503-31435525 GCAACACCCAGAACTAGAAGAGG + Intronic
1146293715 17:31631716-31631738 GCAGCCCTCAGAACCAGAAGGGG + Intergenic
1147150213 17:38510011-38510033 TCAACCGCAAGCGCAAGAAGCGG + Exonic
1149519275 17:57306108-57306130 CCAACCCCCAGAGCAAGCAAAGG - Intronic
1149642977 17:58216782-58216804 ATAAACCACAGAACAAGAAGTGG - Intronic
1149927745 17:60718280-60718302 GCAACCCTCAGAACCAGAAGGGG + Intronic
1151114767 17:71723458-71723480 ACAACACCCAGATCAAGAAATGG - Intergenic
1151726710 17:75889374-75889396 CCACCTCCCAGAACAAGAAGTGG + Exonic
1152941503 17:83175114-83175136 TCAGCCTCCAGAGCAAGGAGGGG - Intergenic
1153745685 18:8177379-8177401 GCAGCCCTCAGAACCAGAAGAGG + Intronic
1157470350 18:47983560-47983582 TCTTCTCCCAGAACAAGGAGGGG - Intergenic
1159488814 18:69102631-69102653 TCAAACCCCAGAACAAGATTTGG + Intergenic
1162017432 19:7853162-7853184 ACAACCCCAAGAAGATGAAGAGG + Exonic
1162189481 19:8933507-8933529 TGAACCCCCACAATAAGAAGGGG - Intronic
1163693723 19:18751661-18751683 GCCAGCCCCAGAGCAAGAAGAGG - Intronic
927520616 2:23696032-23696054 GGAACCCGCAGAACAACAAGTGG + Exonic
928907764 2:36385561-36385583 TTAACCACCAGGACAAGCAGAGG - Intronic
929506030 2:42528807-42528829 TCAACCCCCAGAACAAGAAGAGG + Intronic
930169750 2:48239071-48239093 CCAAGGCCCAGAACAAGAAGTGG - Intergenic
930739712 2:54818557-54818579 GCAGCCCTCAGAACCAGAAGAGG - Intronic
931411929 2:62041056-62041078 TCTACCCCCAGAACATTACGAGG + Intronic
931432591 2:62220135-62220157 TCAGCCCCCTGAACAAGGAAGGG + Intronic
932637853 2:73408275-73408297 TCAACTCATAGCACAAGAAGTGG - Intronic
932705401 2:74020688-74020710 TCAAGCCCTTGAACAAGAGGTGG - Intronic
933599120 2:84312032-84312054 GCAGCCCCCAGAACCAGAACAGG - Intergenic
935823632 2:106919130-106919152 TCAAATAGCAGAACAAGAAGTGG + Intergenic
937343543 2:121107976-121107998 TCCACCACCAAAACAAGCAGTGG + Intergenic
943417478 2:187626767-187626789 TAAACACACAGAACAAGAAATGG + Intergenic
943612498 2:190050102-190050124 GCAGCCCTCAGAACCAGAAGAGG + Intronic
943947543 2:194087411-194087433 GCAGCCCCCAGAACCAGAATAGG - Intergenic
946002221 2:216492088-216492110 ACAGCCCCCACAACCAGAAGAGG - Intergenic
947470416 2:230396385-230396407 GCAGCACTCAGAACAAGAAGAGG + Intronic
948947788 2:241229898-241229920 GAAACCCCCAGCACACGAAGAGG - Exonic
1171086851 20:22245482-22245504 CCAACCTCCAGGACAAGCAGTGG + Intergenic
1171396484 20:24837166-24837188 TCAAGCCCCAGGGCAAGGAGAGG + Intergenic
1171438287 20:25140885-25140907 TTTACACCCAGATCAAGAAGAGG + Intergenic
1174300961 20:49581906-49581928 TCTACCTCCAGATCTAGAAGTGG - Intergenic
1174707265 20:52669542-52669564 TCAACTGGCAGAAAAAGAAGTGG + Intergenic
1175169968 20:57073277-57073299 TCCACACTCAGAACAAGACGTGG - Intergenic
1175458226 20:59131158-59131180 TCCAACTCCAGACCAAGAAGTGG - Intergenic
1178749259 21:35284816-35284838 CCACCACCCAGATCAAGAAGTGG + Intronic
1184746930 22:46461647-46461669 TCACCCCCCAGAACAGGCTGGGG + Intronic
1185306957 22:50124475-50124497 TGAACCCCAAGCACAAGAACAGG - Intronic
