ID: 929511688

View in Genome Browser
Species Human (GRCh38)
Location 2:42569397-42569419
Sequence CAGAAGACTGGGAAGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 886
Summary {0: 1, 1: 0, 2: 6, 3: 85, 4: 794}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929511688_929511694 -5 Left 929511688 2:42569397-42569419 CCTGCCTCCTTCCCAGTCTTCTG 0: 1
1: 0
2: 6
3: 85
4: 794
Right 929511694 2:42569415-42569437 TTCTGCGGAAGAGAGAAATAAGG 0: 1
1: 0
2: 1
3: 17
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929511688 Original CRISPR CAGAAGACTGGGAAGGAGGC AGG (reversed) Intronic
900408821 1:2503857-2503879 CAGAAGAGAGAGAGGGAGGCAGG - Intronic
900542797 1:3212502-3212524 CAGAACATGGGGACGGAGGCAGG - Intronic
900827296 1:4937004-4937026 CAGAAGCCTGGGAAGGAATTAGG - Intergenic
901099490 1:6708370-6708392 AGGAAGACTGGGGAAGAGGCAGG + Intergenic
901199030 1:7456275-7456297 AAGAAGAATGGGAGGGAGGAAGG + Intronic
901557874 1:10045964-10045986 TAGAAGTCTGGGTAGGAGGCCGG + Intronic
901634482 1:10664250-10664272 CACAAGGCTGGGAAGGAGGCCGG + Intronic
901678613 1:10900779-10900801 CTTAGGACTGGGTAGGAGGCGGG - Intergenic
902183138 1:14704827-14704849 CACAACACAGGGAAGGAGCCAGG - Intronic
902327989 1:15715159-15715181 AAGAAGGCTGGCAAGAAGGCTGG + Intronic
902517335 1:16996490-16996512 CAGAACCCTGGGGAGGAGGCGGG + Exonic
902728987 1:18356405-18356427 CAGAAGAGTGGGAGGGAGATTGG + Intronic
902902603 1:19529877-19529899 CAGGAGACTGGGGAGGAGCGTGG - Intergenic
902960228 1:19958072-19958094 TGGAAGACTGGGAAGGAGGTGGG - Intergenic
903087487 1:20875663-20875685 CAGCACTCTGGGAAGGAGGCAGG + Intronic
903278642 1:22237452-22237474 CAAAAGACTGCCAGGGAGGCTGG + Intergenic
903654785 1:24942632-24942654 CAGAGGAGTGGGGAGAAGGCAGG - Intronic
903767668 1:25745075-25745097 CAGAAAACTGTGAAGGTGGAGGG - Intronic
904011600 1:27393210-27393232 CAGAAGTCTGGGAGGGTGGGGGG + Intronic
904317640 1:29676108-29676130 GAGAGCACTGAGAAGGAGGCTGG + Intergenic
904480697 1:30791561-30791583 AGGAAGACAGGGAAGGAGGGAGG + Intergenic
904862548 1:33549701-33549723 GATAAGAAAGGGAAGGAGGCTGG + Intronic
904901917 1:33864480-33864502 CAGAAGAGTAGGAAGGATGATGG - Exonic
905214633 1:36398071-36398093 CCGGAGCCTGGGAAGGAGCCTGG - Intergenic
905329208 1:37180328-37180350 CAGCAGACTGGGAAGGCAGAGGG - Intergenic
905616570 1:39404915-39404937 CAGAAGGGTGGGAAGAAGGAAGG - Intronic
905655762 1:39684962-39684984 CAGAAGCCTGCCAAGGAGGGTGG - Intronic
906543965 1:46608526-46608548 GGGATGGCTGGGAAGGAGGCAGG + Exonic
906833389 1:49058473-49058495 CACATGACTGGGAAGGCTGCAGG - Intronic
907332494 1:53680110-53680132 GAGAAGGCAGGGAGGGAGGCAGG + Intronic
907555055 1:55336159-55336181 CAGAAGAAGGGGCAGGAGGGAGG + Intergenic
907728152 1:57039623-57039645 AAGAAGAGTGGGAAGGAGAAAGG - Intronic
907752264 1:57273635-57273657 GAGAAGACAGGGAGGGAGGGAGG - Intronic
907869885 1:58433270-58433292 CAGAAGTGTGGGAAAGAGGAAGG + Intronic
907918286 1:58890564-58890586 CAGAAGACTGGGTGAGGGGCGGG + Intergenic
908331433 1:63074602-63074624 CAGGAGCCCGGGAAGAAGGCGGG - Intergenic
909597436 1:77422260-77422282 AAGGAGACTGGTTAGGAGGCTGG - Intronic
909945501 1:81658562-81658584 CAGAAGTGTGGGAAGGTGGGAGG - Intronic
910669550 1:89759321-89759343 CAGAACACAAGGAAGGAGACTGG + Intronic
911067991 1:93809211-93809233 TAGAAGGATGGGGAGGAGGCAGG + Intronic
911364246 1:96917433-96917455 CAGATGGGTGGTAAGGAGGCTGG + Intergenic
911504696 1:98734061-98734083 CAGAAGAATGGACAAGAGGCTGG - Intronic
912593076 1:110847152-110847174 CAGAAGACTGTGAGGGAGCTGGG - Intergenic
912802594 1:112729800-112729822 CAGAAGTCAGGCAAGGAGGCTGG - Intergenic
913203507 1:116515332-116515354 CAGACCACGGGGGAGGAGGCCGG - Intronic
913585469 1:120271184-120271206 CAGAAGACTGGGATCTGGGCAGG - Intergenic
913597386 1:120392023-120392045 CAGAAGTCTGGAACAGAGGCTGG + Intergenic
913622714 1:120627183-120627205 CAGAAGACTGGGATCTGGGCAGG + Intergenic
914215971 1:145628752-145628774 AAGAAGAATGGGAAGAAAGCTGG + Intronic
914308666 1:146446925-146446947 CAGAAGTCTGGAACAGAGGCTGG + Intergenic
914468540 1:147951384-147951406 AAGAAGAATGGGAAGAAAGCTGG + Intronic
914512652 1:148347472-148347494 CAGAAGTCTGGAACAGAGGCTGG - Intergenic
914567474 1:148883043-148883065 CAGAAGACTGGGATCTGGGCAGG - Intronic
914605348 1:149247202-149247224 CAGAAGACTGGGATCTGGGCAGG + Intergenic
915076193 1:153309684-153309706 CAGAGGACTGGGGAGGGGGAGGG + Intronic
915555314 1:156657857-156657879 CACGAGAAAGGGAAGGAGGCCGG - Intronic
916252749 1:162754632-162754654 CAGAAGAAGGGGATGGAGCCTGG + Exonic
916323856 1:163535200-163535222 AAGATCACTGGGAAGGATGCAGG + Intergenic
916500086 1:165379651-165379673 CAGAAGGCTGGGGAAGAGCCAGG - Intergenic
916555722 1:165892730-165892752 CAGAAGAATGTAAAGGAGGGAGG + Intronic
916771579 1:167914040-167914062 CAGAAGACAGGAGAGGAGGCCGG + Exonic
916874902 1:168958767-168958789 CGGCAGCCTGGCAAGGAGGCAGG - Intergenic
917058685 1:171012975-171012997 CAGAAGACTGGACAGCAGGGAGG - Intronic
917453368 1:175165706-175165728 CCAAAGCCTGGGAGGGAGGCTGG - Intronic
917534167 1:175862755-175862777 CAGCAGCCTGGAAAGGAGGAAGG - Intergenic
918447721 1:184631614-184631636 CAGAAGAGCAGGAAGAAGGCAGG + Intergenic
919763188 1:201111120-201111142 CAGAAGAGAGGCAAGGAGGGAGG + Intronic
919780850 1:201220021-201220043 AAGAAGACAGGGAGGGAGGAAGG - Intronic
919790720 1:201289093-201289115 CAGCAGAGGGGGCAGGAGGCTGG + Intronic
919816604 1:201444752-201444774 TGGAAAACTGTGAAGGAGGCTGG - Intergenic
920041878 1:203103354-203103376 GGGAAGATGGGGAAGGAGGCAGG - Intronic
920052162 1:203170860-203170882 CTGAAGACTGTGAAGAGGGCTGG - Intronic
920130828 1:203730603-203730625 CAGAAGACTGGAAAGGAGCAAGG - Intronic
921007443 1:211108602-211108624 CAAAAGACTTGGAAGAAGACAGG + Intronic
921131990 1:212227829-212227851 AAGGAGAGTGGGAAAGAGGCAGG + Intergenic
921329328 1:214019804-214019826 CAGGCGTCTGGCAAGGAGGCCGG - Intronic
921509100 1:216009159-216009181 CAGAAAAGTGGGAAAGAGGTTGG - Intronic
922613859 1:226949194-226949216 CTGGAGGCTGGAAAGGAGGCCGG + Intronic
922733034 1:227962020-227962042 CAGAAGACTGGAGAGGAGGAGGG + Intergenic
922809877 1:228409415-228409437 CAAAAGACAGGGACGGAGGGTGG + Intronic
922822322 1:228493140-228493162 CAGGAGGCTGAGAAGGAGGAGGG + Exonic
923332967 1:232942622-232942644 AAGAAGAGAGGGAAGGAGGCAGG + Intergenic
923818041 1:237402629-237402651 CAAAAGATTGGGAAACAGGCTGG + Intronic
923988872 1:239412202-239412224 AAAAAGAGTGGGAAGGAGGGAGG - Intronic
924362497 1:243255777-243255799 CTGAAGAGTGGGATGGAGGCGGG + Intergenic
924616728 1:245618055-245618077 CAGAAGGAAGAGAAGGAGGCAGG + Intronic
924859623 1:247907727-247907749 CTGAAAACTGTGAATGAGGCCGG - Intergenic
1062916624 10:1245099-1245121 CAGGACACTGGGTGGGAGGCTGG + Intronic
1063081921 10:2775457-2775479 CAGAAGGGTGGAAAAGAGGCAGG - Intergenic
1063735284 10:8746748-8746770 GAGAAGACAGAGAGGGAGGCTGG + Intergenic
1064119622 10:12607223-12607245 AAGAAGAAAGGGAGGGAGGCCGG - Intronic
1064285161 10:13985338-13985360 CATGGGACAGGGAAGGAGGCTGG + Intronic
1064348714 10:14557041-14557063 GAGAAGTGTGGGAAGGGGGCTGG - Intronic
1064817959 10:19288422-19288444 CAGGAGGCTGGGAGGGAGGTGGG - Intronic
1064963250 10:20989561-20989583 GAGAAGACAGGGAGGGAGGAGGG + Intronic
1065019692 10:21494362-21494384 GAGAAGCCTGGGAAGGAGCTTGG + Exonic
1065479227 10:26175996-26176018 TAAAAGACTGGAAAGAAGGCCGG + Intronic
1065739580 10:28784768-28784790 ATGCAGACTGAGAAGGAGGCAGG - Intergenic
1065866424 10:29919076-29919098 CAGAAGAGAGGGGAGGAGGGAGG - Intergenic
1067129603 10:43550913-43550935 CATAAGATTGGGAACAAGGCAGG - Intergenic
1067673330 10:48346533-48346555 TAGCAGACTGGGAAGCAGGGGGG + Intronic
1068046502 10:51892845-51892867 CAGAAGACTGGGAAGAAAATTGG + Intronic
1068757936 10:60675376-60675398 CAGAAAACTGGGAAGATGGGTGG - Intronic
1068815059 10:61300240-61300262 CAGAGGACTGGGAGGGAGCGAGG + Intergenic
