ID: 929508772

View in Genome Browser
Species Human (GRCh38)
Location 2:42550496-42550518
Sequence ATGGAGCAGCAGAAGGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 905
Summary {0: 1, 1: 0, 2: 6, 3: 91, 4: 807}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929508772 Original CRISPR ATGGAGCAGCAGAAGGAAGG AGG Intronic
900932829 1:5747619-5747641 AGGGAGGAGCAGAGGGAGGGAGG + Intergenic
900993075 1:6106832-6106854 ATGGAGGAGTGGAAGGATGGAGG + Intronic
900993093 1:6106880-6106902 GTGGAGCAGTGGAAGGATGGAGG + Intronic
901182628 1:7352125-7352147 AAGGAGGAGGAGAAGGAAGCAGG + Intronic
901228367 1:7628163-7628185 ATGGAGAAGGAGAAGGGAGCTGG - Intronic
901755991 1:11441895-11441917 AGGGAGGAGGAGAGGGAAGGAGG + Intergenic
902091935 1:13910536-13910558 ATGGTGAAGCAGGAGCAAGGTGG - Intergenic
902713351 1:18255697-18255719 ATGGGGAAACAGTAGGAAGGGGG - Intronic
903012601 1:20342318-20342340 GTGGGGGAGCAGAAGGAAGGAGG + Intronic
903049600 1:20590816-20590838 TTGGAGAAGCAGAAGGAAGAGGG + Intronic
903138728 1:21326119-21326141 GTGGGGCGGCAGAAGGATGGGGG - Intronic
903192336 1:21663728-21663750 TGGGGGCAGCAGAGGGAAGGTGG - Intronic
903651768 1:24926939-24926961 CTTGAGCAGCAGAAGGAAGGCGG - Intronic
903763423 1:25715712-25715734 ATAGAGCAGAAGAACGATGGTGG + Intronic
903790035 1:25886535-25886557 AGGGAGCAGCACATGGAGGGTGG - Intronic
903939613 1:26920591-26920613 AGGTAGCAGCAGAAGAAAGTGGG + Intronic
904137087 1:28321528-28321550 ATGGAGAAGCAGAAGGGCAGAGG - Intergenic
904591155 1:31616308-31616330 CTGGAGCAGCATAAGGGAGGGGG - Intergenic
904815179 1:33190820-33190842 ATGTCGCAGCATCAGGAAGGAGG + Intergenic
904855069 1:33491567-33491589 ATGGATGAGCAGGAGGAAGGGGG + Exonic
904964235 1:34359308-34359330 ATGGAACATTAGAAGGAAAGGGG - Intergenic
905244909 1:36606052-36606074 ACAGAGAAGCAGATGGAAGGAGG + Intergenic
905654053 1:39674699-39674721 AGAGAGAAGCAGAAGGAGGGAGG + Intergenic
906180840 1:43817557-43817579 AAGGAGAAGAAGAAGGAAGAAGG - Intronic
906180852 1:43817619-43817641 AAGGAGGAGGAGAAGGGAGGAGG - Intronic
906512078 1:46415752-46415774 ATGGGGCAGGAGGAGGAAGCTGG - Intergenic
906708081 1:47909540-47909562 AAGGAGGAGAAGAAGGAAGAAGG + Intronic
906794772 1:48688142-48688164 AGGGAGGAAGAGAAGGAAGGAGG + Intronic
907230084 1:52989452-52989474 GTGGAGCTGCAGAAAGAGGGAGG - Intronic
907321692 1:53606643-53606665 AAAGAGGAGCAGCAGGAAGGTGG + Intronic
907438533 1:54464453-54464475 ATGGAGCCCTAGAATGAAGGGGG + Intergenic
907500388 1:54875366-54875388 AGAGAGCAGGAGAGGGAAGGAGG + Intronic
908043410 1:60141488-60141510 ATGGAAAAGCAGAAGGAAGCTGG + Intergenic
908206538 1:61856082-61856104 ATGGTGTAGCAGAAAGAAGTGGG + Exonic
908320395 1:62972804-62972826 AAGGAGGAGGAGAGGGAAGGAGG + Intergenic
909645963 1:77917736-77917758 ATGGAACAGGAGAAAGCAGGAGG + Exonic
909660005 1:78071531-78071553 AAGAAGAAGGAGAAGGAAGGAGG - Intronic
910035430 1:82782506-82782528 AGGGAGCTGCAGAAGGGAGGAGG - Intergenic
910332989 1:86097493-86097515 AGGGAGGAGGAGAAGGGAGGAGG - Intronic
910835808 1:91508847-91508869 ATGGAGCAGGTGGAAGAAGGAGG - Intronic
910941770 1:92543339-92543361 AGGAAGCTGCAGAAGGAAAGTGG - Intronic
911090633 1:94014340-94014362 AGGGAGGAGAAGAAGGAAAGAGG + Intronic
911182664 1:94875154-94875176 AGGGAGCAGCAGAGTGTAGGCGG - Intronic
911619277 1:100048543-100048565 ATGGAGCAGTTTCAGGAAGGAGG - Intronic
912318960 1:108692571-108692593 ATGTTGCGGCGGAAGGAAGGAGG - Exonic
912411957 1:109485811-109485833 ATGCAGCAGGTGAAGGAAGATGG + Intronic
912469688 1:109898027-109898049 AGGGAGCAGCAAAAGCAAAGTGG - Intergenic
912487850 1:110043232-110043254 ATTGAGCAGCAGCAGAAACGGGG + Exonic
912565773 1:110586174-110586196 CAGGAGCAGAAGAAGCAAGGGGG - Intergenic
912619842 1:111144126-111144148 ATGGAGCCGCATAGGGTAGGTGG - Intronic
912703431 1:111895142-111895164 AGGGAGAAGGAGAAGGAAGGAGG + Intronic
913115557 1:115693089-115693111 ATGCTGGAGAAGAAGGAAGGGGG + Exonic
914912574 1:151799651-151799673 AGGAAGCTGCAGAAGGATGGTGG + Intergenic
915047181 1:153028002-153028024 AAGGAGAAGGAGAAGGAGGGAGG - Intergenic
915200216 1:154221301-154221323 TTGGAGCAGCCGTAGGAAGGGGG + Intronic
915468455 1:156112091-156112113 AAGGTGCAGGAGAAAGAAGGAGG - Intronic
915611417 1:156996422-156996444 AGGAAGCAGCAGAAGGCAGAGGG + Intronic
915733148 1:158068083-158068105 AAGGACCAGCAGTGGGAAGGCGG + Intronic
916282389 1:163066148-163066170 ATGGAGCCTCAGAAGGATGAGGG - Intergenic
916635425 1:166662749-166662771 ATGGAGTAGAAGATGGAAGAAGG - Intergenic
918091315 1:181297479-181297501 CTGAAGCATCAGAAGGGAGGGGG + Intergenic
919449353 1:197751939-197751961 AAGGAGGAGGAGGAGGAAGGGGG + Intronic
919491039 1:198205040-198205062 AAGTAGGAGAAGAAGGAAGGGGG - Intronic
919811145 1:201409527-201409549 ATGGTGCAACAGAAGCATGGAGG - Intronic
920188270 1:204175979-204176001 GAGGAGGAGGAGAAGGAAGGAGG - Intergenic
921396865 1:214677822-214677844 AAGGAGGAGGAGGAGGAAGGAGG - Intergenic
922069880 1:222181522-222181544 ATGAATTAGCAGCAGGAAGGGGG + Intergenic
922153200 1:223022357-223022379 CCTGGGCAGCAGAAGGAAGGTGG + Intergenic
922342415 1:224668658-224668680 CTGGACCAGAAGAAGGAGGGAGG + Intronic
922615503 1:226958858-226958880 ATGGAGCAGCAGGAAGAAGTAGG + Intronic
922681705 1:227603631-227603653 ATGAAGCAGCAGAAGGGGGCTGG - Intronic
922707962 1:227800351-227800373 AAGGAGAAGGAGAAGGAGGGGGG - Intergenic
922722596 1:227906380-227906402 ATGGAGTAGGAGGAGGGAGGAGG - Intergenic
922722648 1:227906528-227906550 ATGGAGCAGGAGGAGGGAGGAGG - Intergenic
923371548 1:233319047-233319069 GTGGAGCAGCTGAAAGATGGTGG - Intergenic
923475303 1:234326089-234326111 AAGGAGCAGGAGGAGGATGGAGG + Intergenic
923743393 1:236677044-236677066 CTGGAGCTCCAGAAGAAAGGTGG + Intergenic
924202384 1:241673484-241673506 ATGGAGCAGGATAAGGCAGAGGG - Intronic
924247751 1:242101402-242101424 ATGGGGCAGCTGAAAGAAGGGGG + Intronic
1062889559 10:1048331-1048353 ATGGAGCAGGAGAAGAGATGGGG - Intronic
1063016108 10:2079361-2079383 ATGAAGACACAGAAGGAAGGGGG - Intergenic
1063057056 10:2517066-2517088 AAGAAGCAGGATAAGGAAGGAGG - Intergenic
1063221724 10:3975186-3975208 AGAGACCAGAAGAAGGAAGGAGG + Intergenic
1063246087 10:4220278-4220300 CTGGGGCAGAAAAAGGAAGGGGG - Intergenic
1063267284 10:4467451-4467473 ATGGAAGAGGAGAAGGAGGGTGG - Intergenic
1063460504 10:6212395-6212417 ATGTAGCAGCGGAAGCCAGGAGG + Intronic
1063539576 10:6918686-6918708 AGGGAGGAGTAGAAGGATGGAGG + Intergenic
1063633776 10:7761072-7761094 ATGCAGGAGCAGAAGGTAGGAGG + Intronic
1064496124 10:15912103-15912125 AAGGAGGAGGAGGAGGAAGGGGG + Intergenic
1064636260 10:17370984-17371006 ATCCAGCAGCAGGATGAAGGTGG + Intronic
1064686512 10:17867312-17867334 AAGAAGAAGAAGAAGGAAGGAGG - Intronic
1064850841 10:19707058-19707080 AGGGAGAAGTAGAAGAAAGGAGG - Intronic
1065050535 10:21787340-21787362 AAGGAGGAGGAGGAGGAAGGAGG + Intronic
1065251641 10:23821534-23821556 CTTGAGAAGCAGAAGGAAGCAGG + Intronic
1065825729 10:29568873-29568895 AGGGAGCAGAGGAAGGAAGGAGG + Intronic
1065992397 10:31025180-31025202 AAGGAGGAACAGAAGGAAGGAGG + Intronic
1067248987 10:44571474-44571496 TTGGGGAAGCAGAAGCAAGGGGG + Intergenic
1068680135 10:59810474-59810496 ATGGAGCAGTATAAAGGAGGAGG + Intronic
1069217685 10:65842511-65842533 ATGGAGCAGGAGAAAGGAGGGGG + Intergenic
1069878952 10:71579891-71579913 ACAGAGCGGCAGCAGGAAGGGGG + Intronic
1069893215 10:71664835-71664857 AGGGAGGAGGAGAAGGAAGAGGG - Intronic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070332589 10:75429080-75429102 AAGGAACAGAAGGAGGAAGGGGG - Intergenic
1070549096 10:77476462-77476484 ACCGAGCAGCAGAGGGAAGAGGG - Intronic
1070694033 10:78548577-78548599 AGGGAACAAAAGAAGGAAGGAGG + Intergenic
1070827386 10:79399158-79399180 ATGGAGGAGAAGAAGGACTGTGG + Intronic
1071025570 10:81108759-81108781 ATGATGCAGCAGAAAGGAGGTGG - Intergenic
1071427963 10:85578578-85578600 AAGGAGAAGCAGAGGGAAGTGGG + Intergenic
1071444820 10:85735992-85736014 AGGGAGCAAGGGAAGGAAGGAGG + Intronic
1071712983 10:88067865-88067887 CTGGAGCACCATCAGGAAGGGGG + Intergenic
1073605819 10:104894770-104894792 ATGGAAAAGGAGAAGGAGGGAGG + Intronic
