ID: 929516781

View in Genome Browser
Species Human (GRCh38)
Location 2:42610550-42610572
Sequence TGGCAGTTGTTGAGGAAAAA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 356
Summary {0: 1, 1: 1, 2: 1, 3: 32, 4: 321}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929516775_929516781 -1 Left 929516775 2:42610528-42610550 CCTAGCCCCTTGTTTGTCGTTTT 0: 1
1: 0
2: 3
3: 44
4: 402
Right 929516781 2:42610550-42610572 TGGCAGTTGTTGAGGAAAAACGG 0: 1
1: 1
2: 1
3: 32
4: 321
929516779_929516781 -8 Left 929516779 2:42610535-42610557 CCTTGTTTGTCGTTTTGGCAGTT 0: 1
1: 0
2: 0
3: 11
4: 190
Right 929516781 2:42610550-42610572 TGGCAGTTGTTGAGGAAAAACGG 0: 1
1: 1
2: 1
3: 32
4: 321
929516778_929516781 -7 Left 929516778 2:42610534-42610556 CCCTTGTTTGTCGTTTTGGCAGT 0: 1
1: 0
2: 0
3: 6
4: 144
Right 929516781 2:42610550-42610572 TGGCAGTTGTTGAGGAAAAACGG 0: 1
1: 1
2: 1
3: 32
4: 321
929516777_929516781 -6 Left 929516777 2:42610533-42610555 CCCCTTGTTTGTCGTTTTGGCAG 0: 1
1: 0
2: 2
3: 5
4: 133
Right 929516781 2:42610550-42610572 TGGCAGTTGTTGAGGAAAAACGG 0: 1
1: 1
2: 1
3: 32
4: 321

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929516781 Original CRISPR TGGCAGTTGTTGAGGAAAAA CGG Intronic
900017524 1:163136-163158 TGCCAGCTGTTGGGAAAAAAAGG + Intergenic
900047783 1:521732-521754 TGCCAGCTGTTGGGAAAAAAAGG + Intergenic
900069999 1:763596-763618 TGCCAGCTGTTGGGGAAAAAAGG + Intergenic
901168996 1:7241420-7241442 TGACAATTTCTGAGGAAAAAAGG - Intronic
903299740 1:22370222-22370244 GAGCATTTGTTGAGGAAAGAAGG - Intergenic
903872640 1:26447681-26447703 TGGTAATTGTTAAGGAAAACAGG + Intronic
904789161 1:33005443-33005465 GGCCATTTGCTGAGGAAAAAAGG - Intergenic
906085800 1:43133025-43133047 AGGCATCTGTTGGGGAAAAAAGG - Intergenic
907826269 1:58020046-58020068 TGGTAGTAGTTGAGGGAAATAGG - Intronic
907839190 1:58140107-58140129 TGGCAAATGTTGAAGAAAAAAGG - Intronic
908473709 1:64469793-64469815 TGGCAGCGGTTGGGGAAGAAGGG - Intergenic
909395066 1:75162017-75162039 TGCCAGTTGGGGAAGAAAAAAGG + Intergenic
909508613 1:76424579-76424601 TGGCAATTGTTGAGGAAATGTGG + Intronic
910653976 1:89601121-89601143 TGGCAGTTGTTCTGTGAAAAGGG + Intergenic
911304172 1:96212716-96212738 TGGCAGATGTTGCTGAATAATGG - Intergenic
911449169 1:98043825-98043847 TGGCATTTGTTGAGGAGATGAGG - Intergenic
913060259 1:115197956-115197978 TGGGAGTTAGTTAGGAAAAAGGG - Intergenic
913667902 1:121067006-121067028 TGTCAGTTGTAGAGGAAACTAGG - Intergenic
914019593 1:143854136-143854158 TGTCAGTTGTAGAGGAAACTAGG - Intergenic
914658144 1:149762353-149762375 TGTCAGTTGTAGAGGAAACTAGG - Intergenic
915258651 1:154657675-154657697 TGCCAGTTGTGGAGGGAAAAGGG + Intergenic
916069647 1:161162425-161162447 TGCAAGTGGTTGGGGAAAAAGGG - Intronic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