1069800159 10:71077008-71077030 CAGAAGGCAGGCAGGGAGGCAGG + Intergenic
1069881931 10:71598566-71598588 CAGCTGATGGGGAAGGAGGCAGG + Intronic
1070128701 10:73641757-73641779 CTGAAGACTGAGAGGGAGACAGG + Exonic
1070168598 10:73915816-73915838 TACAAAACTGAGAAGGAGGCTGG + Intronic
1070704370 10:78627050-78627072 CTGTAGACAGGGAAGTAGGCAGG - Intergenic
1070803415 10:79256460-79256482 TGGAAGGCTGGGAAGGATGCAGG - Intronic
1071117985 10:82245955-82245977 CAGAAGACTGGGAAAAAATCAGG - Intronic
1071561604 10:86650213-86650235 CACAAGCCTGGGAAGGAAACTGG - Intergenic
1071846884 10:89529842-89529864 CTTAAGACTGTAAAGGAGGCCGG - Intronic
1072100534 10:92225267-92225289 CAGAAAATGGGGTAGGAGGCTGG - Intronic
1072710970 10:97715202-97715224 CAGAAGCCTGTGAGGAAGGCTGG - Exonic
1073204421 10:101761393-101761415 CAGGAGGCTGGGAAAGAGGCTGG - Intergenic
1073214316 10:101828252-101828274 CAAAGTCCTGGGAAGGAGGCAGG + Exonic
1073953558 10:108840001-108840023 AAGAAGAATAGGAAGGAGACAGG + Intergenic
1074777890 10:116779551-116779573 CAGGAGACAGGGAAGGTTGCAGG + Intergenic
1075071017 10:119319863-119319885 CAGAAGGCTGGCAGGGAGGGAGG + Intronic
1075344913 10:121674874-121674896 AAGAAGAACGGGAAGGAGACTGG - Intergenic
1075672674 10:124273162-124273184 CAGGAGAATGGGAAGGAGAGAGG - Intergenic
1075859535 10:125662579-125662601 CAAAAGCCTGGGAAGGAAACAGG + Intronic
1076448886 10:130541508-130541530 AAGAAGAGAGGGAAGGAGGAAGG - Intergenic
1076500342 10:130931518-130931540 GAGATGAGAGGGAAGGAGGCAGG + Intergenic
1076535418 10:131173939-131173961 CTCAGGACTGGGAAGGAGGGAGG + Intronic
1077125534 11:933961-933983 CAGCAGGCTGGGAAGGTGGCAGG + Intronic
1077158630 11:1102683-1102705 CAGGAGGCTGGCATGGAGGCGGG + Intergenic
1077357977 11:2127402-2127424 CAGAAGCCCTGGAATGAGGCTGG + Intergenic
1077436165 11:2540190-2540212 CAGCAGCCTGGGGAGGGGGCTGG + Intronic
1077943078 11:6864224-6864246 GAGAAGACTGGGGAGAAGGAGGG - Intergenic
1078060487 11:8039742-8039764 CAGGAGACTGTGAGGGAGGTGGG + Intronic
1078103999 11:8346987-8347009 CAGATGACTGGGAAGGGAGTAGG + Intergenic
1078943704 11:16038472-16038494 AAGAAGACTGGGAAAGAGGGAGG + Intronic
1079150647 11:17896528-17896550 CAGAAGACTTGGAAGGGGAAGGG + Intronic
1079261922 11:18890766-18890788 CAGGAGACTGGAAAGCAGGAGGG + Intergenic
1079328241 11:19512472-19512494 TAGATGACGGGGAGGGAGGCAGG + Intronic
1081382892 11:42437483-42437505 AAGAAGAGTGGGAAGGAGAGTGG - Intergenic
1081979091 11:47255017-47255039 CAGGAAACTGGGAATGGGGCAGG + Intronic
1083026263 11:59553673-59553695 CTTAACACTGGGAAGTAGGCCGG - Intergenic
1083311363 11:61785544-61785566 AACAGGACTGGGAAGGAGGCAGG + Intronic
1083342614 11:61968101-61968123 CAGATGATTGGGAAGGTGGAAGG + Intergenic
1083455925 11:62778557-62778579 CAGAAGTCTGGGCAGCATGCTGG + Intronic
1083897046 11:65625195-65625217 CAGAAGACTGAGAAGAGGACAGG - Exonic
1084482499 11:69430073-69430095 CGAAAGCCTGGGAAGGAGCCTGG - Intergenic
1084569282 11:69949743-69949765 CAGAAGGGCTGGAAGGAGGCAGG + Intergenic
1084695036 11:70747973-70747995 AAGAGGAGAGGGAAGGAGGCAGG + Intronic
1085171523 11:74453652-74453674 CAGACGACTGGGTTGGAGGGAGG + Intergenic
1085224383 11:74906357-74906379 CAGTAGACTGGAATGGAGGCAGG - Exonic
1085708999 11:78812298-78812320 CAGAGCACGGGGCAGGAGGCTGG + Exonic
1086318955 11:85624861-85624883 AAGAAGAAAGGGAAGGAGGGAGG + Intronic
1086924891 11:92629705-92629727 CTGAAGAAGGGGAAGGAGGTTGG - Intronic
1087049104 11:93868291-93868313 CAGTAGGCTGGGTAGGAGCCTGG + Intergenic
1087084133 11:94199324-94199346 CAGATGGCCGGGAAGTAGGCGGG - Intergenic
1089028605 11:115298376-115298398 AAGAAGAAAGGGAAGGAGGCAGG + Intronic
1089404505 11:118186478-118186500 CAGGGGACTGGGAAAGAGACCGG - Intergenic
1089461815 11:118658298-118658320 CAGGAGGCTGAGCAGGAGGCTGG + Exonic
1089466191 11:118688042-118688064 CAGAAGGCTGAGCAGGAGGCTGG + Intergenic
1089540885 11:119188393-119188415 AAGAAGGCTGGGATGCAGGCTGG + Exonic
1090419590 11:126565063-126565085 CAGGAGCTTGGGAGGGAGGCAGG + Intronic
1090773945 11:129946905-129946927 CAGAAGATTGGGAAGCTCGCTGG - Intronic
1091227308 11:133965238-133965260 TAGAAGACTGTGAAAGAGGCCGG - Intergenic
1091404273 12:199161-199183 AGGAAGACAGGGAGGGAGGCAGG + Intronic
1091897047 12:4113926-4113948 CCTAAGAGTGGGAAGGAAGCTGG + Intergenic
1092092835 12:5818015-5818037 AAGAAGGCTTGGAAGGATGCAGG + Intronic
1092122954 12:6057274-6057296 CAGTAGACTGGGAAGGTCGAAGG + Intronic
1092143139 12:6197921-6197943 CTGGAGGGTGGGAAGGAGGCCGG - Intergenic
1092280947 12:7097157-7097179 CCGCAGACTGGGAGAGAGGCGGG + Exonic
1093090037 12:14910725-14910747 GAGGGGACTGGGCAGGAGGCTGG - Intergenic
1093179671 12:15952919-15952941 CAAAAAACTGGGCAGGATGCAGG - Intronic
1093685665 12:22050958-22050980 CAAAAGAGAGGGTAGGAGGCAGG - Intronic
1094216479 12:27948036-27948058 GAGAAGACTTGGAAGGAGTTTGG + Intergenic
1094697475 12:32834695-32834717 AAGAAGACTGGGGGGGAGGAGGG + Intronic
1096486519 12:51985694-51985716 CAGAGAGCTGTGAAGGAGGCAGG + Intronic
1096557243 12:52410920-52410942 CAGAGGAGTGGGAGGGAAGCAGG - Intergenic
1096578899 12:52571847-52571869 CAGGAGGCTGGGGAGGGGGCTGG - Intronic
1096694287 12:53338939-53338961 CAGGGCACTGGGAAGGAGACTGG - Intronic
1096735387 12:53649306-53649328 CAGAAGACTCAGCAAGAGGCTGG + Intronic
1097250575 12:57630415-57630437 AAGAATGCTGGGAGGGAGGCAGG - Intronic
1097604830 12:61740526-61740548 CAGAAGGATGGGAAGGTGGGAGG + Intronic
1098003538 12:65970771-65970793 CTGAAGACTGAGGAGGAGGTTGG - Intergenic
1099441780 12:82707682-82707704 CATATGAGTGGAAAGGAGGCAGG + Intronic
1099520439 12:83653885-83653907 CCAGAGACTGGGAAGGTGGCAGG + Intergenic
1099861412 12:88229196-88229218 CAGTAGGCTGGGTAGGAGCCTGG - Intergenic
1100207186 12:92363590-92363612 GAGAAGAATGAGGAGGAGGCAGG - Intergenic
1100272391 12:93038882-93038904 CAATAGACTGGAGAGGAGGCAGG - Intergenic
1100273601 12:93049547-93049569 AAGAAGAAAGGGAAGGAGGGAGG - Intergenic
1100282193 12:93128503-93128525 CAGAAGCCAGGCACGGAGGCGGG - Intergenic
1101136744 12:101751596-101751618 CAGAGGACTGGGAGTCAGGCTGG + Intronic
1101200235 12:102427820-102427842 CAGGAGAGAGGGAAGGAGGGAGG + Intronic
1101357661 12:103995547-103995569 CAGAGGATTGGGGTGGAGGCAGG - Intronic
1102142617 12:110628022-110628044 CAGAAGAGAGAGAAGGAAGCAGG - Intronic
1102159575 12:110757571-110757593 CAGAAAAATGGGAAGGGGGCTGG - Intergenic
1102325720 12:111981676-111981698 CAAAAGCCTGGGAAAGAGGCTGG + Intronic
1102371884 12:112388683-112388705 CAGAAAACTGGGAAACAGGTAGG - Intergenic
1102514616 12:113437977-113437999 CTGAAGTCAGGGAAGGGGGCAGG - Exonic
1102543172 12:113637003-113637025 CAGATGACTCGGAGAGAGGCTGG - Intergenic
1103179038 12:118891709-118891731 CTGAAGACTAGGAAGGAGGATGG + Intergenic
1103845757 12:123901080-123901102 CAGAAGCATGGGCTGGAGGCTGG - Intronic
1103943446 12:124513195-124513217 TATTAGCCTGGGAAGGAGGCTGG + Intronic
1103954964 12:124571006-124571028 CAACAGAGGGGGAAGGAGGCAGG + Intergenic
1104092057 12:125525738-125525760 AAGAAAGCTGGGAAGGAAGCAGG - Intronic
1104629919 12:130391658-130391680 CAGCAGAATGGTAGGGAGGCTGG + Intergenic
1104661475 12:130613939-130613961 CAGCAGAGAGGGAGGGAGGCAGG + Intronic
1104786049 12:131448507-131448529 CAGGAGACGGGGAGGGAGGGAGG + Intergenic
1105069429 12:133225760-133225782 CAGAAGAGGGGGAGGGTGGCAGG + Intronic
1106181690 13:27374730-27374752 CAGAAAACTGAGAAGTAGGCAGG - Intergenic
1106415609 13:29543653-29543675 GAGAAGGGTGGGGAGGAGGCAGG + Intronic
1107095765 13:36533429-36533451 CAAAATGCTGGGCAGGAGGCTGG - Intergenic
1107749142 13:43545585-43545607 CAGAAAACAGGGAGAGAGGCAGG - Intronic
1107750351 13:43558465-43558487 CAGAACACTCTGAAGGAGCCAGG + Intronic
1107785219 13:43948983-43949005 CAGAAAACTGGGAATAAGGGAGG + Intergenic
1108213233 13:48159041-48159063 GTGAGGACTGAGAAGGAGGCAGG + Intergenic
1108853853 13:54768960-54768982 CAAAAGAGTGGGAAGAAGGAAGG - Intergenic
1110233525 13:73192253-73192275 CCGGAGAGTGAGAAGGAGGCAGG - Intergenic