1073829427 10:107364529-107364551 CTGGAGTAGCAGAGGCAAGGTGG + Intergenic
1073857016 10:107688252-107688274 ATAGACCAGGAAAAGGAAGGAGG + Intergenic
1073986674 10:109217502-109217524 ATGGGGTAGTGGAAGGAAGGGGG - Intergenic
1074290899 10:112137410-112137432 TTGGAGCAGCAGAGGGGAGCAGG + Intergenic
1074298087 10:112209587-112209609 ATGAAGCAGCAGCAGGCAGGAGG - Intronic
1074724081 10:116289688-116289710 AGGGAGAAAAAGAAGGAAGGAGG - Intergenic
1074804070 10:117029678-117029700 CTGGAGCAGGAGCAAGAAGGTGG - Intronic
1074860910 10:117509800-117509822 ATGGAGCACCAGAAAGCTGGCGG - Intergenic
1075049901 10:119175734-119175756 AAAGAGGAGCAGGAGGAAGGGGG + Intronic
1075465393 10:122646980-122647002 ATGCAGAAGCAGCAGGAAGCTGG + Intergenic
1075809645 10:125215633-125215655 CTGGAGGAGCAGAGGGAAGAAGG + Intergenic
1075974734 10:126685592-126685614 AGGGAGCAAGAGAAGGAGGGAGG - Intergenic
1075980742 10:126737030-126737052 AAGGAGCAGCAGAGAGAAGGAGG - Intergenic
1076001500 10:126916702-126916724 AAGGAGGGGTAGAAGGAAGGAGG - Intronic
1076013102 10:127006323-127006345 AGAGGGCAGGAGAAGGAAGGAGG - Intronic
1076271739 10:129158517-129158539 ATGGAGAAGGAGAAGAGAGGTGG + Intergenic
1076352262 10:129825369-129825391 CTGCAGCAGCAGAGGGAGGGAGG + Intergenic
1076737621 10:132465810-132465832 AGGGGGCGGCAGAAGGGAGGCGG + Intergenic
1076890122 10:133279235-133279257 TTGGAGCAGCAGCAGGAGGAGGG + Exonic
1076897906 10:133323139-133323161 AGGAAGCAGGAGAAGGATGGAGG - Intronic
1077042908 11:532466-532488 AAGGAGGTGCAGACGGAAGGAGG - Exonic
1077210625 11:1369550-1369572 ATGGAGGACCAGAAGGAGGCAGG + Intergenic
1077469241 11:2749098-2749120 ATGGGGCCGCAGGAGGAAGGAGG + Intronic
1077510223 11:2955976-2955998 ATGGAGGAGGAGAAGGGAGGGGG - Intronic
1077782591 11:5347791-5347813 AGGGAGCAGAAGAGGGAGGGAGG + Intronic
1077887402 11:6395844-6395866 ATGTGGCAGCAGAAGGAGGCTGG + Exonic
1077922256 11:6650397-6650419 ATACAGGAGCTGAAGGAAGGGGG + Intronic
1078298487 11:10100673-10100695 ACTGATCAGGAGAAGGAAGGAGG - Intronic
1079445577 11:20553719-20553741 AAGGAGGAGGAGGAGGAAGGAGG - Intergenic
1080298317 11:30755271-30755293 AGGGAGCAGCAGAGACAAGGAGG + Intergenic
1080866166 11:36197210-36197232 ATGAGGCAGCAGAATGAAAGAGG - Intronic
1081093284 11:38899863-38899885 GTGGAGGAGGAGGAGGAAGGGGG + Intergenic
1081095262 11:38924939-38924961 AGGGAGCAAGAGAAGGAAGAAGG - Intergenic
1081814478 11:45930818-45930840 AAAGAGCAGCGGAGGGAAGGAGG + Intronic
1083148793 11:60777103-60777125 ATGAAGAAACAGAAGGAAGGAGG - Intergenic
1083153085 11:60805778-60805800 ATGGAGACGGAGAAGGAAGAGGG - Intergenic
1083570938 11:63762171-63762193 AGGGAGGACCTGAAGGAAGGAGG - Exonic
1083859389 11:65411867-65411889 ATGGAGCACCAGCAGGAGGAAGG - Exonic
1084710615 11:70841655-70841677 AGGGAGAAGCAGACGGAAAGGGG - Intronic
1084717292 11:70882162-70882184 ATGGAGGAGGAGGAGGAGGGAGG + Intronic
1084941491 11:72615601-72615623 ATGAAGCAGCTGAAGGTGGGAGG - Intronic
1084945108 11:72634161-72634183 AAGGGGCAGCAGGAGGAAGCGGG + Intronic
1085327047 11:75614230-75614252 CTGGAGCAGCCGCAGGGAGGTGG - Intronic
1085807655 11:79651032-79651054 AGGAAGAAGAAGAAGGAAGGAGG - Intergenic
1085925827 11:81019336-81019358 AGGGAGAGGAAGAAGGAAGGAGG - Intergenic
1086056115 11:82649062-82649084 AAGGAGCAGAAGAAAGGAGGAGG - Intergenic
1086056116 11:82649065-82649087 AAGAAGGAGCAGAAGAAAGGAGG - Intergenic
1086598187 11:88600257-88600279 AAGGAGCAGGAGGAAGAAGGAGG - Intronic
1088722980 11:112610971-112610993 ATGTAGCACCAGAACCAAGGAGG + Intergenic
1089114123 11:116080374-116080396 AAGGAACAGCAGAGGGAAGAGGG - Intergenic
1089118861 11:116117855-116117877 GTGGAGAAGCACAGGGAAGGAGG + Intergenic
1089175853 11:116548300-116548322 ATGGAGCAGCTGAGGGAGAGTGG - Intergenic
1090464628 11:126923293-126923315 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090464635 11:126923344-126923366 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090943449 11:131409235-131409257 TTTGAGAAGCAGAAGGAAGCAGG + Intronic
1091074196 11:132599426-132599448 AAGGTGGAGGAGAAGGAAGGAGG + Intronic
1091195434 11:133726895-133726917 AGGGACCAGCAGAAAGAAGCAGG - Intergenic
1091600063 12:1912628-1912650 ACAGAGGAGCAGAAGGAGGGTGG - Intronic
1091811180 12:3399122-3399144 ATGAAGCAACAGAAGTATGGTGG - Intronic
1091854534 12:3728745-3728767 GTGGAGCAGCAAAGGGAGGGAGG + Intronic
1091855502 12:3736139-3736161 ATGGGGAAGAAGATGGAAGGAGG + Intronic
1091998215 12:5011849-5011871 ATGGAGAAGCAGAATCAAAGAGG + Intergenic
1092009657 12:5098859-5098881 ATAGAGGAGTAGAAGGGAGGCGG + Intergenic
1092060332 12:5545642-5545664 CAGGAGAAGTAGAAGGAAGGGGG + Intronic
1092748855 12:11699663-11699685 ATGGAGCAGCTGTAGGATGGAGG + Intronic
1093508404 12:19896785-19896807 AGGAAGAAGGAGAAGGAAGGAGG - Intergenic
1093860171 12:24155796-24155818 ATGGAGCAGTTTGAGGAAGGAGG + Intergenic
1094647791 12:32343641-32343663 ATGGAGGAACAGAAGGAAGGAGG - Intronic
1094827080 12:34277835-34277857 AGGGAGGAGGAGAAGGATGGAGG - Intergenic
1095259893 12:40085854-40085876 TGGGAGTAGCAGAAGGAATGCGG - Intronic
1095578536 12:43767418-43767440 ATGGAGTAGCAGAAGTAAAGGGG + Intronic
1095596149 12:43960313-43960335 AGGGAGAAGGAGAGGGAAGGGGG + Intronic
1096523758 12:52198694-52198716 ATTGAGCAGCCGGAGGAAGTAGG - Intergenic
1096782647 12:53999951-53999973 GGGGAGCAGCAGAGAGAAGGGGG + Intronic
1096964121 12:55611495-55611517 ATGGGGAAGCAGCAGGGAGGGGG + Intergenic
1097420202 12:59368338-59368360 AAAGGGCAGCAGGAGGAAGGTGG - Intergenic
1097566251 12:61272547-61272569 AGGAAGCATCAGAAGTAAGGGGG - Intergenic
1098624516 12:72646655-72646677 ATGGAAAAGCAGAAGAAAGCAGG + Intronic
1099822445 12:87730077-87730099 ATGGAGGATCTGGAGGAAGGTGG - Intergenic
1100705007 12:97191086-97191108 ATGAAGCAAGAGAAGAAAGGTGG + Intergenic
1101022248 12:100565144-100565166 CAGGAGCAACAGAAGGAAGGTGG + Intergenic
1101132873 12:101707297-101707319 ATGGAGCTGGAGTATGAAGGTGG + Intronic
1101853538 12:108423575-108423597 GTGGAGTAGCAGAAGCCAGGTGG - Intergenic
1101968715 12:109297697-109297719 ATGGACCGGGTGAAGGAAGGGGG - Intronic
1102030566 12:109737900-109737922 AGGGAGCGGCAGGAGGGAGGTGG + Intronic
1102030796 12:109739066-109739088 ATGGAGCCACAGAAGCCAGGTGG + Intronic
1102145006 12:110648462-110648484 TTGAAGCAGCAGAGGCAAGGGGG + Intronic
1102409426 12:112704429-112704451 ATGGAGAGACAGAGGGAAGGTGG + Intronic
1103221898 12:119253169-119253191 GTGCAGCAGCAGAGGGAATGAGG - Intergenic
1103333292 12:120169953-120169975 CTGGAGCAACAGAATGAAGGAGG + Intronic
1104460272 12:128950183-128950205 ATGGAGCAGCTGCAGGGAGGTGG + Intronic
1104570055 12:129917369-129917391 TTGGAGGAGGAAAAGGAAGGGGG - Intergenic
1104703002 12:130921440-130921462 AAGTGGGAGCAGAAGGAAGGGGG + Intergenic
1104835461 12:131787120-131787142 TTGGAGCAGGAGATGGAGGGAGG + Intronic
1106552518 13:30784514-30784536 ATGGAGCAGAAAAGGGAAGGGGG + Intergenic
1106841147 13:33685997-33686019 ATGGGTCAGCAGAAAGAGGGTGG + Intergenic
1107203669 13:37754254-37754276 ATGGAACCACAAAAGGAAGGAGG - Intronic
1107591216 13:41908588-41908610 AAGGAGGAGGAAAAGGAAGGAGG + Intronic
1107897119 13:44976296-44976318 AAGGAGAAGGAGAAGAAAGGAGG + Intronic
1107897122 13:44976312-44976334 AAGGAGGAGGAGAAGAAAGGAGG + Intronic
1107999430 13:45892727-45892749 AAGAAGCAACAGGAGGAAGGAGG + Intergenic
1108074639 13:46667081-46667103 AGGGTCCAGCAGAAGGAGGGAGG - Intronic
1109204320 13:59465056-59465078 ACTGAGCAACAGCAGGAAGGAGG + Intergenic
1110627412 13:77666873-77666895 GAGGAGGAGCAGAAGGAAGTTGG + Intergenic
1112333407 13:98494667-98494689 ATGAAGTAGCAAAAGGTAGGAGG - Intronic
1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG + Intronic
1113817587 13:113184967-113184989 ATGCAGCACCGGCAGGAAGGTGG + Intronic
1114148544 14:20008065-20008087 AGGGAGGAAAAGAAGGAAGGAGG + Intergenic
1115095383 14:29629943-29629965 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1115320642 14:32076749-32076771 AGGGAGAAGCAGAGGGGAGGAGG + Intronic
1117756674 14:58981617-58981639 AAGGAGCAGAAGAATCAAGGGGG - Intergenic