953645884 3:44754335-44754357 TCAGCCCCCAGATGAAGATGGGG - Exonic
954031020 3:47819989-47820011 TAAACCACCACATCAAGAAGAGG - Intronic
954044385 3:47916884-47916906 ACTACCCACAGAAAAAGAAGTGG - Exonic
954678346 3:52327695-52327717 TCAACCCCCAGTCCTAGCAGTGG + Intronic
956689056 3:71859266-71859288 ACAACCCACAGAACAGTAAGTGG + Intergenic
960342690 3:116494253-116494275 CCAACATCAAGAACAAGAAGGGG + Intronic
960631151 3:119732003-119732025 TCAAGCTCCAGGCCAAGAAGAGG - Intronic
961229164 3:125286231-125286253 TAAAGCCCCAAAAAAAGAAGTGG + Intronic
964784362 3:160378508-160378530 TCAACCACCAGAAAAAGAACAGG + Intronic
964980448 3:162670825-162670847 TTCAGCCCCTGAACAAGAAGGGG + Intergenic
966493039 3:180550493-180550515 TCAACCCCAAGAAGAAACAGGGG + Intergenic
966574778 3:181488045-181488067 TCAACCCACAGAACCTGAGGTGG - Intergenic
968952209 4:3701085-3701107 TCATCCCTCAGAAGAAGAAGGGG - Intergenic
969282578 4:6181039-6181061 ACACCACCAAGAACAAGAAGGGG + Intronic
969460674 4:7327186-7327208 TCTGCCTCCAGAACAGGAAGAGG - Intronic
970560344 4:17276007-17276029 GCAACCCACAGAAGCAGAAGAGG - Intergenic
972581545 4:40399763-40399785 CAATCCCCCAGGACAAGAAGAGG - Intergenic
973052739 4:45614118-45614140 ACAACCCTCGGAACCAGAAGAGG + Intergenic
973880643 4:55268387-55268409 TCAACCCACAGAACCACGAGAGG - Intergenic
975892408 4:79045427-79045449 TCAACCACTGGAACAAGCAGGGG - Intergenic
980463196 4:133145353-133145375 TCAATCCCAAGAACAAGGATTGG + Intergenic
980563818 4:134511294-134511316 CCAGCCCCCAGAACAAGCATGGG - Intergenic
980997207 4:139790941-139790963 AAAACTCCCAGAACAAAAAGAGG - Intronic
981739169 4:147984730-147984752 TCAACGTCCAGGCCAAGAAGTGG + Intronic
982397555 4:154928466-154928488 TCAAATCCCAGAACAATAAAGGG - Intergenic
984242760 4:177237168-177237190 CCAACCCCTAGAACCAGACGAGG + Intergenic
984538678 4:181009593-181009615 TCAAGCCACAGAAAAAGAATAGG - Intergenic
985090726 4:186360209-186360231 GAAACACCCAGGACAAGAAGGGG - Intergenic
985713747 5:1444816-1444838 ACCGCGCCCAGAACAAGAAGCGG + Intronic
986196186 5:5538015-5538037 TGACCCCCCAAAACAAGAGGAGG - Intergenic
986590315 5:9362082-9362104 TCACCCCCCAAGACGAGAAGAGG - Intronic
987048499 5:14129490-14129512 TCAAACCCAGGAATAAGAAGAGG - Intergenic
988546122 5:32159151-32159173 TCAGCCCCCTGAAACAGAAGAGG + Intronic
991080834 5:62597388-62597410 GCAGCCCCCAGAACCAGAATTGG + Intronic
992876183 5:81058207-81058229 TCAACTCCCACAACAAAAAAAGG - Intronic
994115450 5:96056981-96057003 GCAGCCCCCAGAACCAGAACAGG + Intergenic
994795788 5:104298087-104298109 TTGACACCCAGAACAAGAAATGG - Intergenic
995048711 5:107677169-107677191 GCAAACCCCAGAAAAGGAAGGGG - Intergenic
995556074 5:113330242-113330264 TCAGCTCTCAGAACCAGAAGCGG - Intronic
997358870 5:133281744-133281766 CCAGCCCCCAGGACATGAAGAGG + Intronic
998641261 5:144013997-144014019 GCAGCCCCCAGAACCAGAATAGG + Intergenic
998757168 5:145393461-145393483 GCAGCCTCCAGAACAAGAATAGG + Intergenic
1001128101 5:169038990-169039012 TCAATCCCCAGCAGAAGAAGGGG - Intronic