1110323001 13:74181384-74181406 CAGAAAATTGAGAATGAGGCTGG + Intergenic
1110619741 13:77581936-77581958 AAGAAGACTGGGAGGCAGGGAGG + Intronic
1112108444 13:96267785-96267807 GAGAGGACAGGGAAGTAGGCAGG + Intronic
1112109242 13:96276251-96276273 CAGAAGACAGGGCTGGAGGGAGG - Intronic
1112386762 13:98946870-98946892 AAGAAGAGTTGGAAGAAGGCAGG - Intronic
1112507918 13:99985998-99986020 CAGAAGACTGGGAACAGGGTGGG - Exonic
1113059250 13:106303501-106303523 CAGAAGACTGAGCAGGTGGAGGG + Intergenic
1113781638 13:112980777-112980799 CAGTGGACTCGGAGGGAGGCTGG - Intronic
1114313434 14:21488757-21488779 CAGGTGACTGGGCAGGTGGCAGG - Exonic
1114429006 14:22644573-22644595 CAGAAGACTGGAGAGGGTGCAGG - Intergenic
1114473043 14:22976942-22976964 TAGAAAACTGTTAAGGAGGCAGG - Intronic
1114786225 14:25603014-25603036 GAGAAGACTGGGAAGGAAAATGG + Intergenic
1114843236 14:26290769-26290791 CATAAGATTTGGAAGGAGCCAGG - Intergenic
1114953286 14:27784296-27784318 CAGCATACTGGGAGGAAGGCAGG + Intergenic
1115315762 14:32023301-32023323 CAAAACACTGGGAAGGAAGGAGG + Intergenic
1115318046 14:32046941-32046963 CAGAAAAATGTGAAGGAGGAAGG + Intergenic
1118255114 14:64199098-64199120 CAGGTGCCTGGGGAGGAGGCTGG - Intronic
1118384335 14:65243275-65243297 GAGAGGACTGAGAAGTAGGCAGG + Intergenic
1118411123 14:65479541-65479563 AAGAAGAAAGGGAAGGAGGGAGG - Intronic
1119025518 14:71149250-71149272 GAGAAGGCTTGGAGGGAGGCAGG + Intergenic
1119386764 14:74262093-74262115 CAGAAGGATGGGAAAAAGGCTGG + Exonic
1119458927 14:74781816-74781838 CAGAAGACAGGGAAGGTGGGGGG - Exonic
1119491603 14:75038948-75038970 CAGGAGAATGGCATGGAGGCAGG - Intronic
1120290472 14:82563663-82563685 AAGAAGAGTGGGAGGGAGGCAGG + Intergenic
1120818527 14:88889786-88889808 CTGAAGATTGAAAAGGAGGCAGG + Intergenic
1121042310 14:90759114-90759136 CAGAAGAGCAGGAAGGAAGCTGG - Intronic
1121450566 14:94004555-94004577 CAGAGGACTGGGAAGGGGCATGG - Intergenic
1121519485 14:94576355-94576377 GAGAAGGCTGGGAAGGAGGTGGG - Intronic
1121611342 14:95282939-95282961 CAGAGGACTGGGGAGGGGGAGGG + Intronic
1121765133 14:96479501-96479523 CAGAAGGCTGGGAAAGGGTCTGG - Intronic
1121891014 14:97590550-97590572 AGGAAGAGTGGGAAGGAGGAAGG + Intergenic
1122402695 14:101476623-101476645 CATAGGTGTGGGAAGGAGGCAGG + Intergenic
1122818356 14:104326494-104326516 CAGAAGGCAGGGCAGGGGGCAGG - Intergenic
1122981346 14:105193598-105193620 CTGAAGCCTAGGAAGAAGGCAGG - Intergenic
1123159551 14:106264655-106264677 CAGAAAAGTGTGCAGGAGGCCGG - Intergenic
1123181666 14:106477137-106477159 CAGTAGACAGGAAAGGAGGCTGG - Intergenic
1202945238 14_KI270726v1_random:19591-19613 CAGTAGACAGGAAAGGAGGCTGG + Intergenic
1124102888 15:26712390-26712412 CAGAAGAGCAGCAAGGAGGCTGG + Intronic
1124929071 15:34101558-34101580 AAAAAGGCTGGGATGGAGGCCGG - Intronic
1125605929 15:40939885-40939907 CAGGAGACAGGGCAGGAGGGAGG + Intergenic
1125775103 15:42205561-42205583 CAGAAGACAGGGAAGAAATCAGG + Intronic
1125909400 15:43422537-43422559 GAGAAGACAGGGAAGGAGGTAGG + Intronic
1126046671 15:44648215-44648237 CAGAATAGTAGGAAGCAGGCTGG + Intronic
1126451126 15:48810721-48810743 CAGCAGCCTGGAAACGAGGCGGG + Intronic
1126664701 15:51065954-51065976 CAAAAGACAGGGAAGGTGGGAGG + Intronic
1127660775 15:61098177-61098199 AAGGAGACAGGGAGGGAGGCAGG - Intronic
1128259286 15:66221296-66221318 CAGGAGTGTGGGAGGGAGGCAGG - Intronic
1128384183 15:67135326-67135348 CAGGGGACTGTGAAGGGGGCAGG - Intronic
1128417454 15:67459661-67459683 CAGCAGACAGGGCAGGAGTCAGG - Intronic
1129224150 15:74156684-74156706 CAGGAGACAGAGAAGGAAGCTGG + Intergenic
1129255065 15:74329796-74329818 TAGAAGATGGGGAAGGAGGAGGG + Intronic
1129419513 15:75412825-75412847 CTGAAGGCTGGGAAGGATGTTGG + Exonic
1129920943 15:79318689-79318711 CACTAAACTGGGAAGGAAGCAGG - Intronic
1130530892 15:84747714-84747736 CAGAAGGCTGGGAGGGTGACCGG - Intergenic
1130961218 15:88659734-88659756 CAGAACACTGGACAGGAAGCTGG - Intergenic
1131310667 15:91287396-91287418 CAGAAAGGTGGGAAGGAAGCAGG - Intronic
1131792069 15:95975800-95975822 CAGAAAAGAGGGAAGGAGGAAGG + Intergenic
1132115071 15:99130149-99130171 CAGACGCCTGTGAAGGATGCTGG + Exonic
1132311764 15:100862452-100862474 CTGCACACTGGGCAGGAGGCAGG + Intergenic
1132359594 15:101201482-101201504 CAGAAGGATGGGAAGGAGTTAGG - Intronic
1132610630 16:814208-814230 CAGGAGAGTGGGAAGGAGGCCGG + Intergenic
1132696093 16:1202601-1202623 CATAAGAAGGGGAAAGAGGCAGG + Intronic
1132789383 16:1677144-1677166 AAGAAAACAAGGAAGGAGGCCGG + Exonic
1132906548 16:2285448-2285470 CAGCAGACTGGGGATGAGGAAGG + Exonic
1132923168 16:2410797-2410819 CAGCAGACTGGGAATGAGGAAGG - Intergenic
1133062560 16:3184067-3184089 CAGGAGACTAGGAAGGCGGAGGG - Intergenic
1133063099 16:3188209-3188231 CAGGAGACTAGGAAGGCGGAGGG + Intergenic
1133340244 16:5031264-5031286 CAGAATACTGGGATGGGGACAGG - Intronic
1133836951 16:9376090-9376112 CAGAAGCCTGAGAAAGGGGCAGG - Intergenic
1134392587 16:13833174-13833196 CAGAAGGGAGGAAAGGAGGCAGG - Intergenic
1134462242 16:14439413-14439435 AAGAAGACAGGGAGGGAGGGAGG + Intronic
1134799683 16:17071956-17071978 CAGAAGGCAGGGAGGGAGGGAGG - Intergenic
1134866337 16:17610695-17610717 AAGAAGAAAGGGAAGGAGGGAGG - Intergenic
1135494523 16:22939883-22939905 CAGAAGAGTGGGAATGTGGGAGG + Intergenic
1135494533 16:22939934-22939956 CAGAAGAGTGGGAATGTGGGAGG + Intergenic
1135588391 16:23688682-23688704 CAGAAGATGGGGATGCAGGCAGG - Exonic
1135637267 16:24088881-24088903 CATAAGACTGGGGCGGAGGAGGG + Intronic
1136267198 16:29128746-29128768 CAGTGGAGGGGGAAGGAGGCTGG + Intergenic
1136370564 16:29833604-29833626 AATAAGACTGGGGTGGAGGCCGG - Intronic
1136481689 16:30546000-30546022 CAGTAGGCTGGGCAGGAGCCTGG + Intronic
1137071584 16:35908871-35908893 CAGTAGGCTGGGTAGGAGCCTGG + Intergenic
1137269936 16:46896683-46896705 CAGATGTGTGGGAGGGAGGCAGG - Intronic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1137700413 16:50493921-50493943 CAGAAGCCAGGGATGGAGCCTGG + Intergenic
1137871542 16:51954637-51954659 CAGAAGAAAAGGAAGGAGGAAGG - Intergenic
1138291715 16:55853738-55853760 GAGAAGCCTGGGAGGCAGGCTGG - Intronic
1138361090 16:56427787-56427809 GAGAGGACTGGGAAGGAGGCAGG + Intergenic
1138646954 16:58432495-58432517 CAGAGGCCTGGCAAGGTGGCAGG + Intergenic
1139303143 16:65962084-65962106 AAGAAGGGAGGGAAGGAGGCAGG + Intergenic
1139429448 16:66903404-66903426 CACGAGGCTGGGAAGTAGGCAGG + Intergenic
1140357580 16:74319429-74319451 CATCTGAGTGGGAAGGAGGCTGG - Intergenic
1140814126 16:78604907-78604929 AAGAAGACAGGGAGGGAGGGAGG - Intronic
1141199123 16:81883597-81883619 GAGAAGACTGAGAAGATGGCAGG + Intronic
1141326857 16:83068576-83068598 CAGAAGAATGGTCAGGTGGCTGG - Intronic
1141421171 16:83917511-83917533 CAGAAGACAGAGAAGGGGCCTGG - Exonic
1141431583 16:83973020-83973042 CAAAACCCAGGGAAGGAGGCAGG - Intronic
1141574991 16:84958102-84958124 TGGAAGGCTGGGAAGGAAGCAGG + Intergenic
1141581937 16:85005221-85005243 AGGAAGACAGGGAAGGAGGTTGG - Intronic
1141808462 16:86357940-86357962 CAGAAGCCAGGGAATGAGCCTGG + Intergenic
1142070490 16:88089069-88089091 CAGTGGAGGGGGAAGGAGGCTGG + Intronic
1142675633 17:1511636-1511658 GAGAAGACTGGGGAGGAAGTAGG - Intronic
1143303506 17:5928292-5928314 CAGAAGCCTGAGCAGCAGGCTGG + Intronic
1143510621 17:7393581-7393603 CAGGTGAGTGGGAAGGAGGGAGG - Exonic
1143705913 17:8697634-8697656 CAGAAGGCTGGGAGAGAGGCTGG - Intergenic
1143794586 17:9326416-9326438 TAGAAAACAGGGAAGGAAGCTGG - Intronic
1143995238 17:11000978-11001000 CAGAAAACTATGAAGAAGGCAGG - Intergenic
1144154183 17:12482436-12482458 CAGAAGCCTGGGGAAGAGGAGGG + Intergenic
1144313871 17:14040084-14040106 CAAAAGCCTGAGAAGGAGGTGGG - Intergenic
1144631326 17:16873937-16873959 CAGAAGCCAGGGAAGGGGCCAGG - Intergenic
1144649274 17:16997337-16997359 CAGAAGCCAGGGAAGGGGCCAGG + Intergenic
1145846394 17:28042206-28042228 AATAAGCCAGGGAAGGAGGCTGG - Exonic