1117963814 14:61187589-61187611 TTGGAGCAGCAGCAGGAGGCAGG - Intronic
1118923545 14:70171337-70171359 ATGGACCAGGAGAATTAAGGAGG + Intronic
1119180158 14:72600086-72600108 AAGGAGGAGAAGAAGGGAGGGGG - Intergenic
1119424052 14:74524514-74524536 TTGGTGCAGGAGAAGCAAGGCGG - Intronic
1119530037 14:75353521-75353543 ATGGAGGAGGAGAGGAAAGGAGG - Intergenic
1119909799 14:78339151-78339173 TTGGAGAAGCTGAAGGAAAGAGG + Intronic
1120578650 14:86217756-86217778 ATGGAGGAGGAGGAGGAAGAAGG - Intergenic
1120964453 14:90155272-90155294 ATGGAGGAGGAGCAGCAAGGAGG + Intronic
1121051360 14:90820882-90820904 ATGAATGAGCTGAAGGAAGGTGG + Intergenic
1121103233 14:91264334-91264356 GTGGAGCAGGAGAAGGACTGGGG - Intergenic
1121117965 14:91356886-91356908 GGGGAGCACCAGCAGGAAGGTGG + Intronic
1121447566 14:93988331-93988353 AGGGAGGAGCAGATGGGAGGAGG + Intergenic
1121612774 14:95292938-95292960 ACGGAGCAGGAGAAAGAAGTGGG + Intronic
1121612832 14:95293213-95293235 AGGGAGGAAAAGAAGGAAGGAGG - Intronic
1121614589 14:95304759-95304781 TCGGAGCTGCAGAAGGAAGTGGG - Intronic
1121735708 14:96216678-96216700 AAGGAGGAGGAGGAGGAAGGAGG + Intronic
1121735724 14:96216733-96216755 AAGGAGGAGGAGGAGGAAGGAGG + Intronic
1121957907 14:98230858-98230880 ATGGAAGAGTGGAAGGAAGGTGG + Intergenic
1122009675 14:98735781-98735803 AAGGAACATCAGAAGGAAGGAGG + Intergenic
1122324036 14:100872036-100872058 ATGGAACAGGAGGTGGAAGGAGG - Intergenic
1122391086 14:101385119-101385141 AGGCTGCAGCACAAGGAAGGAGG - Intergenic
1124937571 15:34186862-34186884 AGGGAGGACCTGAAGGAAGGGGG + Intronic
1125298883 15:38233223-38233245 ATGAAGGGGCAGAATGAAGGGGG + Intergenic
1125573421 15:40738462-40738484 ATAGGCCAGCACAAGGAAGGAGG + Intronic
1125581218 15:40787408-40787430 ACTGAGGAGCAGAAGGAAGTAGG + Intronic
1125664623 15:41420475-41420497 ATGGAGCAGCACAAGGTATTTGG - Intronic
1125713412 15:41805155-41805177 ATGGAACAGCACAGGAAAGGAGG + Intronic
1126330491 15:47525928-47525950 GTAGGGCAGCAGAAGGAAGGGGG + Intronic
1126697132 15:51335888-51335910 ATGGAGCGTCAGGAGCAAGGAGG - Intronic
1126860697 15:52879955-52879977 AGGGACCAGCAGGAGGATGGTGG - Intergenic
1127122105 15:55780596-55780618 AGGGAGAAGAAGAAGGAAGAAGG + Intergenic
1127137742 15:55942512-55942534 AAGGAGGAGGAGAATGAAGGGGG - Intronic
1127243247 15:57142121-57142143 ATGCAGCAGCAAATGGAAGTTGG + Intronic
1127734863 15:61831008-61831030 TTTGAGCAGCACAAGGAAGCAGG + Intergenic
1128352728 15:66901875-66901897 CTTGAGCTGCAGAAGGAAGCAGG - Intergenic
1128498230 15:68210326-68210348 CTGGAGCCCCAGCAGGAAGGGGG - Intronic
1128581636 15:68814519-68814541 GTGCAGCAGCAGCAGGAAAGAGG + Intronic
1128619744 15:69138636-69138658 ATGAATTAACAGAAGGAAGGAGG + Intergenic
1128674134 15:69596297-69596319 GTGAAGCAGCTGCAGGAAGGTGG + Intergenic
1128793392 15:70449080-70449102 ATGGAGGAAGAGAAGGATGGAGG + Intergenic
1128809274 15:70558535-70558557 GTGGAGCAGCAGTAGGAGGGAGG - Intergenic
1129228525 15:74183715-74183737 CTGGGGCAGCAGCAAGAAGGAGG - Intronic
1130092425 15:80831915-80831937 ATGGAGCTGCAGGGGAAAGGTGG + Intronic
1130127412 15:81105350-81105372 AAGGAGGAAAAGAAGGAAGGAGG - Intronic
1130688833 15:86062677-86062699 TGGGAGCAGGAGAAGGAAAGAGG - Intergenic
1131171478 15:90181909-90181931 AAGGAGCAGGAAAAGGGAGGAGG + Intronic
1131302853 15:91214833-91214855 ATTGAGGAGCAGAAAGAACGAGG - Intronic
1131382221 15:91973471-91973493 ATGCAACAGCAGGAAGAAGGGGG + Intronic
1131731625 15:95287669-95287691 AGGGAGCAGGAGAGGGGAGGAGG + Intergenic
1131853065 15:96563436-96563458 ATGCAGGAGCAGCAGGAATGGGG - Intergenic
1131875145 15:96798019-96798041 ATGGAGGAGGAGAAGGAAAAGGG + Intergenic
1131901064 15:97088520-97088542 AAGGAGGAGGAGGAGGAAGGAGG - Intergenic
1131901069 15:97088536-97088558 AAGGAGGAGGAGGAGGAAGGAGG - Intergenic
1131901097 15:97088636-97088658 AAGGAGGAGGAGGAGGAAGGAGG - Intergenic
1131901102 15:97088652-97088674 AAGGAGGAGGAGGAGGAAGGAGG - Intergenic
1131901122 15:97088725-97088747 AAGGAGGAGGAGGAGGAAGGAGG - Intergenic
1132024472 15:98393050-98393072 AGGGAACAGGAGCAGGAAGGGGG + Intergenic
1132078619 15:98845450-98845472 AGGGGGCAGGAGAAGGAAGGAGG - Intronic
1132078632 15:98845486-98845508 AGGGAGGAGGAGAAGGAAGGAGG - Intronic
1132932186 16:2464406-2464428 CTGGAGCCTCAGAAGGAGGGAGG + Intronic
1133139179 16:3731771-3731793 ATGGAGAAGCACAAGGAGGTAGG - Exonic
1133392770 16:5422830-5422852 AGGGAGGAGCAGAGAGAAGGAGG + Intergenic
1133802041 16:9092045-9092067 ATGGAGGAGCGGAAGGAGGAGGG + Exonic
1134338049 16:13319580-13319602 AGGGAGCAACAAAAGGGAGGAGG - Intergenic
1134810821 16:17165767-17165789 ATGGAGCAGTAGTTGTAAGGGGG - Intronic
1135937521 16:26793668-26793690 AAGGAGCAGAAGAGGGAGGGAGG - Intergenic
1136065154 16:27753746-27753768 AAGGAGGAAAAGAAGGAAGGAGG - Intronic
1136539106 16:30918740-30918762 AGGAAGGAGAAGAAGGAAGGAGG - Intergenic
1136768382 16:32811205-32811227 ATGGGGGAGAAGAAGGATGGTGG - Intergenic
1136774258 16:32863210-32863232 ATCGGGGAGCAGAAGGAAGAGGG + Intergenic
1136896353 16:33998304-33998326 ATCGGGGAGCAGAAGGAAGAGGG - Intergenic
1137468227 16:48730584-48730606 AAAGAGCAGCAGAAAGAGGGCGG - Intergenic
1138126165 16:54440468-54440490 ATGGAGGAGGAGGAGGAAGGAGG - Intergenic
1138340153 16:56283878-56283900 ATGGAGCAGCAGAATGAGATGGG - Intronic
1138689712 16:58755907-58755929 CTGGAGCAGGAGAAAGAATGGGG + Intergenic
1138773026 16:59687513-59687535 ATGGTGGAGCAGGAGGAAGAGGG + Intergenic
1139093025 16:63671914-63671936 ATGAAGAAGCAAAAGGAAAGAGG - Intergenic
1139105629 16:63823563-63823585 ACAGATCAGAAGAAGGAAGGGGG - Intergenic
1139165570 16:64561397-64561419 AAGGAGAAGAAGAAAGAAGGAGG + Intergenic
1139845533 16:69918617-69918639 ATCAAGCATCAGAAAGAAGGAGG - Intronic
1140178492 16:72689746-72689768 ATGGAGAAAGGGAAGGAAGGAGG - Intergenic
1140875402 16:79147240-79147262 AGGCAGGCGCAGAAGGAAGGTGG - Intronic
1141031919 16:80596599-80596621 ATGGAGGAACAGAAGGATGATGG + Intergenic
1141137228 16:81474329-81474351 AGGGTGCAGGAGAAAGAAGGGGG - Intronic
1141244205 16:82291217-82291239 ATGAAGCAGACGGAGGAAGGTGG + Intergenic
1141278045 16:82605888-82605910 AGGAAGCAGCAGTAGGAAGATGG - Intergenic
1141308851 16:82893863-82893885 TTGGACCAGTGGAAGGAAGGAGG - Intronic
1141535576 16:84677564-84677586 ATGCAGCAGCAGGAGGCAGCAGG + Intergenic
1141775666 16:86121449-86121471 AGGGAGGAGGAGAAGGAGGGAGG - Intergenic
1141845228 16:86603923-86603945 AGGGAGAAGGAGAAGGAGGGAGG - Intergenic
1141898026 16:86971088-86971110 ATCAAGGAGCAGAAGCAAGGTGG + Intergenic
1142103412 16:88288077-88288099 TTGGAGCAGCAGGAGGAAAAAGG - Intergenic
1142273693 16:89104601-89104623 CAGGAGAAGCAGAGGGAAGGTGG - Intronic
1142427991 16:90010978-90011000 AGGAAGCAGCTGAGGGAAGGAGG - Intronic
1203070774 16_KI270728v1_random:1073221-1073243 ATGGGGGAGAAGAAGGATGGTGG - Intergenic
1203076682 16_KI270728v1_random:1125329-1125351 ATCGGGGAGCAGAAGGAAGAGGG + Intergenic
1143046796 17:4087515-4087537 TAGGTGCAGCAGAAGGAAAGTGG - Exonic
1143296142 17:5873419-5873441 ATGGAACAGAAGAAGGAAGAAGG - Intronic
1143361129 17:6372192-6372214 AAGAAGCAGCAGGAGGGAGGCGG + Intergenic
1143539470 17:7560643-7560665 GTGGAGCTGGAGAAGGCAGGGGG + Intronic
1144022751 17:11251678-11251700 AGGGAACAGCAGAAGCAAGCTGG - Intronic
1144249715 17:13403486-13403508 CTGGGGTACCAGAAGGAAGGTGG - Intergenic
1145304693 17:21667040-21667062 CTGGAGGAGCAGAAAGAATGAGG - Intergenic
1145797191 17:27662560-27662582 AGGGAGCCGCAGAAGGATGGTGG - Intergenic
1145826362 17:27879990-27880012 AGGGGGCAGCAGGAAGAAGGAGG - Intronic
1145898262 17:28473483-28473505 AGGGAGAGGGAGAAGGAAGGAGG - Exonic
1145901447 17:28493111-28493133 AGTCAGCAGCAGAAGGAAGTGGG + Intronic
1146510289 17:33441603-33441625 TGGGAGAAGGAGAAGGAAGGAGG - Intronic
1146662417 17:34673641-34673663 AAAGAGCAGGAGAAGGAAGTAGG - Intergenic
1146987315 17:37232497-37232519 AGGGAGAGGAAGAAGGAAGGGGG + Intronic
1147309729 17:39588134-39588156 ACCGAGCATCAGCAGGAAGGTGG - Intergenic
1147446503 17:40478243-40478265 AGGGAACTGCAGAAGGAAAGAGG - Intronic
1147581074 17:41627476-41627498 GTGGGGCAGGGGAAGGAAGGTGG - Intergenic