917546760 1:175977720-175977742 TGGCAGTTGCTTAAGAAAAAAGG - Intronic
917788560 1:178485342-178485364 TGGCAGGGGATGAGGAGAAAGGG - Intergenic
920969882 1:210734266-210734288 TGGGACTTGTTGAGGGAAATGGG - Intronic
922265704 1:223981632-223981654 TGCCAGCTGTTGGGAAAAAAAGG + Intergenic
923900173 1:238317635-238317657 TGGTAGTTGGAAAGGAAAAAGGG - Intergenic
924155305 1:241169277-241169299 AGGCATTTGTGGATGAAAAAAGG - Intronic
1064260500 10:13781804-13781826 TGCCAGTGGCTGAGGAAAACGGG + Intronic
1064811394 10:19203116-19203138 TGGAAGATGAAGAGGAAAAAAGG - Intronic
1064957774 10:20930443-20930465 TGGCTGATGTCTAGGAAAAATGG - Intronic
1065110477 10:22436060-22436082 AGGTGGTTGTTGAGGAATAAGGG - Intronic
1065421197 10:25546475-25546497 TGTTATTTGTTGAGGCAAAAGGG - Intronic
1066141690 10:32509859-32509881 TGGCTGTTATTAAGAAAAAATGG + Intronic
1066249805 10:33622077-33622099 TGGCAGTTGAAGGAGAAAAATGG - Intergenic
1066455739 10:35569823-35569845 TCGCCATTGTTGAAGAAAAACGG - Exonic
1067154369 10:43764317-43764339 TTACAGTTGTTGATGAAAAAAGG - Intergenic
1067257673 10:44660237-44660259 TGTCAGTTATTGGGGACAAAAGG - Intergenic
1067999466 10:51314944-51314966 TTACAGTTGTTTTGGAAAAATGG - Intronic
1068117770 10:52752801-52752823 GGGCAGGTGGTGAGGAATAAAGG + Intergenic
1068213706 10:53955010-53955032 CCTCAGTTGTTGAGGAAAAAGGG - Intronic
1068424738 10:56845458-56845480 TGAGAGCTGTGGAGGAAAAAGGG - Intergenic
1069214552 10:65803472-65803494 TGGAAGGTCTAGAGGAAAAATGG + Intergenic
1069638037 10:69937526-69937548 TGGCATTTGTAGAGGAAGGAGGG - Intronic
1070572996 10:77655634-77655656 TGGGTGTTGTGGAGGAGAAAGGG - Intergenic
1070984758 10:80679138-80679160 TTGCAGCTGTTTAGGAACAAAGG + Intergenic
1071423186 10:85522570-85522592 TGGCAGTTACTGGGAAAAAAGGG - Intergenic
1073022855 10:100461155-100461177 GGGCAGTTTTTGTGTAAAAAGGG - Intergenic
1076974121 11:158342-158364 TGCCAGCTGTTGGGAAAAAAAGG + Intergenic
1078672877 11:13380564-13380586 AGGCAGTGGTTGATGAAAAATGG - Intronic
1079670754 11:23167666-23167688 GGGCAGTAGTTTAGGATAAAAGG + Intergenic
1080019596 11:27546128-27546150 TGGCAGTTGCTGTTGCAAAAGGG + Intergenic
1080621715 11:33992338-33992360 TTGCAGTTCTAGAGGATAAATGG + Intergenic
1080816566 11:35763410-35763432 TGGCTGTATTTGAGGAATAAGGG + Intronic
1080868642 11:36216884-36216906 TGACAGATGTTCAGGATAAATGG + Intronic
1081156919 11:39704620-39704642 TAGCAGTTTTAGAGGCAAAAAGG - Intergenic
1082637665 11:55616094-55616116 AGGGAGTGGTTGAGAAAAAAGGG + Intergenic
1084994333 11:72960726-72960748 TGGGAGTTGATGTGGAGAAAGGG + Intronic
1085165977 11:74399389-74399411 AGGAAGTTGTTGAGGGAAGATGG + Intergenic
1087014003 11:93538771-93538793 TGGCAGTGGTTGCGGAGAAGAGG - Intronic