1146055065 17:29576831-29576853 CAGGGGAGTGGGAAGGAGGGTGG + Intronic
1146179306 17:30687102-30687124 AAAAAGACTGTGAAGGAGGAAGG - Intergenic
1146189971 17:30756475-30756497 CAGCACTTTGGGAAGGAGGCAGG - Intergenic
1146334872 17:31960824-31960846 CAGCACTTTGGGAAGGAGGCAGG - Intronic
1146371627 17:32268130-32268152 CAGCAGAGTAGGGAGGAGGCAGG - Intronic
1146372940 17:32276554-32276576 CAGAAGACGAGTAATGAGGCAGG + Intronic
1146685880 17:34841331-34841353 CAGATGGCAGGGAAGCAGGCAGG - Intergenic
1147947293 17:44087254-44087276 AAGGGGAGTGGGAAGGAGGCCGG - Intronic
1148018696 17:44539788-44539810 GAGGAGACTGGGGAGGAGGGAGG + Intergenic
1148150027 17:45391440-45391462 CAGGGGAAAGGGAAGGAGGCAGG + Intergenic
1148241020 17:45999324-45999346 CACAAGACTGTGCAGGTGGCCGG + Exonic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148733327 17:49851069-49851091 CGGAAGGCTGGGAGGGAGGCAGG + Intergenic
1148733710 17:49852648-49852670 TGGAAGGCTGGGAGGGAGGCAGG + Intergenic
1148897211 17:50845887-50845909 CAGGAGCCTGGGAGGCAGGCAGG - Intergenic
1148958045 17:51370137-51370159 CAGAGGGCTGGAAAGCAGGCTGG + Intergenic
1149382200 17:56105528-56105550 CAGGAGGCAGGGAAGGAGGGAGG - Intergenic
1149994324 17:61399110-61399132 CGGAAGACTCGGAAGGAACCTGG - Intergenic
1150149614 17:62798528-62798550 ATAAAGACTGGGAAGGAGCCCGG + Intronic
1150309839 17:64119064-64119086 CAGGATACTGTGAAGGAGCCTGG + Intronic
1151151182 17:72088730-72088752 AAGAAGACAGGGAAGGAAGGTGG - Intergenic
1151351815 17:73536416-73536438 CGGAAGCCTCGGAAGGAGGCTGG - Intronic
1151544638 17:74785347-74785369 CTGTAGACAGGGAAGGAGGCAGG - Intronic
1151690123 17:75678776-75678798 CAGAAGACTCGGGAAGAGCCGGG + Intronic
1151793517 17:76325696-76325718 CAGGAGAATGGCATGGAGGCAGG - Intronic
1151809336 17:76428178-76428200 CAAAAGACTGGGAATGAAGATGG - Intronic
1151980921 17:77507928-77507950 CAGCAGCCTGGGAATGGGGCAGG + Intergenic
1152124644 17:78439003-78439025 CAGAAGGCCCGGAAGGAAGCAGG - Intronic
1152157346 17:78643580-78643602 CAGCAGACTGGCAAGAAGCCGGG - Intergenic
1152168226 17:78724702-78724724 CAGGAGACTGGAAAGGAGGGAGG - Intronic
1152238174 17:79149221-79149243 CAAAGGCCTGGGAAGGTGGCAGG + Intronic
1152289240 17:79429457-79429479 CAGCAGGCTGGGCAGGAGGAGGG + Intronic
1152380857 17:79941689-79941711 GGGAACACTGAGAAGGAGGCTGG - Intronic
1152605901 17:81289909-81289931 CAGGAGACTGGGATGGAGCGGGG - Intronic
1152892439 17:82890279-82890301 CAGGAGAGTGGGACAGAGGCCGG + Intronic
1152922303 17:83072245-83072267 CAGGAGTCAGGGCAGGAGGCTGG - Intergenic
1152938486 17:83153831-83153853 CAGACATCCGGGAAGGAGGCAGG - Intergenic
1153387238 18:4511319-4511341 GGGAGAACTGGGAAGGAGGCTGG - Intergenic
1153823886 18:8856885-8856907 GAGAAGACTGGGAGGCAGGACGG + Intergenic
1154073469 18:11176946-11176968 CAGGAGAGGAGGAAGGAGGCAGG - Intergenic
1154261098 18:12833543-12833565 CAGAAGAATGGGAGGGAGTTAGG + Intronic
1154355288 18:13619876-13619898 GAGCAGACTGTGTAGGAGGCTGG - Intronic
1155146319 18:23086634-23086656 CAGCAGGCAGGAAAGGAGGCTGG - Intergenic
1155263937 18:24073314-24073336 CAGGTGGCTGGGAAAGAGGCAGG - Intronic
1156399124 18:36724915-36724937 GAGAAGCCTGGGAAGCAGCCAGG - Intronic
1156752709 18:40478901-40478923 GAGAAGACTAGGAAAGAGGAAGG - Intergenic
1157972460 18:52285944-52285966 CAGAACACCAGGAAGGAGGGAGG + Intergenic
1158287026 18:55895116-55895138 GAGAAGACTCTGAAGGAGGAAGG + Intergenic
1160163887 18:76494528-76494550 CAGCAGACTGGCAAGCAGCCGGG + Intronic
1160244617 18:77146996-77147018 GAGAAAACTGGGCAGGAGGTGGG + Intergenic
1160293530 18:77617093-77617115 CTGAAAAGTGGGAAGAAGGCAGG - Intergenic
1160362252 18:78293829-78293851 CAGAATCCTGGCAAGCAGGCGGG + Intergenic
1160540583 18:79618006-79618028 TAGAAAACGAGGAAGGAGGCGGG + Intergenic
1160544156 18:79641825-79641847 CAGGAGGCTGGGAGGGAGCCTGG - Intergenic
1160665659 19:326846-326868 CAGAGGCTTGTGAAGGAGGCCGG + Intronic
1160888007 19:1360959-1360981 CAGAGGCGTGGGAGGGAGGCGGG - Exonic
1161253288 19:3292972-3292994 CAGAGGGCTTGGAAGGAGGCAGG + Intronic
1161491915 19:4566947-4566969 CAGAAAGCTGGGAGTGAGGCTGG - Intergenic
1161654545 19:5506103-5506125 CAGAAGTCAGTGAAGGAGGCCGG - Intergenic
1161768253 19:6218340-6218362 CAGGGTACTGGGAGGGAGGCTGG + Intronic
1162535498 19:11261351-11261373 AAGAAGACAGGGAAGGGGGATGG - Intronic
1162748414 19:12812708-12812730 TAGAAGAGCGGCAAGGAGGCCGG + Intronic
1162921588 19:13906372-13906394 CAGAGCCCGGGGAAGGAGGCAGG + Exonic
1162979319 19:14228467-14228489 AAAAAGACTGTGAAGGAGGAAGG + Intergenic
1163620662 19:18357866-18357888 AGGAAGACTGAGATGGAGGCTGG - Intronic
1163685105 19:18708169-18708191 CAGGAGGCAGGGAAGGAGGAAGG + Intronic
1163720071 19:18894619-18894641 CTGGAAACTGGGAAGAAGGCAGG + Intronic
1163779710 19:19239922-19239944 CAGAGGAATGGGAGGGAGGAAGG - Intronic
1164076795 19:21826589-21826611 CAGCACTTTGGGAAGGAGGCAGG + Intronic
1164237035 19:23346321-23346343 CAGTAGGCTGGGCAGGAGCCTGG - Intronic
1164459394 19:28434425-28434447 CAGAAAAGTGGGAAAGAGGTGGG + Intergenic
1164648648 19:29876377-29876399 CAGGAGACACAGAAGGAGGCTGG - Intergenic
1164677010 19:30107602-30107624 TGCAAGACAGGGAAGGAGGCGGG - Intergenic
1164837762 19:31368977-31368999 CTGAACACTGGGAATGAGGCTGG - Intergenic
1164857364 19:31535556-31535578 CAGGTGATGGGGAAGGAGGCAGG - Intergenic
1164888099 19:31800520-31800542 CAGAAGTCTGGGGAGGGTGCGGG - Intergenic
1165213138 19:34251375-34251397 CTTAAAACTGGGAGGGAGGCCGG + Intergenic
1165388797 19:35526915-35526937 CACGAGGCCGGGAAGGAGGCAGG - Exonic
1165477694 19:36040713-36040735 AGGAAGACCAGGAAGGAGGCTGG - Intronic
1165561987 19:36687798-36687820 GAGAAGGCTGGGAGGGAAGCAGG + Intronic
1165933853 19:39377375-39377397 CAGAAGGCTGGGTAGGACCCTGG - Intronic
1165947314 19:39451988-39452010 CAGGAGAGTAGGGAGGAGGCTGG + Intronic
1166300018 19:41908003-41908025 CTGGAGCCTGGGGAGGAGGCCGG + Intronic
1166678485 19:44753795-44753817 CAGAAACCTGGGGAGGGGGCAGG + Intronic
1166728183 19:45041576-45041598 CAGCAGACCAGGGAGGAGGCTGG - Intronic
1166784555 19:45359733-45359755 CAGGAGACTGGGTGGCAGGCAGG - Intronic
1167145072 19:47676498-47676520 CAGAAGAGGGAGAAGGAGGAAGG - Intronic
1167672143 19:50859463-50859485 CAGGAGCCTGTGAGGGAGGCTGG - Intronic
1167674896 19:50877889-50877911 CAGGAGACTGTGAGGGAGGCTGG - Intronic
1167772328 19:51529137-51529159 CAGAAGCCAGGGAAGGAGCATGG + Intronic
1168236869 19:55069097-55069119 CAGAGACCTGGGAAGGAGCCAGG + Intronic
1168247340 19:55119022-55119044 CTCAAGATTGGGAAGGTGGCTGG + Intergenic
1168352823 19:55686337-55686359 CTCAGGACTGGGAGGGAGGCTGG + Intronic
1168435680 19:56315174-56315196 CGGAAGTCTGGGAATAAGGCGGG + Intronic
1168541839 19:57219262-57219284 AAAAAGACTGGGCAGGAGGTAGG - Exonic
1168561034 19:57383513-57383535 CAGAAGAATGGGATGGTGGGGGG - Intronic
1168630259 19:57950626-57950648 AAGAAGCATGGGAAGGAGGCCGG - Intergenic
1168686548 19:58352635-58352657 CATAAGACTGTGAAGGAGACAGG + Intronic
925025241 2:602085-602107 AAGAAGGCTGGGAAGCAGGCAGG - Intergenic
925048792 2:795529-795551 GGGAAGACGGGGACGGAGGCAGG + Intergenic
925101487 2:1250166-1250188 CAGAGGAAGGGGCAGGAGGCTGG - Intronic
925434705 2:3826940-3826962 AAGAAGAGAGGGAGGGAGGCAGG - Intronic
925819690 2:7787837-7787859 CAGATGACTGAGAAGCAGCCAGG + Intergenic
926148438 2:10411270-10411292 CAGGACAATGGGAAGGAGGTGGG + Intronic
926380824 2:12287583-12287605 TAGAGGACTGGGAAGGTGTCTGG + Intergenic
926687342 2:15708509-15708531 CAGGAGACTGGGAAACAAGCAGG - Intronic
927072752 2:19547858-19547880 CAGAAGAGTGGGAAGGAACAAGG + Intergenic
927507608 2:23624628-23624650 CAAAGGACTGGAAAGCAGGCTGG - Intronic
927880067 2:26684050-26684072 GAGAAGAAAAGGAAGGAGGCAGG - Intergenic
928220427 2:29398691-29398713 CTGGAAACTGGGAAGGAGGAGGG - Intronic
928419399 2:31126026-31126048 CAGATGACTGGGAATGTGTCTGG - Intronic
928434739 2:31247585-31247607 AAGATACCTGGGAAGGAGGCAGG - Intronic
929271866 2:39981471-39981493 GAGAAGAAGGGGTAGGAGGCTGG + Intergenic