1147674397 17:42194537-42194559 AGGGAGGAGCTGAAGGAGGGGGG + Intergenic
1148027798 17:44600401-44600423 ATGGGGCATCAGCAGCAAGGAGG - Intergenic
1148047678 17:44753937-44753959 GAAGAGCAGCAGAAGGAAGGAGG + Intergenic
1148349353 17:46928512-46928534 ATGGAGGACCATTAGGAAGGGGG + Intronic
1148862016 17:50609453-50609475 ATGGAGCAGGAGTGGGACGGTGG - Intronic
1149569395 17:57661773-57661795 ATGGAGTGGCAGAAAGAAAGGGG - Intronic
1149594152 17:57853956-57853978 AAGGAGCAGGAGAGGGACGGTGG - Intergenic
1149657729 17:58319122-58319144 ATGGAGCAGCAGCAGGGGGGTGG + Exonic
1150136125 17:62696292-62696314 AGGGAGCAGCGGAGGGACGGAGG + Intergenic
1150293046 17:63992906-63992928 ATGTAGGAGGGGAAGGAAGGAGG + Intergenic
1151181266 17:72330515-72330537 TTGGAGCAGGAAAGGGAAGGTGG - Intergenic
1151367031 17:73624076-73624098 CTGGAGCAGGAGCAGGGAGGAGG + Intronic
1152000072 17:77639876-77639898 AGGGAGGAGGAGGAGGAAGGAGG - Intergenic
1152311292 17:79551547-79551569 ATGGATGGGCAGATGGAAGGTGG + Intergenic
1152509440 17:80775504-80775526 AAAGTGCAGCAGAAGCAAGGAGG + Intronic
1152622534 17:81372480-81372502 ATGGAGCTTCAGGAGGGAGGAGG - Intergenic
1152630320 17:81408080-81408102 CAGGGGCAGCAGGAGGAAGGGGG - Intronic
1152854953 17:82659436-82659458 ATGGCGCTCCAGCAGGAAGGAGG - Intronic
1153333770 18:3901082-3901104 AGGGAGCAGCAGAAGGGAGTAGG - Intronic
1153414021 18:4825461-4825483 AAGCAGCAGCAGCAGGAAGAGGG - Intergenic
1153557725 18:6333617-6333639 ATGGAGAAGCAGGATGCAGGTGG + Intronic
1154027324 18:10720831-10720853 GTGGAGCAGCAGTAGTAAAGAGG - Intronic
1154964957 18:21347397-21347419 AAGGAGCAGCAGAAGCAGGAAGG - Intronic
1155014620 18:21820981-21821003 ATGAAGCAGCAAGAGGAATGAGG - Intronic
1155066536 18:22273762-22273784 ATGGAGGAGGAGGAGGGAGGAGG - Intergenic
1155066544 18:22273785-22273807 ATGGAGGAGGAGGAGGGAGGAGG - Intergenic
1155263326 18:24066714-24066736 ATGCAGGAGCAGAAGACAGGTGG - Intronic
1155713534 18:28911687-28911709 ACAGATCAGGAGAAGGAAGGAGG - Intergenic
1156149946 18:34228933-34228955 AGGGAGGAGCAGAAGCAAGTTGG + Intergenic
1156211181 18:34944758-34944780 AAGGAGCAAAAGAAGGAAGAAGG + Intergenic
1156503952 18:37577404-37577426 ATGGCACAGAAGAAGGAAGGAGG - Intergenic
1156694808 18:39753556-39753578 ATGGAGCCACTGAAGGGAGGGGG + Intergenic
1156822516 18:41389982-41390004 ATCAAACAGCAGAAGGAATGTGG + Intergenic
1157214701 18:45773176-45773198 AAGGAGAAGGAGAGGGAAGGAGG - Intergenic
1157556686 18:48617565-48617587 GTGGAGCAGGAGGAGTAAGGTGG + Intronic
1157584153 18:48790647-48790669 ATGGAGGAGCAGACGAAGGGAGG + Intronic
1157768664 18:50325135-50325157 AAGGAGAAGGAGGAGGAAGGAGG - Intergenic
1158142411 18:54269562-54269584 GTGGAGCCGGAGGAGGAAGGCGG + Exonic
1158500124 18:57993507-57993529 TTGGAGCAGCTGAGGGAAGCAGG + Intergenic
1158554289 18:58462397-58462419 TTGGAGACTCAGAAGGAAGGTGG - Intergenic
1158768151 18:60481096-60481118 TTGGAGACTCAGAAGGAAGGAGG - Intergenic
1159586657 18:70288983-70289005 CTGGAGGAGGAGGAGGAAGGAGG + Exonic
1159783786 18:72690745-72690767 AAGTAGAAGCAGAAGGAAGCAGG + Intergenic
1160991423 19:1861869-1861891 GTGGAGCAGCCGAAGGGAAGTGG - Intronic
1161298634 19:3532299-3532321 AGGGAGCAGCAGGAGGAGTGTGG + Intronic
1161329093 19:3677968-3677990 ATGGAGGAATAGAGGGAAGGAGG + Intronic
1161438646 19:4278777-4278799 TTGGAGCAGCAGAAGGAAGAGGG - Exonic
1161709287 19:5838764-5838786 ACCACGCAGCAGAAGGAAGGAGG + Exonic
1161803736 19:6430285-6430307 AAGGAGCTGAAGAAGGAATGGGG - Intronic
1161857888 19:6776197-6776219 ATGGATGAGCAGATGGATGGAGG - Intronic
1162180860 19:8867791-8867813 ATGGAAGGACAGAAGGAAGGAGG + Intronic
1162311542 19:9910609-9910631 ATGGAGAGGCAGATGGATGGTGG + Intronic
1162554071 19:11375592-11375614 GTCGAGCAGCAGAAGGGAGGGGG - Exonic
1162930026 19:13952938-13952960 AGGGAGAATCAGGAGGAAGGGGG + Intronic
1163244755 19:16086558-16086580 ATGGCGCAGCAGCAGGAAGTGGG + Intronic
1163690896 19:18737723-18737745 GAGGAGCAGCAGCAGGAGGGCGG - Intronic
1163779448 19:19238935-19238957 ATGGATGAGCAGAAGGCAGAGGG - Intronic
1164493087 19:28732142-28732164 AAGGAGAAGGAGAAAGAAGGAGG + Intergenic
1164505790 19:28860188-28860210 AGCGAGCAGGAGAGGGAAGGGGG + Intergenic
1164675993 19:30101933-30101955 ATGGAGCAAGAGAGAGAAGGCGG + Intergenic
1164686869 19:30172448-30172470 CTGGAGCAGGAGAAGGGAGCTGG + Intergenic
1164945295 19:32288254-32288276 GTGGATCAGGAGAAGGAAGAAGG - Intergenic
1165135071 19:33662659-33662681 GTGGAGGGGCAGGAGGAAGGAGG + Intronic
1165425379 19:35742629-35742651 ATGGGGCAGGAGAGTGAAGGGGG + Exonic
1165596650 19:37015214-37015236 GAGGAGCATCAGAAGGTAGGTGG - Intronic
1165690888 19:37862385-37862407 AAGGAGGAGGAGGAGGAAGGAGG + Intergenic
1165862670 19:38917460-38917482 GGGGAGCAGCAGGAGGAAAGGGG + Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166160224 19:40947214-40947236 AGGGAGGAGGAAAAGGAAGGCGG + Intergenic
1166182412 19:41118224-41118246 AGGGACCAACAGAAGGAAGGAGG + Intronic
1166670245 19:44705544-44705566 ATGGGGCAGTAGAGGGAAGGAGG - Intronic
1166700220 19:44878044-44878066 ATGGAGGAGGAGGAGGAGGGGGG - Intronic
1167443709 19:49525218-49525240 ATGGATCAGCAGCGGCAAGGCGG - Intronic
1167591536 19:50406911-50406933 GTGGAGCAGGAGAAGGAAGTGGG - Intronic
1167916531 19:52744372-52744394 GTGGAGCAGTGGAAGAAAGGAGG + Intergenic
1168085872 19:54046262-54046284 AGGGAGCAGCAAAAGGAGTGGGG + Intronic
1168116423 19:54223373-54223395 ATGGACGAGCTGAAGGAGGGAGG - Intronic
1168430732 19:56277739-56277761 ATAGAGACTCAGAAGGAAGGAGG + Intronic
925169736 2:1743628-1743650 CTGGGGGAGGAGAAGGAAGGGGG + Intronic
926105376 2:10146492-10146514 ATGGACCAGCAGGTGGCAGGTGG - Intronic
926266880 2:11331001-11331023 AGGAAGGAGCAGAAAGAAGGAGG + Intronic
926394848 2:12430406-12430428 AAGGAGAAGAAGGAGGAAGGAGG + Intergenic
926846803 2:17150019-17150041 AGGGAGAAGCAGAGGGAAGCGGG + Intergenic
926861773 2:17317493-17317515 AAGGAGGAGGAGAAGGAAGTGGG + Intergenic
927097316 2:19757447-19757469 AAGAAGCAGGAGAAGGAAGATGG + Intergenic
927633496 2:24793984-24794006 TTTGGGCAGCAGCAGGAAGGAGG - Intronic
927876056 2:26655853-26655875 AAGAAACAGCAAAAGGAAGGGGG - Intergenic
927946755 2:27139311-27139333 ACCCAGCAGCAGAAGGAATGGGG + Exonic
928394920 2:30936185-30936207 ATGGAGAGACAGAAGGAAAGTGG - Intronic
928436352 2:31257104-31257126 AAGGAGCAGCAGAAGGCCAGAGG + Intronic
928762362 2:34599805-34599827 ATGGAAAAACAGAAGGTAGGAGG - Intergenic
929508772 2:42550496-42550518 ATGGAGCAGCAGAAGGAAGGAGG + Intronic
929531144 2:42753682-42753704 AGGGCGCTGCAGAAGGGAGGAGG - Exonic
929594464 2:43167742-43167764 CTGGAGCAGAAGAAGGAAGAAGG - Intergenic
929971752 2:46584838-46584860 AGGGAACAGCAAAAGGAGGGAGG + Intronic
931464558 2:62475124-62475146 CAGGAGAAGCAGCAGGAAGGGGG + Intergenic
933014228 2:77104106-77104128 CTTGAGCAACTGAAGGAAGGTGG - Intronic
933148963 2:78891346-78891368 AAGGAGAGACAGAAGGAAGGAGG - Intergenic
933656712 2:84894531-84894553 TTGAAGCAGAAGAAGGAAGTGGG - Intronic
933860421 2:86461288-86461310 ATGGAGGAACAGAGGGAAGGAGG - Intronic
933998231 2:87685640-87685662 GAGGGGCAGCTGAAGGAAGGAGG + Intergenic
934882553 2:97996144-97996166 CTGGCGCAGGAGAAGGAGGGAGG + Intergenic
934991446 2:98924704-98924726 GTGGAGGAGTAGGAGGAAGGAGG - Intronic
935051832 2:99530876-99530898 CTGGAGCAGCACAAGGAGGGTGG - Intergenic
935564898 2:104595767-104595789 AGGGAGCAAGAGAGGGAAGGGGG - Intergenic
935711857 2:105906088-105906110 AAGGAGCAGCATGAGAAAGGAGG - Intergenic
935944545 2:108273563-108273585 AAGGAGCAGCAGCACGAAGAGGG - Intergenic
936295619 2:111265233-111265255 GAGGGGCAGCTGAAGGAAGGAGG - Intergenic
936741044 2:115509026-115509048 TGGGAGCAGCACAAGGAAGGGGG + Intronic
937016525 2:118611075-118611097 ATGGAACAGCAGATGGGAAGGGG - Intergenic
937250250 2:120519348-120519370 ATGAAGGAGGAGAGGGAAGGAGG - Intergenic
937814047 2:126231620-126231642 ATGGAGGAGGAGATGGAAGGAGG - Intergenic
937922719 2:127143225-127143247 TTGGAGGAGCAGAAGGATGGTGG - Intergenic
938655700 2:133430862-133430884 GTGGAGAGGGAGAAGGAAGGAGG + Intronic
939168454 2:138665384-138665406 ATGGAAAAGAAGTAGGAAGGAGG + Intergenic