1089165938 11:116476614-116476636 AAGCAGTTGGTGAGGAAAGAAGG + Intergenic
1090371308 11:126255395-126255417 TGGCAGATGTTGGGAAAGAATGG - Intronic
1090427333 11:126617278-126617300 TGGCAGGTGGTGAAGAAACATGG + Intronic
1090919161 11:131193032-131193054 TGACAGTTGTAGGGTAAAAAAGG - Intergenic
1092162397 12:6323030-6323052 TGGCAGTTCCGAAGGAAAAAAGG - Intronic
1093843224 12:23931956-23931978 TGACCCTTGTTGAGGAAATAGGG - Intronic
1096729344 12:53595178-53595200 TGGCAGAGGGTGGGGAAAAAAGG + Intronic
1097577434 12:61412585-61412607 TTGAAGCTGTTGAGAAAAAAGGG + Intergenic
1097813015 12:64038738-64038760 TTTCAGCAGTTGAGGAAAAATGG + Intronic
1098187455 12:67912770-67912792 TGGGAGTTATCCAGGAAAAAAGG - Intergenic
1101068473 12:101047668-101047690 TGGCAGTTTTGCAGTAAAAATGG + Intronic
1101235256 12:102782050-102782072 TGGTAGTTGTTGGGGAAAATAGG - Intergenic
1103825212 12:123732436-123732458 GGGCTGTTGCTGAGGAAAACAGG - Intronic
1104077321 12:125401420-125401442 TAGAAGTTGTTGAGGATAAGAGG + Intronic
1104832472 12:131763083-131763105 AGGCAGTTGTTGATGAAAAGTGG + Intronic
1105468429 13:20669029-20669051 TGGGAGTAGGAGAGGAAAAAGGG + Intronic
1106476493 13:30102791-30102813 GGGCAGTTCTGCAGGAAAAAGGG - Intergenic
1109217873 13:59610597-59610619 AGGAAGTTGTTAAGGAGAAATGG - Intergenic
1110295183 13:73856009-73856031 TGGCAGTTGTAGTCCAAAAAGGG - Intronic
1111147413 13:84202354-84202376 TGGCAGTTGATAAAGTAAAATGG - Intergenic
1112013500 13:95311949-95311971 TGGCAGAAGGTGGGGAAAAAAGG - Intergenic
1115057831 14:29152406-29152428 TGGAATTTCTGGAGGAAAAAAGG - Intergenic
1115290058 14:31760488-31760510 TGGCAGTTATAGTGGAAGAATGG - Intronic
1116050329 14:39795077-39795099 TGGCAGGAGAAGAGGAAAAAGGG + Intergenic
1116619279 14:47177909-47177931 TGTGAATTGTTGAGGAACAAAGG + Intronic
1119338976 14:73859124-73859146 AGGCATTTGTTGATGAAATAAGG + Intronic
1119493797 14:75061612-75061634 TCAAAGTTGTTGAGGGAAAAGGG - Intronic
1120092762 14:80352812-80352834 TGGTAGTTTTAGAGGAAAAAAGG - Intronic
1120169016 14:81230770-81230792 TGGCATTGGTTGAGAAAAAGTGG + Intergenic
1121757717 14:96417030-96417052 TGGCAGCCGTTGAAGACAAAGGG + Intronic
1123666901 15:22615080-22615102 TGCCAGTTGATGGGGAAGAAAGG - Intergenic
1124320741 15:28709653-28709675 TGCCAGTTGATGGGGAAGAAAGG - Intronic
1124481751 15:30085696-30085718 TGCCAGTTGATGGGGAAGAAAGG + Intronic
1124488207 15:30137794-30137816 TGCCAGTTGATGGGGAAGAAAGG + Intronic
1124521839 15:30411505-30411527 TTGCAGTTGATGGGGAAGAAAGG - Intronic
1124536825 15:30554714-30554736 TTGCAGTTGATGGGGAAGAAAGG + Intronic
1124543298 15:30606768-30606790 TGCCAGTTGATGGGGAAGAAAGG + Intronic
1124563252 15:30794220-30794242 TGCCAGTTGATGGGGAAGAAAGG + Intergenic
1124755319 15:32400526-32400548 TGCCAGTTGATGGGGAAGAAAGG - Intronic