929511688 2:42569397-42569419 CAGAAGACTGGGAAGGAGGCAGG - Intronic
930366542 2:50446493-50446515 AGGAAGACGGGGAAGGAGGGAGG - Intronic
931137687 2:59422467-59422489 AAGAAGAGAGGGAAGGAGGAAGG - Intergenic
932074481 2:68650302-68650324 CATGAGACTGGGAAGCAGTCTGG - Intronic
932079824 2:68703727-68703749 CTTATGACTGGGAAGAAGGCAGG + Intronic
932139897 2:69266240-69266262 TAGAAGACAGGAAAAGAGGCAGG + Intergenic
932231656 2:70088302-70088324 CAGATGACTGGGGAGCTGGCCGG - Exonic
932462348 2:71891182-71891204 CAGAAGGCTGGGAATGAAGTGGG + Intergenic
932539376 2:72636290-72636312 AAGAAGGCAGGGAGGGAGGCAGG + Intronic
932604577 2:73156651-73156673 CAGGAGACCAGGCAGGAGGCTGG - Intronic
933230287 2:79799203-79799225 AAGAAGAGGGGGAATGAGGCTGG - Intronic
933309942 2:80648044-80648066 CTGTAGCCTGGGAAGGAGACAGG + Exonic
933783226 2:85816393-85816415 CCCAAAACTGGGGAGGAGGCTGG + Intergenic
934112726 2:88757502-88757524 GGGAAGACTTGGAGGGAGGCTGG + Intergenic
934484036 2:94685153-94685175 CAGCACACTGGGAGGAAGGCAGG - Intergenic
934592002 2:95561993-95562015 CAGTAGAGAGGGAAGGTGGCTGG - Intergenic
935878783 2:107540192-107540214 CAGAACACTGGGCGGGAGGTTGG - Intergenic
936117242 2:109711986-109712008 CCGATGACAGGGAAGGAGCCAGG - Intergenic
936242658 2:110801222-110801244 GAGAGCACTGGGAAGGAGGAGGG + Intronic
936259088 2:110942972-110942994 AAGAAGAGTGGGAGGGAGGGAGG + Intronic
936492423 2:112983662-112983684 CAGGAGAGTGGTAAGAAGGCAGG + Intronic
937192086 2:120112070-120112092 AAGAAGACTGGGCAGGGGGCGGG - Intronic
938796861 2:134724874-134724896 CAGAAGACTGGGATGCAAGCAGG + Intergenic
939198077 2:138998260-138998282 CAGAGTACAGGGAAGGAAGCAGG + Intergenic
939401994 2:141706526-141706548 CAGAGGACTTGGAAGCAGGTTGG - Intronic
939650069 2:144748704-144748726 CAGAAGGCTGGTCAGGATGCGGG + Intergenic
940452419 2:153856267-153856289 CAGATGACTGGTAGGTAGGCAGG + Intergenic
940557488 2:155249349-155249371 CACATGACTGGGGAGGTGGCAGG + Intergenic
940754246 2:157663518-157663540 CAGACTACGGGGAAGGAGACTGG + Intergenic
941773289 2:169364864-169364886 CAGAAGAGGGGAAAGGAGGGAGG + Intergenic
941846918 2:170142488-170142510 TTGGAGACCGGGAAGGAGGCAGG - Intergenic
942046325 2:172101398-172101420 GAGATGGCTGGGAAGCAGGCGGG - Intronic
942149124 2:173057193-173057215 AAGAAGACTGGGATGGAATCAGG - Intergenic
942243879 2:173989813-173989835 CAGAGCACTGGGAGGGAGGGGGG - Intergenic
942552805 2:177137362-177137384 CAGAAGATGGGGAAAGGGGCTGG - Intergenic
943527198 2:189031221-189031243 AGGAAGCCTGGGAAGAAGGCAGG + Intergenic
944034569 2:195278211-195278233 CAGTGGACTGGGAGAGAGGCAGG - Intergenic
944361764 2:198865406-198865428 CAGAACACTGGCCTGGAGGCTGG - Intergenic
944497987 2:200328105-200328127 CAGCAGACTGGGAAGGGGTAGGG - Intronic
945520712 2:210823964-210823986 CAGAACACTGAGAAAGAGTCTGG + Intergenic
945915110 2:215695561-215695583 AAGAAGACTGATAAAGAGGCAGG + Intergenic
945984794 2:216344876-216344898 GAGCACTCTGGGAAGGAGGCCGG + Intronic
946056091 2:216903187-216903209 CAGAGGACTCAGAAGAAGGCAGG - Intergenic
946232738 2:218302597-218302619 GAGGAGACTGGGGAGGTGGCAGG + Intronic
946432736 2:219634158-219634180 CAGAAAACTGGACAGGAAGCAGG - Intronic
947181810 2:227418000-227418022 CAGAGGAATGGGTAGGAGGCAGG - Intergenic
947357835 2:229315699-229315721 CAGAAGTGAGGGAAGGAGCCAGG + Intergenic
947382583 2:229559627-229559649 CAGAAGAAAGGGAAGGAAGGAGG + Intronic
948180442 2:235975598-235975620 CACATGACTGGCAAGGAGTCAGG + Intronic
948336202 2:237209217-237209239 CAGAACACTCTGGAGGAGGCAGG - Intergenic
948676268 2:239598661-239598683 GAGAACACTGGGAAGGAGGGAGG - Intergenic
948866959 2:240780419-240780441 GAGAAGGCGGGGAAGCAGGCGGG - Intronic
1168752340 20:291695-291717 AAGGAGACTGAAAAGGAGGCAGG - Intergenic
1168797820 20:623181-623203 CACAAGACCAGGAAGGAGGGAGG - Intergenic
1168821276 20:775173-775195 CAGGAGCCTGGGAAGGAGGCTGG - Intergenic
1168861294 20:1047834-1047856 GAGATGAGTTGGAAGGAGGCAGG + Intergenic
1169308702 20:4517213-4517235 CAGAAGACTGGACAGGAGGTGGG - Intergenic
1170237780 20:14126871-14126893 CTGAGGACAGGGAAAGAGGCTGG - Intronic
1170270762 20:14524792-14524814 CTCAAGACCAGGAAGGAGGCTGG - Intronic
1170589745 20:17762741-17762763 CAGGAGCCTTGGAAGGAGGAGGG - Intergenic
1172102395 20:32493106-32493128 TACAAGCCTTGGAAGGAGGCTGG + Intronic
1172331807 20:34080629-34080651 CAGAAGACTGGGAGGCTGGTGGG - Intronic
1172692930 20:36803079-36803101 CTGAAGACAGGGAAGGGGGCCGG - Exonic
1172785465 20:37465465-37465487 GAGAAGAGGAGGAAGGAGGCGGG - Intergenic
1173552805 20:43945069-43945091 CAGAAGAGTGGAAAGGAACCAGG + Intronic
1173638234 20:44579880-44579902 CAGAAGACTGAGTAGGTGTCAGG - Intronic
1174412207 20:50343565-50343587 CAGGAGGCTCTGAAGGAGGCAGG + Intergenic
1174481402 20:50833831-50833853 CATTAGACAGGGAAGCAGGCCGG + Intronic
1174873824 20:54207437-54207459 CCAAAAACGGGGAAGGAGGCAGG + Intergenic
1174886657 20:54343087-54343109 AAGAAGGCAGGGAAGGAGGAAGG - Intergenic
1175005245 20:55674828-55674850 CAGAAGCCTAGGAAGGTGGATGG + Intergenic
1175305792 20:57974634-57974656 CTGAGGACTGGCAAGGAGGCTGG - Intergenic
1175345074 20:58267055-58267077 GAGAAGAATGGGATGGAGGAGGG + Intergenic
1175534841 20:59702323-59702345 CAAAAGAACAGGAAGGAGGCTGG - Intronic
1175594254 20:60217976-60217998 AAGAAGTCTGGGAAGGTGGCTGG - Intergenic
1175645579 20:60667792-60667814 AAGCAGGCTGGGAAGGAGGAAGG + Intergenic
1175979740 20:62732243-62732265 CCTAAGATAGGGAAGGAGGCAGG - Intronic
1176158670 20:63637176-63637198 CTGAAGGCTGGGCAGGAGGTGGG - Intergenic
1176719575 21:10382174-10382196 CAGAAGAGAGGGAGGGAGGGAGG + Intergenic
1176957623 21:15124324-15124346 CAGGAGACAGGGAAGAAGGAGGG + Intergenic
1178131303 21:29575312-29575334 CAGAAGGGTGGGAGGGTGGCAGG + Intronic
1178143464 21:29710880-29710902 AAGAAGAAAGGGAAGGAGGGTGG - Intronic
1178321950 21:31612676-31612698 CAAAAGAAGGGGAACGAGGCAGG - Intergenic
1178718686 21:34989499-34989521 CAGAAGCCTGGGAAAGACCCTGG - Intronic
1178752964 21:35321726-35321748 CAGAAGCCTGGGTCTGAGGCTGG - Intronic
1179109457 21:38433899-38433921 CAGAGGATTAGGAAGGAGGATGG - Intronic
1179288042 21:39994988-39995010 CTGAAGACTGGGTAGGAGTTAGG + Intergenic
1179902405 21:44401012-44401034 GAGGAGAAAGGGAAGGAGGCAGG - Intronic
1180300812 22:11035148-11035170 CAGAAGAGAGGGAGGGAGGGAGG + Intergenic
1180731120 22:17983314-17983336 TAAAAGAGTGGGAAGGATGCTGG - Intronic
1180978922 22:19869576-19869598 CTGAGGACTGCGAAGGACGCTGG - Intergenic
1181094834 22:20497789-20497811 TAGAAACCTGGGAAGGAAGCAGG + Intronic
1181506284 22:23360437-23360459 GAGAAGCCTGGGAGGCAGGCTGG - Intergenic
1182151986 22:28034347-28034369 AAGCAGACTGGGAAGAAGACAGG - Intronic
1182294542 22:29305373-29305395 GAGAAGACAGGGATGGAGCCGGG - Intergenic
1182347014 22:29673503-29673525 CACCAGACTGGCGAGGAGGCTGG + Intronic
1182752601 22:32653879-32653901 CAAAAGGCTGGAAAGGAAGCAGG - Intronic
1183307228 22:37089184-37089206 CAGAAGCCTGGGAAGCAGAGAGG + Intronic
1183386004 22:37514991-37515013 CAGCAGCGTGGGAAGGGGGCTGG + Intronic
1183792849 22:40087776-40087798 CTGGAGACTGAGAGGGAGGCAGG + Intronic
1183832576 22:40426196-40426218 CAGATGAGTGGGAAGGAAGCGGG - Intronic
1183959726 22:41404152-41404174 CAGAAGCCTGGGAGGAAGGGAGG + Intergenic
1183998786 22:41656697-41656719 CAGAAGACTGCAAGGGAGGAGGG - Intronic
1184015526 22:41783078-41783100 CAGAGGACAGGGAAGGTGGGTGG - Intronic
1184088979 22:42282684-42282706 CAGAGACCTGGGAGGGAGGCCGG + Intronic
1184146781 22:42616405-42616427 AAGAGGTCTGGGAAGGAGCCCGG - Intergenic
1184151316 22:42640747-42640769 GAGAAGGCTGAGGAGGAGGCAGG - Intronic
1185008797 22:48301548-48301570 CACAAGACTGAAGAGGAGGCCGG - Intergenic
1185081658 22:48712788-48712810 CACAGGAATGGGAAGGAGGGCGG - Intronic
1185422111 22:50740552-50740574 CTGTAGACTGGGAAGGGGACCGG + Intronic
950116181 3:10451445-10451467 CAGTAAACTGGGAAGTAGTCAGG - Intronic