939169267 2:138675000-138675022 ATGAAACAGGAGAAGGAAGGTGG - Intronic
939240454 2:139552200-139552222 ATGGAGGAGGTCAAGGAAGGAGG - Intergenic
939553129 2:143640284-143640306 ATGGGGAATCAGAAGGAAGAGGG + Intronic
940106916 2:150111474-150111496 ATGGAGTGGGAGGAGGAAGGAGG - Intergenic
941022617 2:160424870-160424892 AATGAGCAGCAATAGGAAGGTGG + Intronic
942210187 2:173662424-173662446 TTAGAGCAGCAGAAGGAACTTGG - Intergenic
942324958 2:174768736-174768758 AGGGAGCAGCCCAGGGAAGGGGG + Intergenic
942326679 2:174781996-174782018 ACAGAGCAGCAGAAGCCAGGCGG + Intergenic
942855397 2:180540508-180540530 ATGGAGCGAGGGAAGGAAGGAGG - Intergenic
943272399 2:185823543-185823565 AGGGAGGGACAGAAGGAAGGAGG + Intronic
943272531 2:185825420-185825442 ATGGGACACCAGAAGGGAGGAGG + Intronic
943662148 2:190570597-190570619 ATGGAGCAACAGGATGGAGGAGG + Intergenic
944338398 2:198565481-198565503 ATGGATCAGCCGAAAGAAAGGGG - Intronic
944455973 2:199894579-199894601 AAGGAGCAGCAGAGTCAAGGTGG - Intergenic
945389044 2:209241964-209241986 ACAGAGCACCTGAAGGAAGGAGG + Intergenic
945976897 2:216277923-216277945 TTGGAGCAGCAGACAGAAGAGGG - Intronic
946260189 2:218483281-218483303 ATGGAGCAGTAAAAGGTGGGGGG + Intronic
946437626 2:219668415-219668437 ATGGAAGAGCAAAAGGAAGCCGG - Intergenic
946704726 2:222447072-222447094 ATGGAGGAGCATAAAGAAAGAGG - Intronic
947852960 2:233303399-233303421 ATGAAGCAGCAGGAGAATGGGGG + Intergenic
948262242 2:236613015-236613037 ATGGAGCAGAGGGAGGAGGGCGG - Intergenic
948458489 2:238118210-238118232 ATGGAGCAGCAGATGGATGGAGG + Intronic
1168852528 20:986359-986381 GGGGAGCAGAAGAAGGAATGGGG - Intronic
1169208384 20:3752535-3752557 GAGGAGCCGCAGGAGGAAGGAGG + Exonic
1170072210 20:12381272-12381294 ATGGAGCAGAAGTAGCAAGCTGG - Intergenic
1170142514 20:13139094-13139116 ATGGAGGAGGAGAAGGAGGGAGG - Intronic
1170405605 20:16032668-16032690 ATGGATGAGAAGAGGGAAGGAGG + Intronic
1170757321 20:19215573-19215595 AAGGGCCAACAGAAGGAAGGAGG - Intronic
1170815186 20:19708074-19708096 AGGGAGAATCAGAAGAAAGGGGG + Intronic
1171301526 20:24065140-24065162 ATGGAACAAGAGAGGGAAGGAGG - Intergenic
1171370855 20:24661280-24661302 AGTGAGCAGAAGAAAGAAGGAGG + Intronic
1171383147 20:24748280-24748302 TGGGAGCAGCAGAAGGAAACAGG + Intergenic
1171503127 20:25610173-25610195 AAGGAGCAGCTGAATTAAGGAGG + Intergenic
1171522208 20:25784480-25784502 CTGGAGGAGCAGAAAGAATGAGG - Intronic
1171529957 20:25846425-25846447 CTGGAGGAGCAGAAAGAATGAGG - Intronic
1171554619 20:26071403-26071425 CTGGAGGAGCAGAAAGAATGAGG + Intergenic
1171941129 20:31330955-31330977 AAGGAGAAGGAGAAGGAAGAAGG + Intergenic
1172930038 20:38579939-38579961 GGGGAGCAGCTGCAGGAAGGGGG - Intergenic
1173001997 20:39111499-39111521 GTGGAGCAGGAGGAAGAAGGGGG + Intergenic
1173186008 20:40840801-40840823 AAGGAAAAACAGAAGGAAGGAGG + Intergenic
1173189632 20:40866147-40866169 CTGGAGTGGAAGAAGGAAGGAGG - Intergenic
1173438873 20:43057389-43057411 AAGGAGGAAAAGAAGGAAGGAGG + Intronic
1173529107 20:43754903-43754925 ATGGAGCAGAAACCGGAAGGAGG - Intergenic
1173707420 20:45122651-45122673 ATGAAGAAGAAGAAGGAGGGAGG - Intergenic
1173856850 20:46255724-46255746 CTGGAGCAGGAAAAGGAAGAAGG - Intronic
1174540935 20:51288669-51288691 AGAAAGCAGCAGAAGGCAGGAGG - Intergenic
1174965032 20:55203007-55203029 ATGGAGGCTGAGAAGGAAGGAGG + Intergenic
1175306813 20:57981854-57981876 AGGGAGGACCAGAAAGAAGGGGG + Intergenic
1175366426 20:58459514-58459536 AGGGATCAGGAGGAGGAAGGAGG + Exonic
1175503321 20:59465496-59465518 ATGGGGCAGAAGGAGGAAGAAGG - Intergenic
1175554657 20:59840977-59840999 ATGGAGCAGCACAACGAAGAAGG - Intronic
1175652345 20:60736254-60736276 ATGGAGGAACAGGAGGCAGGAGG - Intergenic
1175919671 20:62444791-62444813 CTGGGGCAGGAGAAGGAGGGTGG + Intergenic
1176030438 20:63008800-63008822 ATGGAGCTGGAGAATGCAGGAGG + Intergenic
1176215623 20:63946366-63946388 GTGGAGCAGGAGAAGGAAGCCGG - Intronic
1176656011 21:9589477-9589499 CTGGAGGAGCAGAAAGAATGAGG - Intergenic
1176873463 21:14102730-14102752 AGGGCGCAGGGGAAGGAAGGGGG + Intergenic
1177802945 21:25846374-25846396 TTGGAGCAGGAAAAGGAAGGAGG + Intergenic
1178191526 21:30287543-30287565 AGGGAGAGGAAGAAGGAAGGAGG + Intergenic
1179085106 21:38209182-38209204 CTGGAGCAGCAGGAGCAAAGGGG + Intronic
1179188570 21:39104338-39104360 ATAGAGAAACAGAAAGAAGGAGG + Intergenic
1179797551 21:43794213-43794235 CTGGAGCTCAAGAAGGAAGGAGG + Intronic
1180642177 22:17307798-17307820 GGGGTGCAGCAGAAGGAAGAAGG + Intergenic
1180649502 22:17367025-17367047 AAAGGGCAGCAGAAGGGAGGAGG + Intronic
1181279256 22:21707029-21707051 ATGGAGCCGGACAAGGCAGGAGG + Intronic
1181310396 22:21941582-21941604 ATGGAGCTGCGGAATGAATGAGG + Intronic
1181455298 22:23056125-23056147 CTGGAGCAGGTGAATGAAGGGGG + Intergenic
1181527877 22:23500483-23500505 GTGGGGGAGGAGAAGGAAGGTGG + Intergenic
1181885192 22:26016627-26016649 ATGGAGGAACAGAAAGATGGGGG - Intronic
1181931336 22:26403939-26403961 AAGGAGGAGGAGGAGGAAGGAGG + Intergenic
1182073449 22:27478909-27478931 ATGGACCAGGAGGAGGACGGTGG + Intergenic
1182114658 22:27749153-27749175 AAGGACCGGCAGAAGGAAAGAGG + Exonic
1182848927 22:33454776-33454798 TGGGAGCAGCAGAAAGAATGGGG + Intronic
1182890863 22:33817887-33817909 ATGGAGAAGCTGAAGGAGGGAGG + Intronic
1183131429 22:35840416-35840438 AGGGAGCTGGAGAAAGAAGGAGG - Intronic
1183593977 22:38798563-38798585 ATGGAGCAGCAAGAAGAAGATGG - Intergenic
1184087079 22:42271318-42271340 ATGCCGCAGCAGAAGGCAGCTGG - Intronic
1184089348 22:42284099-42284121 ATGGAGGAGCAGCGGGGAGGAGG + Intronic
1184610987 22:45602964-45602986 CTGGAGCAGAAGAGGGCAGGAGG + Intergenic
1184758271 22:46529457-46529479 AGGGGGTAGCAGGAGGAAGGTGG + Intronic
1184855416 22:47143921-47143943 CTGGAGCAGAAGAAGGCAGCGGG - Intronic
1185089360 22:48757179-48757201 AAGGAGGAGGAGAAGGGAGGAGG + Intronic
1185089372 22:48757218-48757240 AAGGAGGAGGAGAAGGGAGGAGG + Intronic
1185129196 22:49028092-49028114 ATGGAGGTACAGAAGGAAGGAGG + Intergenic
1185181380 22:49365459-49365481 CTGGAGGAGCAGGAGGATGGTGG - Intergenic
949128284 3:471913-471935 CTGGAGCAGGAGCAAGAAGGAGG - Intergenic
949828066 3:8183965-8183987 ATGGGGCAGCAGATGCAATGGGG - Intergenic
949901832 3:8821522-8821544 ATGGAGGATGAGAAGGAAGAAGG - Intronic
950595674 3:13979160-13979182 ATGGAGCAGAAGCAGGAAGCAGG - Intronic
950991024 3:17437674-17437696 AGGGGGCAGAGGAAGGAAGGGGG + Intronic
951295294 3:20926318-20926340 AGGGAGCAAGAGAGGGAAGGGGG + Intergenic
951505128 3:23436312-23436334 ATGGAACAGCAGAATGAACCTGG - Intronic
952499315 3:33945101-33945123 AGGGAGCAGAAGATGGAATGGGG + Intergenic
952766346 3:36957294-36957316 ATGAAGGGGAAGAAGGAAGGGGG - Intergenic
953549444 3:43890001-43890023 TTGGAGGAGCTGAAGGAAGAAGG - Intergenic
953724945 3:45389461-45389483 ATGATGCACAAGAAGGAAGGCGG + Intronic
954710842 3:52504423-52504445 AGGGAGCATCAGAAGGGAGCTGG - Intronic
954841736 3:53517354-53517376 TTGAAGTTGCAGAAGGAAGGTGG + Intronic
956705730 3:71997442-71997464 ATGAAGAAGAAGAAGAAAGGAGG + Intergenic
956784427 3:72630576-72630598 GGGGAGAAGCAGAAGGAAGAAGG + Intergenic
957911174 3:86621527-86621549 ATGAAGCAGCAGAAGGAAATAGG + Intergenic
958144907 3:89612199-89612221 AGAGAGAAACAGAAGGAAGGAGG - Intergenic
958595385 3:96216008-96216030 AGGGAGCTGCAGAAGGGTGGAGG + Intergenic
958735093 3:97999889-97999911 GTGGAGAAGGTGAAGGAAGGAGG + Intronic
958860452 3:99438896-99438918 TTAAAGCAGAAGAAGGAAGGAGG + Intergenic
959049305 3:101509268-101509290 ATGGGGCAGCAAAAGTAAGCTGG - Intronic
959595985 3:108128899-108128921 AAGGAGAGGCAGAAGGAAGCAGG + Intergenic
959932681 3:112000559-112000581 AAGGAGCAGCATTAGGAATGGGG + Intronic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
960166573 3:114409493-114409515 CAGAAGCAGCTGAAGGAAGGGGG + Intronic
960190401 3:114697734-114697756 AAGGAGCAGGAGAGGGAGGGAGG + Intronic
960373724 3:116872701-116872723 ATGAAGCAGGAGAAAGAAGTCGG + Intronic
960533747 3:118794089-118794111 GTGAAACAGCACAAGGAAGGGGG + Intergenic
960836438 3:121911456-121911478 ATGGAGGAGGAGGAGGAGGGAGG - Intronic