1124761827 15:32452877-32452899 TTGCAGTTGATGGGGAAGAAAGG - Intronic
1124776802 15:32596191-32596213 TTGCAGTTGATGGGGAAGAAAGG + Intronic
1124960034 15:34387013-34387035 TGCCAGTTGATGGGGAAGAAAGG - Intronic
1124976663 15:34533234-34533256 TGCCAGTTGATGGGGAAGAAAGG - Intronic
1125198366 15:37074756-37074778 TGGCAGATATTGAGTAAAACTGG + Intronic
1125701560 15:41690084-41690106 GGGGAGTGGTTGAGGGAAAATGG - Intronic
1127290448 15:57565732-57565754 TGCCAGTTATTAAAGAAAAATGG + Intergenic
1127555704 15:60085291-60085313 AGGCAGTTGTGCAGGAAAACGGG - Intergenic
1127774110 15:62252293-62252315 TGTCAGTTGCTGGGGAAGAAAGG - Intergenic
1127775742 15:62263173-62263195 TGCCAGTTGCTGGGGAAGAAAGG - Intergenic
1128193782 15:65731470-65731492 TTGCAGTTATTAATGAAAAAAGG - Intronic
1128975393 15:72149261-72149283 TGGCACATGATGAGGCAAAAAGG + Intergenic
1130484363 15:84390382-84390404 TGCCAGTTGATGGGGAAGAAAGG + Intergenic
1131646823 15:94353546-94353568 TGGCAATTGCTTAAGAAAAATGG - Intronic
1131695914 15:94877169-94877191 TGCCAGTTGATGGGGATAAATGG - Intergenic
1131747509 15:95464903-95464925 TGGTATTTCTTGAGAAAAAAAGG - Intergenic
1132433624 15:101779488-101779510 TGCCAGTTGATGGGGAAGAAAGG - Intergenic
1133698411 16:8286854-8286876 TGGGAATTATTGAGGAAAAGTGG + Intergenic
1133711170 16:8402562-8402584 GAGCAGTTGTTGAGGGACAATGG - Intergenic
1134203616 16:12219526-12219548 AGGCAGTTGTTGTGTAGAAAGGG + Intronic
1135221420 16:20617441-20617463 TGTCAGAGGTGGAGGAAAAAGGG - Intronic
1135674257 16:24401995-24402017 TGGCATGTGTTGAGGAGAAGGGG - Intergenic
1139034093 16:62922208-62922230 TGGCAGTTGTTTTGGATTAAAGG + Intergenic
1139266070 16:65639664-65639686 TGCTGGTTGTTGAAGAAAAATGG - Intergenic
1141048738 16:80741784-80741806 TGGCAGATGTTCAGGTAAAATGG + Intronic
1142446138 16:90139321-90139343 TGCCAGCTGTTGGGAAAAAAAGG - Intergenic
1142461367 17:96142-96164 TGCCAGCTGTTGGGAAAAAAAGG + Intergenic
1144368779 17:14570290-14570312 TGGAAGTTGCTGATGATAAAAGG - Intergenic
1144585688 17:16486284-16486306 TGGCATTTGTTCCAGAAAAAAGG + Intronic
1145841968 17:28002674-28002696 TGGCAGTTGCTGAGAAGGAATGG + Intergenic
1146003741 17:29147967-29147989 TGGCAGTTGATGGGGAAGAGAGG + Intronic
1147576253 17:41601082-41601104 TGGCAGTGGTTGAGGGGAAAAGG - Intergenic
1147914758 17:43879654-43879676 TAGCAGTAGTTGAGGGCAAAGGG + Intronic
1148456043 17:47812072-47812094 TGGCAGTTGGTGGGGGATAAAGG - Intronic
1150490769 17:65572979-65573001 TGGCCTTTGTTGGGGAGAAAAGG - Intronic
1150573172 17:66405934-66405956 TGGTTGGTGTGGAGGAAAAATGG + Intronic
1150696044 17:67406372-67406394 TGCCAGTGGTTGGGGAAACAGGG - Intronic
1150713688 17:67552890-67552912 TGGGAATTATTGAGGAAACAGGG - Intronic