950117671 3:10461956-10461978 CAGGAGAGTGGGAAGAAGGAAGG - Intronic
950406779 3:12809955-12809977 CATAATCCTGGGAAGGAGGCCGG + Intronic
950406816 3:12810088-12810110 CAGCAGACAGTGCAGGAGGCTGG - Exonic
950630130 3:14276710-14276732 CCGATGGCTGGGAAGGGGGCTGG + Intergenic
950654341 3:14427467-14427489 CAGAGGCCTGGGAAGGAAGGCGG - Intronic
951355834 3:21665642-21665664 CTCATGACTGGGAGGGAGGCAGG - Intronic
952194003 3:31053484-31053506 CAGGAGACTGGTAAGGGGGCTGG - Intergenic
952221539 3:31328426-31328448 CAGGAGAAAGGGAAGGGGGCAGG + Intergenic
952750166 3:36818396-36818418 AAGAAGTCAGGGAAGGAAGCAGG + Intergenic
952794376 3:37225841-37225863 CAGATAACTGGGAAGGATCCTGG + Intergenic
953141784 3:40235801-40235823 CAGATGTCTGGAAAGGAGGAAGG + Intronic
953154318 3:40355080-40355102 GAGAAGACTGGGGAGGAAACGGG + Intergenic
953292191 3:41676826-41676848 CAGCATACTGGGCAGGAAGCAGG - Intronic
953451262 3:43008375-43008397 CAGAGGACTAGGAAGGAGGCAGG - Intronic
954035597 3:47849386-47849408 CTGCAGACAGGGAAGGAGGCTGG - Intronic
954584588 3:51722257-51722279 CTCAACAATGGGAAGGAGGCAGG + Intergenic
954867234 3:53740038-53740060 CACAAGACTGGGAAGCAAGTCGG + Intronic
955368483 3:58331802-58331824 CAGTAGACTGGGAAGGGGCTTGG - Intergenic
955909709 3:63847439-63847461 CAGAAGAATGAAAAGAAGGCCGG + Intronic
956419991 3:69077867-69077889 CTGGAGACTGGGAAGGTCGCTGG - Exonic
956626111 3:71268411-71268433 CAGAAGACTGGGAAAGTTGGGGG + Intronic
956823814 3:72978353-72978375 AAGAATACTGGGAAGAAGGTGGG + Intronic
956838775 3:73117700-73117722 AAGAAGAGAGGGAAGGAGGGAGG - Intergenic
957048472 3:75394514-75394536 CAGCAGACTGGGAATAAGACAGG + Intergenic
957825886 3:85443412-85443434 CAGAGAAATGGGAATGAGGCTGG - Intronic
958017969 3:87964736-87964758 CAGAGGACTGGAAAGGAAACTGG - Intergenic
958888700 3:99758672-99758694 GAGAAGACTGGGAACCAGGAAGG + Intronic
960223401 3:115143860-115143882 CAGAAGTTTGAGAAGGAGGAAGG - Intronic
960473589 3:118096742-118096764 CAGAAGGCTGGGAAGGTGGGAGG - Intergenic
961432763 3:126894683-126894705 CAGCAGACGGAGCAGGAGGCTGG + Intronic
961462786 3:127063226-127063248 GCGAGGACAGGGAAGGAGGCCGG - Intergenic
961812461 3:129529692-129529714 CAGGAGACTTGGAACGCGGCAGG - Intronic
961880553 3:130058627-130058649 CAGCAGACTGGGAATAAGACAGG + Intergenic
962006704 3:131356932-131356954 CAGGTGACTGGGCAGGAGACAGG + Intergenic
962051625 3:131821811-131821833 CAGAGGTCTGGGAAGCAGGAAGG - Intronic
963112875 3:141701270-141701292 CAGTAGGCTGGGCAGGAGCCTGG + Intergenic
963156289 3:142100671-142100693 GTGAAGAAAGGGAAGGAGGCAGG - Intronic
963837338 3:150070482-150070504 CAGCAAACTGGCAGGGAGGCAGG - Intergenic
964321321 3:155500715-155500737 CAGAGTACTGGCAAGGAGGGTGG - Exonic
964556583 3:157946135-157946157 CAGAAGAGGGGGAGGGAGGGAGG + Intergenic
964604166 3:158541215-158541237 CTGAAGACTTAGAAGGAGCCAGG - Intronic
965742794 3:171893843-171893865 AAGGAGAGAGGGAAGGAGGCAGG - Intronic
966826343 3:183968031-183968053 CAGCAGAATAGGAAAGAGGCTGG - Intronic
966834500 3:184038671-184038693 AGGGAGACAGGGAAGGAGGCAGG - Intronic
966843294 3:184106389-184106411 AGGGAGACAGGGAAGGAGGCAGG - Intronic
967183365 3:186925790-186925812 CACAAGACTGGGAGGATGGCTGG - Intergenic
967260271 3:187634849-187634871 CAGAAGCCTGGGAGGGAAGAAGG - Intergenic
967377282 3:188818850-188818872 CAAAAGCCTGGGAAGGAAGCTGG - Intronic
967647793 3:191947517-191947539 AAGAAGACAGGGAAAGAGGAGGG + Intergenic
968267320 3:197372327-197372349 CAAAAGACAGGCCAGGAGGCTGG + Intergenic
968361167 3:198147937-198147959 CAGGAGGCTGGGGAGGAGTCAGG + Intergenic
968773742 4:2526031-2526053 CAGGAGAATGGCATGGAGGCAGG + Intronic
968992945 4:3926971-3926993 CAGCAGACTGGGAATAAGACAGG + Intergenic
969139429 4:5055671-5055693 CAGACGAGCAGGAAGGAGGCAGG - Intronic
969294880 4:6263933-6263955 GGGAACACTGGGAAGGAGGGAGG + Intergenic
969475149 4:7418118-7418140 CAGAAAAAAGGGAAGGAGGAAGG - Intronic
969608840 4:8216055-8216077 CAGAAGAGGGGCAGGGAGGCAGG - Intronic
969822530 4:9731390-9731412 CAGCAGACTGGGAATAAGACAGG - Intergenic
969889163 4:10243689-10243711 CAGCAGACTGTGAGGGAGACTGG + Intergenic
971453547 4:26822448-26822470 CAGCACACTGGGAAGAAAGCAGG - Intergenic
972239750 4:37177631-37177653 CTGAAGACTGGGTAAGAGGTGGG + Intergenic
973547483 4:51996092-51996114 CAGATGAATGGGAGGAAGGCGGG + Exonic
973588983 4:52420932-52420954 CAGAAGACAGGGAAGGCAGTAGG + Intergenic
973788072 4:54352822-54352844 CAGAAGGGTGGGAGGGTGGCAGG - Intergenic
973795409 4:54420499-54420521 CAGAAGAATGGGTAGGAATCAGG - Intergenic
975523101 4:75321251-75321273 CAGAGGGCTGGGAAGGATGATGG - Intergenic
976358810 4:84153540-84153562 CAGAACACTGGAAACTAGGCGGG - Intergenic
977258313 4:94764892-94764914 GGGAGGACTGGGAAGGGGGCAGG + Intronic
977313750 4:95418907-95418929 CTGAAGTCGGGGCAGGAGGCAGG - Intronic
977525763 4:98143500-98143522 CGGAAGCCTGGGGAGGAGGCGGG + Intergenic
977577000 4:98685376-98685398 CAGTAGAGTAGGAAGGAGCCGGG - Intergenic
977709990 4:100113912-100113934 GAGAAGAATGGGCAGGAGACAGG - Intergenic
978153960 4:105468650-105468672 GAGATGAATGGGTAGGAGGCTGG + Intronic
978483745 4:109226221-109226243 CAGAAGAATGGGAGGTAGGAGGG + Intronic
978770995 4:112456409-112456431 CAGGTGACTGGGCAGGTGGCAGG - Intergenic
981090144 4:140723628-140723650 TTAAAGACTGGGAAGTAGGCCGG - Intronic
981094298 4:140762644-140762666 AAGAAGACAGGGAGGGAGGGAGG - Intergenic
981864013 4:149392673-149392695 CAGAAGCCTGGAAAGAAGCCAGG + Intergenic
982105417 4:152007879-152007901 CAGAACACAGGAAAGGCGGCAGG - Intergenic
982129450 4:152214695-152214717 CAGAAGACTGGGATGAGGGGTGG + Intergenic
982396885 4:154923423-154923445 CAGAAAAGTGGGAAAGGGGCCGG + Intergenic
983226846 4:165093664-165093686 CACAAAACTGATAAGGAGGCTGG - Intronic
983274977 4:165605782-165605804 CAGAATACAGAGAAGGAGGAAGG + Intergenic
984167453 4:176319928-176319950 CGGAGGACCGGAAAGGAGGCGGG + Intergenic
984496919 4:180510296-180510318 TAGAAGACTGGGATGCAGACTGG - Intergenic
985096406 4:186416933-186416955 CAGGAGACAGAGAAGGAAGCTGG + Intergenic
985273406 4:188216174-188216196 AAGGAGACAGGGAAGGAGACAGG - Intergenic
985273412 4:188216198-188216220 AAGGAGACAGGGAAGGAGGGAGG - Intergenic
985282630 4:188302081-188302103 TAGAAGACAGTGTAGGAGGCGGG + Intergenic
985622393 5:962453-962475 CAGATGCCAGGGAAGGAGCCTGG + Intergenic
985706475 5:1404214-1404236 CGGAGGACTGGGATGGGGGCTGG + Intronic
985769231 5:1798753-1798775 CAGCAGATGGGGCAGGAGGCCGG + Exonic
986602762 5:9489963-9489985 CAGAAGACATGGAAGTTGGCAGG + Intronic
986824070 5:11501711-11501733 CATAAGAAGGGGCAGGAGGCTGG + Intronic
986943455 5:12985505-12985527 GAGTAGACTGAGAAGGAGGAGGG - Intergenic
987492171 5:18595030-18595052 TTGAAGACTGAGAAGAAGGCAGG - Intergenic
987557263 5:19469691-19469713 CAGAAATCTGGGTAGGAGGAGGG - Intergenic
987940126 5:24523077-24523099 CAGAAAACGGGGATGGGGGCAGG + Intronic
988529101 5:32011651-32011673 CAGGAGAGTGGGAAGGAGGAAGG - Intronic
988669205 5:33362796-33362818 CTGCAGTCTGAGAAGGAGGCAGG + Intergenic
989272598 5:39550544-39550566 CAGAAGAGAGGGAAGGAAGGAGG + Intergenic
989510864 5:42286515-42286537 GAGAAGACAGAGAAGGAAGCAGG + Intergenic
990425401 5:55683030-55683052 AAGAAGAGAGGGAAGGAGGCAGG + Intronic
990938065 5:61171984-61172006 CAGAAGATTTGTAAGGAGCCTGG - Intergenic
990977915 5:61575237-61575259 CAGATGCCTGGGCTGGAGGCGGG - Intergenic
991117808 5:62974332-62974354 CAGAAGATTGGGTGGGAGGGAGG - Intergenic
991215577 5:64154886-64154908 CAGCTGCCTGGGAAGGGGGCAGG - Intergenic
991309463 5:65220447-65220469 CAGAAGAGTGGGAATTAGCCGGG + Intronic
992729121 5:79640317-79640339 TAGAAGAATGGGATGGAGGGTGG + Intronic
993184686 5:84602034-84602056 CTGAAGTCTGGAAAGGAGGACGG - Intergenic
993786287 5:92141840-92141862 CAGAAGAGTGGGAAGATGCCAGG + Intergenic
994377879 5:99035926-99035948 CAGAAGGATGGGAAGGTGGGAGG - Intergenic
994398319 5:99247276-99247298 TAGAAGACAGGAATGGAGGCAGG + Intergenic