961314480 3:126025344-126025366 AAGGAGCAGCAGACAGCAGGTGG + Intronic
961319107 3:126060782-126060804 ACGGAGCAGCAGGTGGAAGCCGG + Intronic
961346034 3:126263943-126263965 ATTGGGGAGCAGAAGGGAGGAGG + Intergenic
961366224 3:126401675-126401697 AGGGAGCAGCAGGTGGGAGGGGG + Intronic
961405544 3:126677160-126677182 AGGAAGAAGCAGAAGAAAGGAGG + Intergenic
961422318 3:126816119-126816141 ATGGACACGTAGAAGGAAGGAGG - Intronic
961521223 3:127468394-127468416 ATGGAGCAGGACGAGGAAGCAGG + Intergenic
961673822 3:128552909-128552931 ATGGAGCAGCAGGAAGGATGGGG + Intergenic
962091747 3:132251595-132251617 ATGGAGCAAATGAAGGGAGGGGG + Intronic
962137784 3:132755826-132755848 AGGGACCAGAAGCAGGAAGGTGG + Intergenic
962331720 3:134484692-134484714 AAGGAGTAGCAGCAGGAAAGTGG - Intronic
963846035 3:150159073-150159095 GTGAAGCAGCAGAAGAATGGGGG - Intergenic
965110063 3:164409621-164409643 AAGGAGGAACAGAGGGAAGGAGG - Intergenic
965360721 3:167735219-167735241 ACAGAGCAGAGGAAGGAAGGGGG + Intergenic
965756210 3:172029909-172029931 AGGAAGCAAGAGAAGGAAGGAGG - Intergenic
965884296 3:173424804-173424826 AGGGCTCAGCAGAAGGCAGGAGG - Intronic
966207560 3:177420508-177420530 ATGTAGCAGAAGAAGGCGGGAGG - Intergenic
966954742 3:184864126-184864148 AAGGAGAAGGAGAAGGGAGGGGG + Intronic
967035739 3:185647223-185647245 GTGGAGCAGGGGAAGGAGGGGGG + Intronic
968276667 3:197445632-197445654 AAGGAGCAGAAGAAGGAACAGGG - Intergenic
969258317 4:6017965-6017987 ACAGAGCAGAAGAAGGAGGGCGG + Intergenic
969360571 4:6660716-6660738 AAGGAGGAGGAGAAAGAAGGAGG + Intergenic
969511385 4:7620014-7620036 AAGGAGGAGGAGGAGGAAGGAGG - Intronic
969511390 4:7620030-7620052 AAGGAGGAGGAGGAGGAAGGAGG - Intronic
969525443 4:7701793-7701815 ATGGAGGGGCAGAGGGAAGACGG + Intronic
969617124 4:8260180-8260202 GAGGAGCAGGAGAGGGAAGGAGG - Intergenic
969659323 4:8517395-8517417 AGGGAGCAGAAGAGGGAGGGGGG + Intergenic
970253078 4:14137049-14137071 AAGGAGCTGCAGAAACAAGGAGG + Intergenic
970931015 4:21512020-21512042 AGGGAGGAAGAGAAGGAAGGAGG + Intronic
971094682 4:23387374-23387396 AAGGAGAAGCAGAAGTAAGATGG - Intergenic
971192607 4:24441675-24441697 AGGAAGAAACAGAAGGAAGGAGG + Intergenic
971255199 4:25008096-25008118 GTGGTGCTACAGAAGGAAGGGGG - Intronic
971903752 4:32698283-32698305 ATGGTGCAGCAATAGGAGGGTGG + Intergenic
972156782 4:36172886-36172908 AAGGAGCAGCAGGATGGAGGTGG - Intronic
972696618 4:41452688-41452710 GCGGTGCAGAAGAAGGAAGGAGG - Intronic
974239226 4:59223783-59223805 TTAGAGTAGCAGAAAGAAGGAGG - Intergenic
974247092 4:59333849-59333871 GTGGAAGAGCAGAAGGAAGGAGG - Intergenic
975814705 4:78205722-78205744 TGGGAGCAGCAGCAGGAAGAGGG + Intronic
977195861 4:94058336-94058358 ATGTACCAGAAGAAGGCAGGAGG + Intergenic
978400725 4:108327707-108327729 AAGGAGAAGAAGAAGGAAGTAGG - Intergenic
978404477 4:108364724-108364746 ATGGGGAAGCAGGAGGAGGGTGG - Intergenic
978613613 4:110571642-110571664 AGGGAGCAGCAATAGGCAGGTGG - Intergenic
979345674 4:119584135-119584157 CTGGAGCAGGAGAAAGAAGTAGG + Intronic
979932068 4:126643210-126643232 ATGGAGGAGCAGAGGGATGAGGG + Intergenic
980146562 4:128992748-128992770 AGGGAGCACCAGTAAGAAGGTGG - Intronic
980255834 4:130380167-130380189 ATGGAGGAGCATAAGTATGGAGG - Intergenic
980418427 4:132524091-132524113 ATGGAGGAACAGAGTGAAGGAGG - Intergenic
981545144 4:145885947-145885969 CTGGGGCAGCAAAGGGAAGGAGG - Exonic
981809335 4:148755848-148755870 ATGGGGCATAAGAAGGAAGGAGG - Intergenic
983839738 4:172442365-172442387 ATGGTGCTGCAGAAGCAAGCTGG - Intronic
984881380 4:184412704-184412726 AGCAAGGAGCAGAAGGAAGGTGG - Intronic
985031392 4:185794260-185794282 ATGGAGAAGGAGGAGGAGGGAGG + Intronic
985851610 5:2392548-2392570 ATGGAAGAGAAGAAAGAAGGAGG - Intergenic
985880288 5:2634151-2634173 GTGGAGCTGCAGAAGGCAGGCGG + Intergenic
986342745 5:6805168-6805190 AGGGAGCAGTTGAAGGAATGGGG + Intergenic
987025370 5:13921690-13921712 AAGAAGCAGAAGAAGGAAAGAGG - Intronic
987034566 5:14006886-14006908 AGGCAGCAGCAGGAGGCAGGAGG - Intergenic
987388615 5:17354192-17354214 ATGAAGCTGCAGAACCAAGGAGG - Intergenic
988597193 5:32606061-32606083 GTGCAGCATCTGAAGGAAGGTGG + Intergenic
988632079 5:32942330-32942352 AAGGAGAAGGAGAAGGGAGGAGG + Intergenic
988706106 5:33727329-33727351 ATGGAGGAGAAGAAACAAGGAGG - Intronic
989242899 5:39220602-39220624 ATGAATGAGTAGAAGGAAGGTGG - Intronic
989322359 5:40151199-40151221 CTGGAGGAGCAAAAGGAAGAAGG - Intergenic
990526483 5:56633170-56633192 AAGGAGGAGCAGGAGGAGGGAGG + Intergenic
990953273 5:61319615-61319637 AGGGAGTAGCAGTTGGAAGGAGG - Intergenic
990994491 5:61717906-61717928 AAGGAGAAGCAGGTGGAAGGTGG - Intronic
990995190 5:61726220-61726242 ACGGAGAAGCAAAAGGCAGGAGG + Intronic
991917359 5:71618357-71618379 GTGGAACAGCAGAAGGTGGGAGG - Intronic
992266948 5:75028838-75028860 ATGGAGCTGCAGAATTAAGGTGG - Exonic
992696805 5:79297363-79297385 ATGGAGCAGTGCAGGGAAGGTGG - Intronic
992737866 5:79742018-79742040 AGGGAGGAGGAGGAGGAAGGAGG - Intronic
992773206 5:80068464-80068486 ATGGGGCAGAAGAAGGAAAGGGG - Intronic
992787523 5:80184241-80184263 ATGGAGTAGAAGAGAGAAGGTGG - Intronic
993138115 5:83996370-83996392 ACTGAGCAGCAGAAGGAACAAGG + Intronic
993174502 5:84466163-84466185 ATGGAGCAGATAAAGGAAGGTGG + Intergenic
993858589 5:93105630-93105652 ATGAAGTATCAGAATGAAGGGGG - Intergenic
995404320 5:111777013-111777035 GTGGAGGAGGAGGAGGAAGGAGG + Intronic
995614827 5:113950194-113950216 TGGGAGCAGCAGAATGAGGGAGG - Intergenic
995652006 5:114380279-114380301 ATGGACCACCAGAAAGAAGCAGG - Intronic
995679537 5:114701502-114701524 ATGGGGTAGAAGAGGGAAGGTGG - Intergenic
996053772 5:118962597-118962619 ATGGAGAAGAAAAAGGAAGTGGG + Intronic
996441923 5:123500983-123501005 AGGGAACAGAAGAAGGAAGCTGG + Intergenic
997044620 5:130299364-130299386 TTTGAGCAACAGAAGGATGGTGG + Intergenic
997171896 5:131730164-131730186 ATGGAATAGAAGAAGGCAGGGGG + Intronic
997283190 5:132661304-132661326 CTGGTGCAGCAGACAGAAGGTGG - Intergenic
997670376 5:135666485-135666507 ATCGAGGAGCAGAAGGATGTAGG - Intergenic
997923096 5:138001502-138001524 ATGGAGCTTTAGAAGGAAGATGG - Intronic
998504482 5:142660907-142660929 CTGGAGCCAGAGAAGGAAGGAGG - Intronic
998664023 5:144275272-144275294 AAGGAGGAGCAGATGGGAGGTGG - Intronic
998679883 5:144455236-144455258 ATGTGGAAGCAGAAGGAAGTTGG - Intronic
998855175 5:146387733-146387755 TTTGAGGAGAAGAAGGAAGGAGG - Intergenic
998957607 5:147453618-147453640 CCGGAGCAGAAGAAGGAGGGAGG - Intronic
999125001 5:149240089-149240111 ACTGAGAAGCAGCAGGAAGGTGG + Intronic
999153116 5:149439999-149440021 AAGGAGCACAGGAAGGAAGGTGG - Intergenic
999381037 5:151121699-151121721 ATGGAGCCGCTGGAGGAAGTGGG - Intronic
999514334 5:152285843-152285865 ATGGGCCAGGAGAAGGAAGGGGG + Intergenic
1000113609 5:158133017-158133039 AGGGAACAGCAGAAGAAGGGTGG + Intergenic
1000142482 5:158418998-158419020 ACTGAGTAGCAGAAGGAAGAGGG + Intergenic
1000706437 5:164518931-164518953 ATGGAGGAGGAGAGGCAAGGAGG + Intergenic
1001132923 5:169079597-169079619 AGGGAGGAGGAGGAGGAAGGAGG + Intronic
1001313641 5:170628022-170628044 AAGCAGGAGCAGAAGGAAGAGGG - Intronic
1001514334 5:172344948-172344970 ATGGAGGAAAGGAAGGAAGGAGG + Intronic
1001548261 5:172584038-172584060 CTGGAGGAGGAAAAGGAAGGAGG + Intergenic
1002108416 5:176891740-176891762 ATGGGGCAGGAGGAGGAAGAAGG - Intronic
1002118228 5:176981706-176981728 TGGGACCAGGAGAAGGAAGGTGG + Intronic
1002400164 5:178987052-178987074 AGGGACCAGCAGGAGAAAGGAGG + Intronic
1002447036 5:179296102-179296124 ATGGTGAAGCAGGAGGATGGGGG + Intronic
1002969125 6:1996093-1996115 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1003115852 6:3283622-3283644 AGGCAGCAGCAGGAGGAAGGGGG - Intronic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1003973432 6:11321138-11321160 AGGGAGGGACAGAAGGAAGGAGG + Intronic
1004475602 6:15968322-15968344 CTGGGGCTGCAGAAGGAAGATGG + Intergenic
1005533258 6:26729691-26729713 ATGGAGCAAGAGAAGGGGGGAGG + Intergenic
1005537536 6:26771973-26771995 ATGGAGCAAGAGAAGGGGGGAGG - Intergenic