1152933113 17:83120365-83120387 TGCCAGTTGGGGAGGAAAAGAGG + Intergenic
1153567075 18:6429318-6429340 AGCCAGTTGTTGAGGATAAATGG - Intergenic
1155537379 18:26831530-26831552 GGACAGTCGTTGAGTAAAAAGGG - Intergenic
1156013884 18:32526361-32526383 TGTCAGTTGATGAAGAAAAGGGG + Intergenic
1156022172 18:32612256-32612278 TGGCAGATGTTGTGGAGAAAAGG - Intergenic
1156058301 18:33038854-33038876 TGGCATATGTTGAGGATTAAGGG - Intronic
1156787016 18:40927324-40927346 TGCCAGTTGTTTAAAAAAAAAGG + Intergenic
1157836407 18:50907342-50907364 GAGCAGTTATTCAGGAAAAATGG - Intronic
1157878434 18:51295310-51295332 AGGTAGTTGTTAAAGAAAAAGGG + Intergenic
1158761936 18:60400540-60400562 TGGGAGTTGTTGAGATAAAAAGG + Intergenic
1159470438 18:68848279-68848301 TCAGAATTGTTGAGGAAAAAGGG - Intronic
1159763480 18:72457163-72457185 GGGAAGTTGTTGAGGAGAGAAGG + Intergenic
1160651070 19:228509-228531 TGCCAGCTGTTGGGGAAAAAAGG + Intergenic
1163171919 19:15537344-15537366 TGGCAGCTGTGGAGGGCAAAGGG - Exonic
1164775613 19:30851291-30851313 TGGCAGTTGGGAAGGACAAAAGG - Intergenic
1165008694 19:32827284-32827306 TGGAAGATGTTGAACAAAAATGG + Intronic
1167633986 19:50642904-50642926 TGGAAGGTGCTTAGGAAAAATGG + Intronic
1168633370 19:57974792-57974814 TGGAAAATGTTCAGGAAAAAAGG + Intergenic
926705940 2:15837637-15837659 TGGCAGTTTTGGAGAAAGAAGGG + Intergenic
928197182 2:29224371-29224393 TGGCAGTGGTTAGGGAAACAGGG - Intronic
928423455 2:31158292-31158314 TGGCAGTGGAGGAGGAAGAAAGG - Intergenic
928571141 2:32609939-32609961 TGGCATTTGATTAGGAAAACTGG - Intronic
929516781 2:42610550-42610572 TGGCAGTTGTTGAGGAAAAACGG + Intronic
929613171 2:43286919-43286941 TGGGGGTTGGTGAGGAAAAGTGG + Exonic
929925780 2:46206965-46206987 TGGTAGTTTTTGAAGAAAAGAGG - Intergenic
932740711 2:74289001-74289023 TGGCAATGGGTGGGGAAAAAAGG - Intronic
933289259 2:80419833-80419855 TGCTTGTTGTTCAGGAAAAATGG - Intronic
933524123 2:83414818-83414840 TGGTAGTTGTAGATGAAAACAGG + Intergenic
935253129 2:101283001-101283023 TGGCAGATATTTAGGTAAAAAGG - Intronic
935546200 2:104402202-104402224 TGGCAGGTTTTGAGGAAACCTGG + Intergenic
935616008 2:105082621-105082643 GGGAGGTTTTTGAGGAAAAATGG + Intronic
938215644 2:129510933-129510955 AGGCACTTGTAGAGGGAAAATGG + Intergenic
938630094 2:133157105-133157127 TGACAGTATTTGAGGCAAAATGG - Intronic
941304202 2:163841274-163841296 TGGCAGTTGATGAGGGACAGAGG + Intergenic
941979979 2:171444729-171444751 TGGCTGTCCTTTAGGAAAAACGG + Intronic
942115645 2:172726559-172726581 TGGCAGTTGCTCAGGAAACAAGG + Intergenic
942425575 2:175857069-175857091 TGGAAGTGGAAGAGGAAAAATGG + Intergenic
942768589 2:179487299-179487321 TGACTGTTGTTTGGGAAAAATGG + Intronic
943711609 2:191102468-191102490 TGGCAGTTGTTGTAAAAACAAGG - Intronic
943885075 2:193206168-193206190 AGGCAGTTCTTAAGGTAAAATGG + Intergenic