994669980 5:102753911-102753933 CAGTGGACTGGGAAGAAGGTAGG - Intergenic
995110155 5:108419984-108420006 AATAAGACAGGGAAGGAGGTGGG - Intergenic
995945106 5:117635606-117635628 GGAAAGACTGGGAAGGAGGTGGG - Intergenic
996099404 5:119431421-119431443 CAGAAGACAGGCAAGGGTGCAGG - Intergenic
996694045 5:126373794-126373816 CATAAGACTGAGAAGGAGCGTGG + Intronic
996882303 5:128313486-128313508 CAGAAGACTGGGAGAGAAGACGG - Intronic
998065590 5:139155716-139155738 CAGAAGACTGGGTAAGAGGGTGG + Intronic
998154327 5:139775963-139775985 CAGAAGACAGGTGAAGAGGCTGG - Intergenic
998269218 5:140691591-140691613 AAAAGGCCTGGGAAGGAGGCGGG - Exonic
998453029 5:142249496-142249518 CAGCAGACTGGGAAGGCGGCTGG + Intergenic
998831882 5:146168399-146168421 CAGAAAACTGAAACGGAGGCTGG + Intronic
999461258 5:151759012-151759034 CAGGAGGCTGCGAAGGACGCAGG + Intronic
999531383 5:152466803-152466825 TAGAGGACTGGGAAAGAGGAAGG + Intergenic
999936722 5:156494721-156494743 CAGAAAAGTGGGAAGGAAGAAGG - Intronic
1000009845 5:157220584-157220606 CAGCAGAGTGGTCAGGAGGCAGG + Intronic
1001133238 5:169081266-169081288 CAGCAGGGTGGGAAGGAGCCTGG + Intronic
1001331623 5:170766568-170766590 CAGAAAAGTGGGAAAGAGGTTGG + Intronic
1001493148 5:172169496-172169518 CAGAAGAATGGGAGGGTGGGTGG + Intronic
1001814909 5:174660408-174660430 CATACAACTGGGAAGGAGGTGGG - Intergenic
1002033834 5:176450000-176450022 CAGAAGCCTGGGAAGGGTTCTGG - Intronic
1002081785 5:176741701-176741723 CAGAAGACTGGGAGGGAAGTGGG + Intergenic
1002296693 5:178235272-178235294 CAGAAGACTGGGGAAGTGGGGGG + Intergenic
1002298099 5:178242288-178242310 GAGGAGAGGGGGAAGGAGGCAGG - Intronic
1002357298 5:178641218-178641240 GTTAAGACTGGGAAAGAGGCTGG + Intergenic
1002770935 6:290673-290695 CAGGTGACTGAGAAGCAGGCGGG + Intergenic
1002851762 6:1003164-1003186 GAGAAGACAGGGAAGGATGGCGG - Intergenic
1002901453 6:1413045-1413067 CAGGAGACTTGGAAGGAGCAAGG + Intergenic
1003253586 6:4455074-4455096 CAAAACAGTAGGAAGGAGGCTGG - Intergenic
1003427106 6:6004779-6004801 GAGAGGACAGGGAAGGAGCCAGG - Intronic
1003550472 6:7098387-7098409 CTGAAGATGTGGAAGGAGGCAGG - Intergenic
1003567126 6:7230968-7230990 AAGAAGCCTGAGGAGGAGGCGGG + Exonic
1003674244 6:8188453-8188475 CAGAGGAGTGGGAAGGAGAATGG + Intergenic
1003683495 6:8278387-8278409 AAGGGGACTGGGAAGCAGGCAGG + Intergenic
1004056795 6:12147125-12147147 CCCAAGGCTGGGAAGCAGGCTGG + Intronic
1004064417 6:12228862-12228884 CAGAAGCCTTGGGAGGAGGGAGG + Intergenic
1004164399 6:13243114-13243136 CAAAAGAATGGGAATGAGTCAGG + Intronic
1004971459 6:20915220-20915242 CCTAAGACTGGGAAATAGGCAGG - Intronic
1005391735 6:25340842-25340864 CAGAAGACAGGAAAGGAGTTAGG + Intronic
1005513319 6:26531376-26531398 CAGGAGAGTGGAAATGAGGCAGG + Intergenic
1005981469 6:30840039-30840061 GCGAAGAGTGGGAGGGAGGCAGG + Intergenic
1006105642 6:31714551-31714573 GAAGAGACTGGGAAGGAGGAAGG + Intronic
1006153865 6:32003677-32003699 CTGAAGACTGAGAAGGAGCCAGG + Intergenic
1006160173 6:32036414-32036436 CTGAAGACTGAGAAGGAGCCAGG + Intergenic
1006627552 6:35408108-35408130 CAGAAGACAGGGTAGGAGGGTGG - Intronic
1007107285 6:39292522-39292544 CAGAGGAGTTGGAATGAGGCGGG - Intergenic
1007118463 6:39361260-39361282 AAGAAGAATGGGTTGGAGGCTGG + Intronic
1007450768 6:41939458-41939480 AAGGAGCCTGGGGAGGAGGCGGG - Intronic
1007706827 6:43796172-43796194 GAGAAGGCTGGGGAGGAGGAAGG - Intergenic
1007939751 6:45769293-45769315 TAGGAGCTTGGGAAGGAGGCAGG - Intergenic
1008449391 6:51632628-51632650 CAGAGGACAGGGAAGCAGCCAGG + Exonic
1008453152 6:51676045-51676067 CAGAGGAGGAGGAAGGAGGCAGG + Intronic
1009292915 6:61906539-61906561 AAGAATAGTGGGAAGGAGGGGGG - Intronic
1009464767 6:63955214-63955236 CAGAAGATAGGGATGAAGGCTGG - Intronic
1009972599 6:70640913-70640935 CAGTAGAGGGGTAAGGAGGCAGG - Intergenic
1010289412 6:74117812-74117834 GAGAAGGCTAGGAAGGAGGAAGG - Intergenic
1010807110 6:80250347-80250369 CAGAAGATTGAGACAGAGGCTGG - Intronic
1011311914 6:85988969-85988991 CAGAAGCCAGGGATGGTGGCAGG + Intergenic
1011715105 6:90097048-90097070 CAGAAGGCTGGGAAAGAGCCTGG - Intronic
1011725287 6:90204812-90204834 TAGAATACTGGAAAGTAGGCAGG - Intronic
1011787333 6:90861780-90861802 CAACAGATTGGGAAGTAGGCTGG - Intergenic
1012253015 6:97000164-97000186 CAGAAGACTGAGGAGGACTCAGG + Intronic
1013837047 6:114345010-114345032 AAGATGACTGAGAAGGAGGATGG + Intergenic
1014391516 6:120871724-120871746 AAGTAGAGTGGGAAGGAGGCTGG + Intergenic
1015190662 6:130468233-130468255 CAGAGGGCCTGGAAGGAGGCTGG - Intergenic
1015935235 6:138402300-138402322 CTGGGGACAGGGAAGGAGGCAGG + Intergenic
1016318723 6:142818982-142819004 CAGAAGAAAGGAAAGGAGGGAGG + Intronic
1016998571 6:149978744-149978766 CAGCAGACAGGAAAGGAAGCAGG + Intergenic
1018373647 6:163191279-163191301 CTGAAGCCTGGGAAGGAAGTAGG - Intronic
1018631931 6:165829110-165829132 CAGCAGCCTGGGAATGAAGCTGG - Intronic
1018915904 6:168132201-168132223 CAGCTGGCTGAGAAGGAGGCAGG - Intergenic
1018960953 6:168448303-168448325 CAGGAGGCTGGGGAGGAGGATGG + Intronic
1018983434 6:168617459-168617481 CTGAAGACGGGGCAGGAAGCTGG + Intronic
1019188520 6:170236045-170236067 CAGGAGACAGGGAGGGGGGCAGG - Intergenic
1019205997 6:170362443-170362465 CAGAACACTGGGAGAGTGGCAGG - Intronic
1019281959 7:205101-205123 CAGGACCCTGGAAAGGAGGCGGG + Intronic
1019730796 7:2628330-2628352 CAGAAGGCTGAGATTGAGGCGGG + Intergenic
1020088718 7:5325226-5325248 AAGAAGAAAGGGAAAGAGGCTGG - Exonic
1020315585 7:6903318-6903340 CAGCAGACTGGGAATAAGACAGG + Intergenic
1021786390 7:24156815-24156837 GAGAAGAGGGGGAAGGAAGCAGG - Intergenic
1022355119 7:29607375-29607397 GAGAAGCCTGGGAAAGAGTCAGG - Intergenic
1023050331 7:36245520-36245542 CAGTAGATTGGGTAGGAGGTGGG + Intronic
1023251048 7:38261576-38261598 CAAAAGACAGGACAGGAGGCCGG + Intergenic
1024076868 7:45825520-45825542 CAGGTGACAGGGAAGGAGGCCGG - Intergenic
1025127551 7:56355903-56355925 CAGGTGACAGGGAAGGAGGCCGG + Intergenic
1025602782 7:63015461-63015483 CAGGTGACAGGGAAGGAGGCCGG + Intergenic
1025727654 7:64081889-64081911 CAGAAGACAGGCAAAGAGGTGGG - Intronic
1026135251 7:67654662-67654684 CAGAAGACTGTGATGTTGGCTGG + Intergenic
1027217588 7:76193994-76194016 TAGAAGGCTGGGAGGGAGGAGGG + Intergenic
1027265974 7:76495482-76495504 CAGAAGCCTGGAGAGGAGGAGGG - Intronic
1027317348 7:76993599-76993621 CAGAAGCCTGGAGAGGAGGAGGG - Intergenic
1027654193 7:80908727-80908749 CAGAAAAATGGGAGGGAGACAGG + Intronic
1028790214 7:94844842-94844864 CACAAGACTGTGAAGGCAGCTGG + Intergenic
1029557858 7:101282797-101282819 CAGGCGGCAGGGAAGGAGGCTGG + Intergenic
1029746981 7:102521435-102521457 CAGAAAACTGGATAGGAGGCAGG + Intergenic
1029764934 7:102620524-102620546 CAGAAAACTGGATAGGAGGCAGG + Intronic
1030318504 7:108140702-108140724 GAGCAGAGTGGGAAGGAGGAAGG + Intergenic
1030596900 7:111550839-111550861 CCAAAGACAGGGAAGGAGTCAGG + Intronic
1031924672 7:127628213-127628235 AAGTAGACTGGCAAGGAGACAGG - Intergenic
1032131814 7:129235403-129235425 AAGAAGAATGAGAAGGAGGCTGG - Intronic
1032269283 7:130388896-130388918 CAGGAGAATGGGAAGGAGTGGGG - Intergenic
1033075277 7:138244123-138244145 CATTAGAATGGGAAGGAGGAAGG - Intergenic
1033242208 7:139689821-139689843 AAGAGGACTGGGAAGGAGTCAGG + Intronic
1033941794 7:146663930-146663952 CCTAAGACTGGGAAGAAAGCAGG - Intronic
1034338545 7:150338495-150338517 CAGAAGCCTGGGAGGAAAGCTGG - Intronic
1034558808 7:151866795-151866817 CAGAAGACGGGCAGGCAGGCAGG - Intronic
1034760450 7:153667434-153667456 CAGAAGAGTTGGCAGGATGCTGG + Intergenic
1035239565 7:157520926-157520948 AAGGAGACTGGGGAGGAGGAGGG + Intergenic
1035727861 8:1835612-1835634 CAGCAGGGTGGGAAGGACGCTGG - Intronic
1035985118 8:4420904-4420926 CAAAAGACAGGGAGGGAGGAGGG - Intronic
1036221999 8:6929059-6929081 CCACAGACTGGGAAGGAGGCAGG - Intergenic
1036668520 8:10764266-10764288 CACAGGGCTGGGAAGGTGGCAGG + Intronic
1036777830 8:11625671-11625693 CTGAAGACGGTGAGGGAGGCTGG + Intergenic