1005777110 6:29146238-29146260 CTGGGGCAGGGGAAGGAAGGGGG - Intergenic
1005910880 6:30308435-30308457 ATTGAGTAGCAAGAGGAAGGAGG + Intergenic
1005987371 6:30883533-30883555 GAGGAGCAGGAGAAGGATGGAGG - Intronic
1006595779 6:35191886-35191908 ATGGCGGAGCTGAGGGAAGGGGG - Intergenic
1006617746 6:35341380-35341402 AAAGAGAAGCAGAAAGAAGGGGG + Intergenic
1006750212 6:36372305-36372327 CTGGAGCAGCAGGAGCACGGGGG + Intronic
1006852950 6:37112555-37112577 ATGAGGCGGGAGAAGGAAGGGGG + Intergenic
1007224778 6:40305317-40305339 GGGGAGCAGCAGCAGGTAGGGGG + Intergenic
1007231244 6:40348979-40349001 ATGGAGCAGCAGAAGGGTCCAGG - Intergenic
1007397641 6:41586713-41586735 CTGAAGCAGCGGAAGGAGGGAGG + Intronic
1007537372 6:42605114-42605136 ATGGAGCACAAGGAAGAAGGGGG - Intronic
1007714514 6:43848026-43848048 ATGAAGAAGGAGGAGGAAGGTGG + Intergenic
1007963541 6:45983209-45983231 ATGCAGCAGCACAGGGAGGGAGG + Intronic
1008678920 6:53851477-53851499 ATGGAACAGACGATGGAAGGAGG - Intronic
1008784396 6:55148498-55148520 ATGGAGAAGCACATGGTAGGTGG - Intronic
1009008412 6:57814383-57814405 ATGGAGCAAGAGAAGGGGGGAGG - Intergenic
1009878713 6:69538594-69538616 ATGGAACGGCAAAAGGTAGGAGG + Intergenic
1010183274 6:73112768-73112790 ATGGAGCTGGGGAAAGAAGGGGG + Intronic
1010578669 6:77566251-77566273 AGGGAGCAGAAGAAATAAGGTGG + Intergenic
1011441436 6:87391349-87391371 ATGGAGCCACTGCAGGAAGGAGG + Intronic
1011668660 6:89660832-89660854 ATTAAGCAGCAGCAGGAATGGGG + Intronic
1011750053 6:90446566-90446588 AAGAAGCAGCAGAAGCCAGGTGG + Intergenic
1012848029 6:104414091-104414113 ATGGAGCAACAGAAAGGAGGTGG + Intergenic
1013325239 6:109039100-109039122 GAGGAGAAGGAGAAGGAAGGAGG + Intronic
1014331487 6:120071209-120071231 ATGGAGTAGGAGAAGCAAGATGG - Intergenic
1014425394 6:121298660-121298682 ATTGAGCAGCAGAAGAAGAGAGG - Intronic
1014528047 6:122524115-122524137 AAGGAGGAGGAGAAGGAAGAAGG - Intronic
1014773583 6:125484190-125484212 GTGGGTCAGCAGAAGTAAGGAGG - Intergenic
1014884846 6:126767137-126767159 ATAGATATGCAGAAGGAAGGAGG - Intergenic
1015225509 6:130852776-130852798 ATGGAGATGCAGGAGGAAGGAGG - Intronic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015323402 6:131901292-131901314 ATGGAATAAAAGAAGGAAGGAGG - Intergenic
1015666524 6:135636118-135636140 AGGGAGAAGAAGAAGGAAGAAGG - Intergenic
1016073811 6:139772668-139772690 AAGGAGAGGGAGAAGGAAGGAGG - Intergenic
1016474256 6:144409479-144409501 ATGGGAAAGCACAAGGAAGGTGG - Intronic
1016794723 6:148105753-148105775 ATGGAGGAGAAGGAGGAAGATGG + Intergenic
1017056799 6:150443863-150443885 ATGGTGCAGCAGAAAGAGGCTGG + Intergenic
1017853553 6:158328169-158328191 TTGGAGGAGCAGGAGGAGGGAGG + Intronic
1018038102 6:159898742-159898764 AGGGAGAAGGAGAAGGAACGAGG - Intergenic
1018073630 6:160190003-160190025 AAGGAGGAGGAGAAGGAAAGAGG + Intronic
1018248336 6:161843297-161843319 ATGGAGAAGGAGACAGAAGGTGG - Intronic
1018333879 6:162763300-162763322 CTTGAGAAGCAGCAGGAAGGAGG + Intronic
1018757971 6:166865920-166865942 ATGGAGAAGGGGAGGGAAGGAGG + Intronic
1018795217 6:167180054-167180076 AGGGGGCAGCAGAAACAAGGTGG - Intronic
1018802844 6:167236729-167236751 ATGTACCACCAGATGGAAGGAGG + Intergenic
1018807744 6:167274310-167274332 ATGTACCACCAGATGGAAGGAGG - Intronic
1018821103 6:167375008-167375030 AGGGGGCAGCAGAAACAAGGTGG + Intronic
1018996990 6:168717459-168717481 AAGGAGCAGCACCTGGAAGGAGG + Intergenic
1019030361 6:169004909-169004931 ACGGTGCAGCAGGAGAAAGGTGG + Intergenic
1019049228 6:169170369-169170391 AGGGAGCGGAAGGAGGAAGGTGG - Intergenic
1019500016 7:1360119-1360141 ATGGACCAGCAGAGGAGAGGGGG - Intergenic
1019660186 7:2219775-2219797 CTGGAGCACCAGGAGGAGGGTGG - Intronic
1019817331 7:3210826-3210848 ATGGATCAGCAAAAAGTAGGAGG + Intergenic
1020828136 7:13058019-13058041 GAGGAGAAGCAGAAAGAAGGAGG - Intergenic
1020917531 7:14214929-14214951 ATGGAGTGGGAGAAGGAGGGAGG - Intronic
1021163516 7:17305112-17305134 ATAGGGCAGCAGCAGGAGGGTGG + Intronic
1021410042 7:20320033-20320055 ATGGACCAGCAGGGGGAAAGTGG - Intergenic
1022178583 7:27896087-27896109 AGAGAGCAGCACAAGGAAGGAGG + Intronic
1022215234 7:28253204-28253226 AAGGAGAAGGAGAAGGAAGCAGG - Intergenic
1022569920 7:31442230-31442252 ATGGAGGAGAAGAAATAAGGAGG + Intergenic
1022782154 7:33596837-33596859 ATGGAAGAATAGAAGGAAGGGGG - Intronic
1023049964 7:36242433-36242455 ATGAATGAACAGAAGGAAGGAGG - Intronic
1023693434 7:42818642-42818664 AGGAAGAAGGAGAAGGAAGGAGG + Intergenic
1024169395 7:46768540-46768562 ATCAATCAGGAGAAGGAAGGAGG - Intergenic
1025282698 7:57639655-57639677 CTGGAGGAGCAGAAAGAATGAGG - Intergenic
1025302019 7:57825762-57825784 CTGGAGGAGCAGAAAGAATGAGG + Intergenic
1025852536 7:65256566-65256588 ATGAAGCAGAAGAAGGAATCAGG + Intergenic
1025887775 7:65614523-65614545 GAGGAGGAGCAGATGGAAGGAGG - Intergenic
1026401826 7:70021679-70021701 ATTGAGGAGCAGCAGGAAGGAGG - Intronic
1026584293 7:71643692-71643714 TTGCAGCAGCAGAAGGCAGCAGG + Intronic
1026642600 7:72140427-72140449 CAGGAGCAGCAGAAGGAGGTGGG - Intronic
1026879717 7:73900792-73900814 GAGGAGCAGGAGAAGAAAGGGGG - Intergenic
1026917461 7:74129531-74129553 AAGGAGAAGGGGAAGGAAGGAGG + Intergenic
1028076851 7:86527094-86527116 TTGGACCAGCAGAAGGATGGAGG - Intergenic
1028199527 7:87944893-87944915 AGGAAGAAGAAGAAGGAAGGAGG - Intronic
1028554189 7:92104706-92104728 ATGGAATATCAGAAGCAAGGAGG - Intronic
1029173915 7:98650381-98650403 TTGGAGCATCAGAAGGGAGAAGG + Intergenic
1029175799 7:98663530-98663552 ATGGAGAAGGACAGGGAAGGTGG + Intergenic
1029574012 7:101391081-101391103 ACAGAGCAGCGGAAGGAAAGGGG + Intronic
1030128315 7:106176302-106176324 ATGGAGCTGGAGAAGCAAGGAGG - Intergenic
1030196448 7:106858109-106858131 ATGTAGCAGGAAAAGGAGGGTGG + Intergenic
1030714993 7:112799351-112799373 ATTAAGCTGCAGAAGGGAGGGGG + Intergenic
1031780784 7:125961458-125961480 ATGGAACAGCAGGAGGAGGGAGG - Intergenic
1031854602 7:126907187-126907209 GAGGAGGAGCAGATGGAAGGAGG + Intronic
1031863845 7:127015094-127015116 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1031863849 7:127015122-127015144 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1032605491 7:133346319-133346341 ATGGAGAAGCAGACAGAAGCAGG - Intronic
1033628665 7:143135759-143135781 AAGGAGCAGAAGAAGGCAAGAGG - Intronic
1033828317 7:145219699-145219721 AAGGAGCAGCAGAGAGAAGGGGG - Intergenic
1034001952 7:147424113-147424135 ATGGAGCAGCGGAATGAAGTAGG - Intronic
1034455056 7:151165599-151165621 ATAGAGCAGCAACTGGAAGGTGG - Intronic
1034978910 7:155463435-155463457 AAGGAGGAGCAGGAGGAAGGAGG - Exonic
1035078434 7:156196888-156196910 AAGGAGCAGGAGAAAGAAAGAGG - Intergenic
1035117352 7:156535827-156535849 ATTGAGCAGCAGGAGGAATTTGG - Intergenic
1035418162 7:158706413-158706435 AGGGACCAGCATAAGGAAAGGGG - Intergenic
1036690298 8:10940890-10940912 AAGGAGCAGCTGAAGGGAAGGGG - Intronic
1037627018 8:20617189-20617211 CTGCAGCACCAGAAGTAAGGTGG + Intergenic
1037824719 8:22154515-22154537 ATGGGAAAGCAGAAGGGAGGGGG - Intronic
1038054603 8:23846639-23846661 GTGGCACAGCAGAAGGAAGCTGG + Intronic
1038532421 8:28329137-28329159 ATGGTGCAGGAGCAGGAAGCAGG - Exonic
1038699612 8:29837282-29837304 ATGCAGGAGCCCAAGGAAGGTGG + Intergenic
1038914476 8:32005131-32005153 ATGGAAGAGAGGAAGGAAGGAGG + Intronic
1039886285 8:41655933-41655955 AGGGAGCAAGAGAAGGAGGGCGG - Intronic
1040516077 8:48136298-48136320 ATGGAGCAGGATGAGCAAGGTGG - Intergenic
1041179294 8:55230942-55230964 ACTGAGCAGCTGAAGGCAGGAGG - Intronic
1041180214 8:55239536-55239558 GTGGGGCAGCAGAAGGAGAGTGG - Intronic
1041291160 8:56310104-56310126 AAGGAGGAGGAGAAGGAAGGAGG + Intronic
1041291191 8:56310197-56310219 AAGGAGGAGGAGGAGGAAGGAGG + Intronic
1041291196 8:56310213-56310235 AAGGAGGAGGAGGAGGAAGGAGG + Intronic
1041291201 8:56310229-56310251 AAGGAGGAGGAGGAGGAAGGAGG + Intronic
1041291206 8:56310245-56310267 AAGGAGGAGGAGGAGGAAGGAGG + Intronic
1041291211 8:56310261-56310283 AAGGAGGAGGAGGAGGAAGGAGG + Intronic
1041291216 8:56310277-56310299 AAGGAGGAGGAGGAGGAAGGAGG + Intronic
1041291221 8:56310293-56310315 AAGGAGGAGGAGGAGGAAGGAGG + Intronic
