ID: 929511584

View in Genome Browser
Species Human (GRCh38)
Location 2:42569056-42569078
Sequence CCTCCACGAAACCCTCATCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 42}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929511568_929511584 30 Left 929511568 2:42569003-42569025 CCCAGTGTTTAGGGCCAGGCCTC 0: 1
1: 0
2: 2
3: 15
4: 215
Right 929511584 2:42569056-42569078 CCTCCACGAAACCCTCATCGGGG 0: 1
1: 0
2: 0
3: 1
4: 42
929511575_929511584 11 Left 929511575 2:42569022-42569044 CCTCTACTTGGGGGTACGAATTA 0: 1
1: 0
2: 0
3: 0
4: 37
Right 929511584 2:42569056-42569078 CCTCCACGAAACCCTCATCGGGG 0: 1
1: 0
2: 0
3: 1
4: 42
929511569_929511584 29 Left 929511569 2:42569004-42569026 CCAGTGTTTAGGGCCAGGCCTCT 0: 1
1: 0
2: 0
3: 12
4: 138
Right 929511584 2:42569056-42569078 CCTCCACGAAACCCTCATCGGGG 0: 1
1: 0
2: 0
3: 1
4: 42
929511574_929511584 16 Left 929511574 2:42569017-42569039 CCAGGCCTCTACTTGGGGGTACG 0: 1
1: 0
2: 0
3: 3
4: 39
Right 929511584 2:42569056-42569078 CCTCCACGAAACCCTCATCGGGG 0: 1
1: 0
2: 0
3: 1
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929511584 Original CRISPR CCTCCACGAAACCCTCATCG GGG Intronic
900532392 1:3161033-3161055 CCTCCACCAAACCCTCAGGCAGG + Intronic
905223395 1:36464255-36464277 CCTCCACGCGACCCTCAGCATGG + Exonic
916184626 1:162118863-162118885 ACTCCATGAAAACCTCATCTCGG + Intronic
1077330717 11:1982763-1982785 CCTCCAGGGAGCCCTCCTCGAGG - Intronic
1077476880 11:2794673-2794695 CCTCCAGGACACCCTCACCTGGG - Intronic
1078549341 11:12269619-12269641 CTCCCACGAAGCCCTCATCCTGG - Intergenic
1084939763 11:72606291-72606313 CCTCCAGGATACCCTCAGCTGGG - Intronic
1202813697 11_KI270721v1_random:37942-37964 CCTCCAGGGAGCCCTCCTCGAGG - Intergenic
1102809847 12:115814791-115814813 TCTCCACGAAGCCCTCTTCTTGG - Intergenic
1111672374 13:91347813-91347835 CCTCCGCGAAGCTCTCCTCGCGG + Intergenic
1113926348 13:113943913-113943935 CCTCCTCCACACACTCATCGTGG + Intergenic
1125724840 15:41862888-41862910 CCTCCAGGAAGCCCTGATCCAGG - Exonic
1129260272 15:74362935-74362957 ACTCCACATAACCCACATCGTGG + Intronic
1131828347 15:96337547-96337569 CCCCATCGAAACCCTCATCCGGG + Exonic
1136540405 16:30924999-30925021 CCTCCAGGACACCCTCCTCTTGG - Intronic
1137897481 16:52229566-52229588 CCTCCAAGAAACCCTCTCAGAGG + Intergenic
1151452027 17:74203793-74203815 CCTCCCCGACACCCTCCACGCGG - Intronic
1156739327 18:40304911-40304933 CCACCACTATACCCTCATCAGGG - Intergenic
1160820019 19:1053562-1053584 CCTCCAGGAAGCCCTCCTCCTGG - Intronic
1161161091 19:2762231-2762253 TCGCCACAAAACCCACATCGAGG + Intronic
1167430516 19:49451597-49451619 CGTCCTCGAGACCCTCAACGTGG + Exonic
1167512111 19:49900881-49900903 CCTCATCGAAACCATCATTGTGG - Intronic
925967889 2:9083363-9083385 CCTCCCCTAAACCCTCAGCCTGG - Intergenic
929511584 2:42569056-42569078 CCTCCACGAAACCCTCATCGGGG + Intronic
934775136 2:96932497-96932519 TCTCCAGAAAGCCCTCATCGGGG - Intronic
935743993 2:106175050-106175072 CCTCCATGAAATCCTCAGTGGGG + Intronic
948844134 2:240675152-240675174 CCTCCACCAAACGCTCGTCCAGG + Intergenic
948849726 2:240699727-240699749 CCTCCACCAAACGCTCGTCCAGG - Intergenic
1184267889 22:43359571-43359593 TCTCCAGGAAACCCTCTTGGAGG - Intergenic
966759801 3:183407881-183407903 CCTGCACCAAACCCTCTTCACGG + Intronic
968074517 3:195809203-195809225 CCTTAAGGAAACCCTCATTGCGG + Intronic
978606613 4:110487142-110487164 CCTCCACAAATTCCTCATGGGGG - Intronic
979613530 4:122715575-122715597 CCACCACGAAACACTCCTCGGGG + Intergenic
984097139 4:175447681-175447703 CCTCCAGGTAACCCACATCAAGG + Intergenic
995892972 5:116977423-116977445 CATCCACGTGACCCTCATGGTGG + Intergenic
1001250672 5:170144475-170144497 GCTCAACCAAACCCTCCTCGTGG + Intergenic
1002047203 5:176548894-176548916 CCTCCACGAGAACCTCACAGGGG + Intronic
1019350325 7:551419-551441 CCTCCACGTACTCCTCATTGGGG + Exonic
1034785727 7:153924406-153924428 CCTCCTCAAAACCCTCAATGAGG - Intronic
1035613552 8:985893-985915 CCTCGATGAAACCCTCTTCCTGG + Intergenic
1045550249 8:103164878-103164900 ACTCCAAGAAACACTCATCTGGG - Intronic
1048830002 8:138466525-138466547 CTTCCACGAAAGCATCATCAGGG - Intronic
1057962576 9:99470764-99470786 CCTCCACTAAACCCCCACCTAGG - Intergenic
1062571512 9:137187989-137188011 CCTCCACGAACCACTCCTCCAGG + Exonic