1037716813 8:21407907-21407929 CAGCAGAGTGGGGAGGAGGAAGG - Intergenic
1038308096 8:26422537-26422559 TAGGGGACTGGGAAGGAGACGGG + Intronic
1039149062 8:34482905-34482927 CTGAAGAATGGGATGGTGGCAGG + Intergenic
1041237420 8:55818440-55818462 TAGAAAACTGGGAATCAGGCTGG - Intronic
1041347883 8:56920442-56920464 GAGAAGACGGAGAAGGAGGAAGG + Intergenic
1042397696 8:68311080-68311102 AAGGAGACAGGGAAGGAGGAAGG - Intronic
1043561774 8:81501636-81501658 GAGAAGGCTGGCAAGGAGGCGGG + Intergenic
1044532726 8:93326122-93326144 GAGAAGACCGAGAAGGTGGCAGG - Intergenic
1044553802 8:93540407-93540429 AAGAAGACAGGGAAGGTAGCTGG + Intergenic
1044685849 8:94824658-94824680 CGGAAGAGTGGTAAGGAGGAAGG - Intronic
1044946701 8:97396294-97396316 CAGAAGATGGGGAGGGAAGCGGG - Intergenic
1045341083 8:101255054-101255076 CAGAAGAGTGGGAAGGAAAGAGG - Intergenic
1045349979 8:101329758-101329780 CAGGGGAGTGGGAAGGAGGGAGG - Intergenic
1045370450 8:101517249-101517271 AGGAAAACTGGGAAGGGGGCAGG - Intronic
1045554929 8:103206758-103206780 GAGAAGAGTGTGAAGGAGGGAGG + Intronic
1047000726 8:120569973-120569995 GAGAAGCCTGGAAAGGAGGAGGG - Intronic
1047181126 8:122589149-122589171 CAGAAGACAGTGAATGTGGCTGG - Intergenic
1047323390 8:123811650-123811672 GAGAAGACTGGGGAGGAAGAGGG + Intronic
1047706453 8:127504485-127504507 CAGCTGACTGGTAATGAGGCTGG + Intergenic
1047830853 8:128628150-128628172 CAGAAAAGAGGGAAGGAGGATGG - Intergenic
1048141339 8:131797596-131797618 GAGAAGACAGGGAATAAGGCTGG + Intergenic
1048211850 8:132460883-132460905 TAGAAGATAGGGAAGGAGGGTGG - Intronic
1048437407 8:134431422-134431444 CAGAAGACATGGAAGTGGGCAGG + Intergenic
1048912592 8:139150351-139150373 AAGAAAAATGGGAAGGAGACTGG - Intergenic
1049434361 8:142579609-142579631 CCCAGTACTGGGAAGGAGGCAGG - Intergenic
1049544120 8:143221605-143221627 CAGGAGACTGGGTAGGAGGAGGG + Intergenic
1049793578 8:144484967-144484989 GAGATCACTGGGAAAGAGGCCGG + Intronic
1050602040 9:7262596-7262618 CAGAAAAAAGGGAAGTAGGCAGG + Intergenic
1051107052 9:13592429-13592451 CAGACTACTGGGAAGGAAACAGG + Intergenic
1051845821 9:21450013-21450035 CAGAATATTGGGAAGGATGGGGG + Intergenic
1052249782 9:26384239-26384261 CCAAAGACAGGGAAGGAGCCTGG + Intergenic
1052834881 9:33242850-33242872 CAGAGCACTGGGATGGGGGCAGG - Intronic
1053310987 9:37019568-37019590 CAGATGAAAGGGAAGGAGCCAGG + Intronic
1053387101 9:37701414-37701436 CAGAAGACTGAGTAGGAGTTGGG + Intronic
1053673749 9:40399237-40399259 CAGCACACTGGGAGGAAGGCAGG + Intergenic
1053923551 9:43025597-43025619 CAGCACACTGGGAGGAAGGCAGG + Intergenic
1054074991 9:60520495-60520517 CAGAACACTGGGATGAAGGCCGG - Intergenic
1054384854 9:64539302-64539324 CAGCACACTGGGAGGAAGGCAGG + Intergenic
1054510878 9:65977053-65977075 CAGCACACTGGGAGGAAGGCAGG - Intergenic
1054749241 9:68887463-68887485 GAGAAGGCTGGGGAGGAGGCTGG + Intronic
1055081827 9:72275271-72275293 CACAAGAATGGGAAGGAGTGAGG + Intergenic
1055146224 9:72938117-72938139 GAAAAGACTGGGCAGGAGACTGG + Intronic
1055476705 9:76669833-76669855 CAGAAGACTCGGGAGGAGTGAGG - Intronic
1055699090 9:78921758-78921780 CAGAAGGCTGAGGAGGAGGAAGG + Intergenic
1056238821 9:84623167-84623189 CAGAAGACAGGGAAAGGGGAAGG - Intergenic
1057106266 9:92420542-92420564 TAGAAGAGAGGGAAGGAGGATGG - Intronic
1057144512 9:92749101-92749123 CAGGAGCCTGGGAAGGCTGCAGG + Intronic
1057173331 9:92976677-92976699 CAGAAGGCTGACAAGGATGCCGG + Exonic
1057386293 9:94608491-94608513 CAGAAGAATGGGAAGCAGTCAGG + Intronic
1057506714 9:95640070-95640092 CTCAAGAATGGGAAGGAGTCAGG + Intergenic
1057622025 9:96644774-96644796 CATAAGATTGGGATTGAGGCCGG - Intronic
1057724009 9:97555552-97555574 CCGAAGTCTGGGAAGGAGAGGGG + Intronic
1057836523 9:98449772-98449794 CAGAAGAGGGGGATGGAGGAGGG + Intronic
1058328512 9:103728184-103728206 AGGAAGAGTGGGAAGGGGGCAGG - Intergenic
1059431874 9:114255292-114255314 CTGACCACTGGGAGGGAGGCCGG - Intronic
1059470014 9:114497865-114497887 CAGCCACCTGGGAAGGAGGCAGG + Intronic
1059473801 9:114527652-114527674 CTGTAGACTGGGAAGGACCCAGG + Intergenic
1059696765 9:116737094-116737116 TGGAAGACTGGGAAGAAGGGTGG + Intronic
1061087015 9:128405295-128405317 CAGAGGACTGTCTAGGAGGCAGG - Intergenic
1061208424 9:129177346-129177368 TAGAAGCCGGGGGAGGAGGCGGG + Exonic
1061402930 9:130378315-130378337 GAGGAGGCTGGGGAGGAGGCTGG + Intronic
1061503879 9:131019822-131019844 GTGAAGACTGGGAGGGGGGCGGG - Intronic
1061591475 9:131600487-131600509 CACAAGAGTGGCCAGGAGGCAGG + Intronic
1061648850 9:132029765-132029787 CAGAAATCTGGGAACAAGGCAGG + Intronic
1061649858 9:132038794-132038816 CAGGAGACAGGGAAGAAGGAAGG + Intronic
1061950135 9:133931499-133931521 CAGAGGACAGGGAAGGCAGCTGG - Intronic
1062016496 9:134293734-134293756 CAGAAGCCTGTGGAGGGGGCAGG - Intergenic
1062080838 9:134622587-134622609 AAGGAGACAGGGATGGAGGCAGG - Intergenic
1062080869 9:134622686-134622708 AAGGAGACAGGGATGGAGGCAGG - Intergenic
1062080900 9:134622787-134622809 AAGGAGACAGGGATGGAGGCAGG - Intergenic
1062107843 9:134765517-134765539 CAGCAGGCTGGGAGGGAGTCTGG + Intronic
1062449088 9:136608106-136608128 AAGAAGAGAGGGAAGGAGGGAGG + Intergenic
1186342215 X:8657054-8657076 CAGAGAAGTGGGAAGGGGGCAGG + Intronic
1186344225 X:8674949-8674971 AAGAAGACAGGGCAGAAGGCAGG - Intronic
1186637991 X:11427156-11427178 AATAAGACTGGACAGGAGGCAGG - Intronic
1186646893 X:11516846-11516868 GAGATGACAGAGAAGGAGGCTGG - Intronic
1186833536 X:13415080-13415102 CAGAAGATAACGAAGGAGGCTGG - Intergenic
1186901199 X:14058621-14058643 CCAAAGACTGGAAAGAAGGCAGG + Intergenic
1187215012 X:17267662-17267684 TAGAGGAGTGGGAAGGAGGGGGG + Intergenic
1187632707 X:21192683-21192705 CAGAAGAGTGGGAATGGGGCAGG + Intergenic
1187663306 X:21574237-21574259 TAGAAGACTCGGAAGAAGACAGG - Intronic
1188537261 X:31211216-31211238 AAGAAGACTGCGTGGGAGGCTGG + Intronic
1188574855 X:31635509-31635531 CAGAAGACAGCAAAGCAGGCAGG + Intronic
1189023099 X:37362831-37362853 CAGCAGACTGGGAGGGGGCCTGG + Intronic
1189273121 X:39765646-39765668 CACGTGACTGGGAAGGAGGAAGG + Intergenic
1189474035 X:41335046-41335068 CAGAAGATTGGGGAGGAGTGGGG + Intronic
1190059131 X:47199633-47199655 GAGAAAACTGGGCAGAAGGCTGG - Intronic
1190067802 X:47254089-47254111 AAGAAGACTGGGAAGCGGCCGGG - Intergenic
1190736189 X:53257036-53257058 GGGAAGACAGGGAAGGAGTCGGG + Intronic
1191226888 X:58053662-58053684 CCGACGACTGGTAAGGAGTCTGG + Intergenic
1191716420 X:64196860-64196882 CAGAACACTGGGAAGGAAGGTGG + Intronic
1192605530 X:72512886-72512908 AAGAGGACTGAGAAGTAGGCAGG - Intronic
1195310055 X:103624143-103624165 CTGAGGCCTGGGAAGGAGGCTGG - Intronic
1195769026 X:108329055-108329077 AAGAAGAGTGGGAAGGGGGCTGG + Intronic
1196179312 X:112672601-112672623 TAGAGGACTGGGAAGGAGGTTGG + Intronic
1196512156 X:116524322-116524344 CAGTGGACTGGGAAGGTGGGTGG - Intergenic
1197045845 X:121997272-121997294 AAAAAGACTAGGAAGGAGGAGGG + Intergenic
1197199472 X:123735210-123735232 CAGAGGAGTGGGAGGGAAGCAGG - Intergenic
1197282409 X:124552727-124552749 CAGAGGAGTGGGAAGGAGATTGG - Intronic
1199067665 X:143439692-143439714 CAGAAGACTGGGAGAGAGGGAGG + Intergenic
1199254507 X:145703330-145703352 CTGAAGACTGGGAACAAAGCAGG + Intergenic
1199666333 X:150099394-150099416 CAGAACCCTGGGAAGGAATCTGG + Intergenic
1199946328 X:152670984-152671006 CAGCAGCCTGGGAAGAAGCCGGG + Intergenic
1199991095 X:152988167-152988189 CAGTACACTGGGAAGGGAGCAGG + Intergenic
1200053587 X:153447045-153447067 CAGGCGACTGGGATGGAGGGGGG + Intronic
1200102866 X:153696721-153696743 CTGGGGACTGGGAAGGGGGCAGG + Intergenic
1200164303 X:154025534-154025556 GAGAAGAGTGGGAAGGAGGGTGG + Intronic
1200267872 X:154655501-154655523 CTGGGGACTGGGAAGGGGGCAGG + Intergenic
1200747539 Y:6915780-6915802 CAGAAAACTGGAAAGGGGCCAGG - Intronic
1201011397 Y:9550458-9550480 GAGAATACTGGGAATGGGGCAGG + Intergenic
1201278708 Y:12322021-12322043 CAGCAGGCAGGGAAGGTGGCTGG - Intergenic