1001667245 5:173443488-173443510 TCCACCCCCAGATCTAGAAGTGG + Intergenic
1001854891 5:175002622-175002644 TCAACTCCCAATACAAGAAGAGG + Intergenic
1002484971 5:179528995-179529017 TCATCTCCAATAACAAGAAGAGG + Intergenic
1003440358 6:6135149-6135171 ACAACACCCAGATCAAGAAATGG + Intergenic
1003715341 6:8640039-8640061 TCAAGCCCCAGACCAAGGGGTGG - Intergenic
1004383372 6:15151307-15151329 TCAACCCCTAGCAGTAGAAGTGG + Intergenic
1006941991 6:37758411-37758433 TCATCACCCAGATCAAGAAATGG - Intergenic
1007359288 6:41343564-41343586 GCAGCCCTCAGAACCAGAAGAGG + Intronic
1010261731 6:73824631-73824653 TCACACCCCTGAACTAGAAGAGG - Exonic
1011754883 6:90488254-90488276 GTAACCCTCAGAACAAGAAAAGG - Intergenic
1012162926 6:95909833-95909855 TCAAAACCCAGAACAAAAAATGG - Intergenic
1013285243 6:108675587-108675609 TCAACCCCTAGAGCAAGCTGGGG - Intronic
1022224849 7:28352650-28352672 TCAATCCCCAGAGGAAGCAGAGG + Intronic
1022328180 7:29352233-29352255 ACAACCTCCAGACCAAGAAGTGG - Intronic
1022893742 7:34728226-34728248 TCAACCCCCAAACCAAGAGCTGG + Intronic
1024051994 7:45630099-45630121 TCAACCCAAATAAAAAGAAGTGG - Intronic
1028511851 7:91634037-91634059 TCAACCCACAGGGCAAGAACAGG + Intergenic
1030125838 7:106151760-106151782 TCAACCCCCACCACTATAAGTGG - Intergenic
1032202733 7:129834208-129834230 TCTACCCCAAGAAAAAGAACTGG + Exonic
1032284698 7:130531471-130531493 TCAACACCCAGAAGAACAGGTGG + Intronic
1032453253 7:132052697-132052719 TCAGAGCCCAGAACAAGGAGGGG + Intergenic
1036750963 8:11443589-11443611 CCAGCGCCCAGCACAAGAAGAGG + Intronic
1041132017 8:54711097-54711119 TCAATCCCCAGAATAAGGTGAGG + Intergenic
1042946916 8:74164403-74164425 GCAACACCCAGAACCAGAATAGG - Intergenic
1043540410 8:81255936-81255958 TCTACCCCAAGAAAAAGAACCGG - Intergenic
1043954898 8:86348735-86348757 TCAAACCCCAGAAAAAGGAGAGG - Intronic
1044636563 8:94331025-94331047 GCAGCCCCCAGAACTAGAACAGG - Intergenic
1049156064 8:141067581-141067603 TCAGCCCCTAGATCCAGAAGTGG + Intergenic
1050031531 9:1391392-1391414 CCTACCCCCAGAACAAGAGCAGG - Intergenic
1050157028 9:2678738-2678760 TCAACCCCCAGCAAAACAAACGG + Intergenic
1052363598 9:27586955-27586977 GCAACCCCCAGAAACAGAAGAGG - Intergenic
1056013124 9:82353675-82353697 TTAACCTCTAGAACAAGAAGAGG - Intergenic
1056642287 9:88381937-88381959 GCAACCCTCAGAACAAGAAGGGG - Intergenic
1058111787 9:101038665-101038687 TCAACCCCCACATCAAGAAGAGG + Intronic
1058790334 9:108438323-108438345 TCAACCTCTGGGACAAGAAGAGG - Intergenic
1060268805 9:122127277-122127299 TCACCCCGCAGAACTAGAGGGGG + Intergenic
1060443437 9:123663897-123663919 TCAACCCCCAGTGTAAGCAGTGG + Intronic
1187740928 X:22354717-22354739 CCAACCCACAGAAACAGAAGAGG - Intergenic
1189344428 X:40229919-40229941 GCATCCCCAAGAACAAGAACAGG - Intergenic
1189419172 X:40841210-40841232 TCAGCCCCCAGAACCAGAATAGG + Intergenic
1193843925 X:86445049-86445071 TAAACCCCCGCAAAAAGAAGAGG - Intronic
1196153437 X:112400956-112400978 CCAAGCCCCAGTACAAGGAGTGG - Intergenic
1198458369 X:136839371-136839393 TCTCCCCCCAGAAATAGAAGAGG - Intergenic