1041291230 8:56310322-56310344 AAGGAGGAGGAGGAGGAAGGAGG + Intronic
1042748301 8:72131537-72131559 AAGGAGAAGAAAAAGGAAGGAGG - Intergenic
1042889339 8:73589985-73590007 AGGGAGGAGGAGAAGGAAGAGGG + Intronic
1043817738 8:84823791-84823813 ATAGAGAAGCTGAAAGAAGGAGG - Intronic
1044127328 8:88474432-88474454 CTGTACCAGCAGAAGCAAGGTGG + Intergenic
1044380809 8:91530960-91530982 ATTGTACAGCAGAGGGAAGGGGG + Intergenic
1044725104 8:95188300-95188322 GTGGAGAAGCAGAAGGCAGCAGG + Intergenic
1044826737 8:96205790-96205812 CTGGAGCAGGAAAAGCAAGGAGG - Intergenic
1045388271 8:101691228-101691250 TGGGAGCTGTAGAAGGAAGGAGG - Intronic
1046367879 8:113260023-113260045 ATGCAGCAGAAGAAAGAATGAGG - Intronic
1046877035 8:119266584-119266606 GTGTAGGAGCAGAATGAAGGAGG + Intergenic
1046932843 8:119858297-119858319 ATGGAGGGGCAGTGGGAAGGGGG - Intergenic
1047308189 8:123670211-123670233 AAGGAGGAGGAGGAGGAAGGTGG - Intergenic
1047344014 8:124009840-124009862 ATGGAGCTGCAGACCCAAGGAGG + Intronic
1047526407 8:125638058-125638080 AGGGGGCAGAAGAAGAAAGGAGG + Intergenic
1047893787 8:129342995-129343017 ATGGAGACACAGTAGGAAGGAGG + Intergenic
1048147303 8:131857978-131858000 ATGGAGAAGGAGAAGAAAGAAGG - Intergenic
1048421191 8:134279823-134279845 GTGGAGCAGCAGATGTAAGGAGG + Intergenic
1048468540 8:134687084-134687106 GGGGAGCAGCAGGAGGCAGGAGG - Intronic
1048551911 8:135441433-135441455 AGGGAGCCACAGGAGGAAGGAGG + Intergenic
1048989707 8:139754145-139754167 ATGGAGCAGCAGCAGGCTGGGGG - Intronic
1049058446 8:140257386-140257408 GAGGAGAAGTAGAAGGAAGGTGG - Intronic
1049092940 8:140530397-140530419 AGGGAACAGCAGCAGGAAGAGGG + Intergenic
1049394974 8:142395755-142395777 AGTGAGCAGCAGCGGGAAGGAGG + Intronic
1050261817 9:3848997-3849019 GTGCAGCAGCAGTGGGAAGGGGG - Intronic
1050339350 9:4620300-4620322 ATGAAGCCACAGGAGGAAGGAGG - Intronic
1050475905 9:6040906-6040928 AAGGAGGAGGAGGAGGAAGGAGG - Intergenic
1051170385 9:14314702-14314724 AAGGAGGAGGAGGAGGAAGGTGG - Intronic
1051700907 9:19822932-19822954 AAGGAGAAGAGGAAGGAAGGAGG - Intergenic
1051889506 9:21927830-21927852 ATGGCTAACCAGAAGGAAGGGGG + Intronic
1052706298 9:31997424-31997446 ATGGAGCAGCAGCTGCAATGGGG + Intergenic
1052830618 9:33212258-33212280 AGGGAGCAGCAGAAGAAGGGAGG + Intergenic
1053065470 9:35065785-35065807 ATGGAGCAAAGGAAGGATGGAGG + Intronic
1053198650 9:36137986-36138008 AGGGAGGAACAGAGGGAAGGAGG - Intronic
1053730914 9:41056107-41056129 CTGGAACAGAAGAAGGAGGGCGG - Intergenic
1053897461 9:42757193-42757215 CTGCAGCAACAGAAGGAAAGTGG - Intergenic
1054697599 9:68375983-68376005 CTGGAACAGAAGAAGGAGGGCGG + Intronic
1055511035 9:76995791-76995813 TGGAAGGAGCAGAAGGAAGGGGG - Intergenic
1055840467 9:80497120-80497142 ATGGAGCAGCTGCAGGAATGGGG - Intergenic
1056018423 9:82416590-82416612 AGGAAGCAGCAGCAGGAAGGGGG + Intergenic
1056282768 9:85058132-85058154 AAGGGGCAGGGGAAGGAAGGAGG + Intergenic
1056376976 9:86024324-86024346 ATAGAGCAGGAAAAGGATGGCGG + Intergenic
1056666746 9:88587476-88587498 AAGGAGCAGCAGAGGAAGGGTGG + Intergenic
1056818313 9:89817661-89817683 ATGTGGAAACAGAAGGAAGGAGG + Intergenic
1056856331 9:90132701-90132723 AATCAGCAGCGGAAGGAAGGTGG - Intergenic
1058567719 9:106304340-106304362 ATGCAGCATAAGGAGGAAGGAGG + Intergenic
1058616424 9:106833621-106833643 ATTGAACAGCATAAGGAAGGGGG - Intergenic
1058776489 9:108289318-108289340 CTGGAGAAGCAGATGGAAGGGGG - Intergenic
1059070775 9:111133687-111133709 ATGTAGCTGCACAAAGAAGGAGG + Intergenic
1059072447 9:111152904-111152926 AGGGAGGAGGAGGAGGAAGGAGG + Intergenic
1059072452 9:111152920-111152942 AAGGAGGAGGAGGAGGAAGGAGG + Intergenic
1059072464 9:111152962-111152984 AAGGAGGAGGAGGAGGAAGGAGG + Intergenic
1059072477 9:111153004-111153026 AAGGAGGAGGAGGAGGAAGGAGG + Intergenic
1059729674 9:117044414-117044436 ATGGAGCAGCAGAGGGGTGTGGG + Intronic
1059823220 9:117997232-117997254 AAGGAGGAGGAGGAGGAAGGAGG - Intergenic
1060549052 9:124476625-124476647 AAGGGGCAGCAGAAGGAGTGGGG + Intronic
1060573019 9:124660571-124660593 TTGGAGCTGCAGAAAGATGGGGG + Intronic
1060978205 9:127777554-127777576 CTGGGGCAGCAGAGGGATGGGGG - Intronic
1061085357 9:128394940-128394962 AGGGAGGAGCCTAAGGAAGGAGG - Intergenic
1061237658 9:129351930-129351952 AAGGGACTGCAGAAGGAAGGCGG - Intergenic
1061487639 9:130928461-130928483 ATGGAGGGGCAGCTGGAAGGCGG + Intronic
1061856769 9:133445737-133445759 ATGGGGCAGCATCAGGACGGGGG + Exonic
1061978860 9:134088272-134088294 ATTGAGCAGCAGAAGCCAGGAGG - Intergenic
1061984402 9:134121550-134121572 ATGGGAAAGCAGAAGCAAGGTGG + Intergenic
1062165347 9:135104808-135104830 CTGGAGGAGCAGGAGGCAGGAGG - Intronic
1062190716 9:135246619-135246641 GAGGATGAGCAGAAGGAAGGAGG - Intergenic
1062284002 9:135765055-135765077 ATGGAGCGGCAGAAGTCAGGGGG + Exonic
1203633728 Un_KI270750v1:92937-92959 CTGGAGGAGCAGAAAGAATGAGG - Intergenic
1185449556 X:275216-275238 AAGGAGCAGGGGGAGGAAGGAGG + Intergenic
1185524944 X:770361-770383 AGGGAGGAAAAGAAGGAAGGAGG + Intergenic
1185665206 X:1760098-1760120 AAGGAGAAGGGGAAGGAAGGAGG - Intergenic
1185830196 X:3294303-3294325 AAGGAGAAGGAGAAAGAAGGAGG - Intergenic
1186145783 X:6622114-6622136 ATGGAGGGACAGAAGGAAGGAGG + Intergenic
1186582956 X:10840624-10840646 TTGGAGAAAGAGAAGGAAGGCGG - Intergenic
1188801652 X:34538990-34539012 AGGGAGGAGGACAAGGAAGGAGG + Intergenic
1189166140 X:38863025-38863047 ATGGCGCAGCAGCAGGCAGGAGG + Intergenic
1189540247 X:41979988-41980010 AAGGAACAGAAAAAGGAAGGAGG + Intergenic
1189573154 X:42321169-42321191 ATGGTGAAGAAGCAGGAAGGTGG + Intergenic
1190113215 X:47608625-47608647 AGGGAGCAACAGGAGGGAGGGGG + Intronic
1191732562 X:64353006-64353028 ATGCAGGGGGAGAAGGAAGGAGG - Intronic
1192314231 X:70039561-70039583 AGGCAGCAACAGAAGGAAGATGG + Intergenic
1192603183 X:72486382-72486404 GTGGAGCAGTAGAGGGAAAGGGG - Intronic
1192631614 X:72781929-72781951 ATGGAGCAGCAGAAGGGGCTTGG + Intronic
1192633136 X:72792197-72792219 ATGGAGCAGCCGAAGGGGCGTGG + Intronic
1192648573 X:72928604-72928626 ATGGAGCAGCCGAAGGGGCGTGG - Intronic
1192650095 X:72938872-72938894 ATGGAGCAGCAGAAGGGGCTTGG - Intronic
1193247757 X:79249510-79249532 ATGGAGCAGAAGACTTAAGGAGG + Intergenic
1193827431 X:86242844-86242866 ATGGAGCAGGAGAAAGAAGGGGG - Intronic
1195008008 X:100705962-100705984 ATAGATCAGCAGAAGGCAAGTGG - Intronic
1195265591 X:103176319-103176341 ACAGAGCAGCAGAGGGCAGGCGG - Intergenic
1195277666 X:103298119-103298141 AAGGGGCTGCAGAAGGACGGAGG + Intergenic
1195615069 X:106905674-106905696 GAGAATCAGCAGAAGGAAGGAGG + Intronic
1195908213 X:109865665-109865687 AGGCAGCAGCAGAAGGCAAGTGG - Intergenic
1196109729 X:111932987-111933009 CTGGAACAGCAGAAAGAAGATGG - Intronic
1196111660 X:111953100-111953122 ATTGAGCAGCAGCAAGAAGCAGG - Intronic
1196914114 X:120514140-120514162 AAGGAGGAGCAGAAGCAACGGGG - Intergenic
1197707721 X:129646528-129646550 AGGGAAGGGCAGAAGGAAGGAGG - Exonic
1197829399 X:130625846-130625868 ATGGAGAAGTAACAGGAAGGGGG + Intronic
1198064179 X:133079778-133079800 GTGGAGCTGCAGAAGAAATGTGG + Intronic
1198278909 X:135123332-135123354 GTGGAGCATCAGGAGGAAGGTGG + Intergenic
1198292050 X:135249188-135249210 ATGGAGCATCAGGAGGAAGGTGG - Intronic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1199679477 X:150215288-150215310 AGGGAGAAACAGAGGGAAGGAGG + Intergenic
1199717864 X:150519055-150519077 AAGGAGGAGGAGAAAGAAGGAGG + Intergenic
1199751550 X:150824134-150824156 GAGGAGGAGAAGAAGGAAGGAGG + Intronic
1199982820 X:152930163-152930185 ATGGTGCAGAAGGTGGAAGGTGG - Intronic
1199991398 X:152989577-152989599 AAGGAGGAGCAGGAGGAAGAGGG - Exonic
1200097268 X:153670136-153670158 AGGGAGAAGCAGAGGGAAAGGGG + Intronic
1200105699 X:153710865-153710887 ATCGGGGAGCAGAAGGAAGAGGG - Intronic
1201257281 Y:12121051-12121073 AGGGGACAGCAGAAGGAATGGGG + Intergenic
1201461674 Y:14232562-14232584 AAGAAGCAGAAGAAGGAAGGAGG - Intergenic
1201490208 Y:14532809-14532831 ATAGAGAAAAAGAAGGAAGGAGG - Intronic
1201564595 Y:15353177-15353199 AGTGAGCAGCAGAAGCAAGTTGG + Intergenic