944144973 2:196497689-196497711 TGGCTGGTGTTGGGGAAAAGGGG - Intronic
945826497 2:214726283-214726305 TGGCAGCTGTCAAGGAAAAAGGG + Exonic
946510232 2:220348132-220348154 TTGCAGTTGTTGAGGGAGCATGG + Intergenic
946530996 2:220570294-220570316 TGGCTGTTGGGGAGGAAATAAGG - Intergenic
948228456 2:236332065-236332087 TGGCAGTAGCTGATGAAAACTGG - Intronic
948246224 2:236488853-236488875 TGTCATTTTTTGAGGAAAGAGGG + Intronic
948251074 2:236529718-236529740 TGGCAGTTTTTCTGGAACAATGG - Intergenic
948666968 2:239542123-239542145 AGGAAGCTGTTTAGGAAAAAAGG - Intergenic
949036646 2:241818600-241818622 GGGCAGTTGCTGGGGAAAAGGGG - Intergenic
1168733711 20:111268-111290 TCCTAGTTGCTGAGGAAAAAGGG - Intergenic
1168791052 20:576073-576095 TGGCATTGGTTGAGGGAAGAAGG + Intergenic
1170130944 20:13019420-13019442 TCTCATTTGTTTAGGAAAAATGG + Intronic
1170156774 20:13276079-13276101 TGGCAGTTATCGAGGAAGAAGGG + Intronic
1171154185 20:22857084-22857106 GGGCAGTGGGTGGGGAAAAAGGG + Intergenic
1172604502 20:36205611-36205633 GGGCAGTGGTTGAGGAAAATTGG + Intronic
1173185541 20:40837165-40837187 TGCCAGATGATGAGGAAAGAGGG - Intergenic
1173240914 20:41296547-41296569 TGGCAGAAGGTGGGGAAAAAAGG - Intronic
1175468320 20:59208087-59208109 GGCCAGTTGTTGAAGAAGAAAGG + Intronic
1175849407 20:62080746-62080768 GGGCAAGTGTTAAGGAAAAATGG + Intergenic
1176875740 21:14125469-14125491 AGGCAGACGATGAGGAAAAACGG + Intronic
1177310784 21:19389637-19389659 TTACATTTGTTGAGGAAATATGG - Intergenic
1177862587 21:26471866-26471888 TATCAGATGTTGAGGATAAATGG - Intronic
1178363589 21:31969943-31969965 TGGCTGTTTTTGAGCAAACAAGG + Intronic
1179010246 21:37551028-37551050 TGGAACTGGTGGAGGAAAAATGG + Intergenic
1183281805 22:36936260-36936282 TGGCTGGTGTGGAGGAGAAATGG + Intronic
1184175254 22:42785374-42785396 TGCCAGTTGATGGGGAAGAAAGG + Intergenic
950309044 3:11939921-11939943 TGGCAGTTGGTGTGGAAAGAAGG + Intergenic
950973445 3:17213935-17213957 AGGCATTTGTAGAGAAAAAAAGG + Intronic
951341075 3:21487989-21488011 TGGAAGCTCTTGAGGAAAACTGG - Intronic
955959272 3:64322287-64322309 GGGCAGCTGTAGAGGGAAAATGG + Intronic
957439442 3:80224902-80224924 TGATAATTTTTGAGGAAAAAAGG + Intergenic
958161780 3:89825947-89825969 TTGCAGGTGTTAAGGATAAATGG + Intergenic
958549955 3:95599584-95599606 TGGCTGTCTTTGAGGAAAAGGGG - Intergenic
958635874 3:96745382-96745404 TGGCAGTTGTTCAAGTAAATGGG + Intergenic
959574784 3:107923026-107923048 TGGCAGTAGTTTTGGAAAGAAGG - Intergenic
960419713 3:117428787-117428809 TGGCAGTTGTTAAAAATAAATGG + Intergenic
960444350 3:117729577-117729599 TGGGGGTTGTTGAGGGAAAAGGG - Intergenic
960769527 3:121178107-121178129 TGCCAGAGGTTAAGGAAAAAGGG + Intronic
961937650 3:130602598-130602620 TGGCAGGGCTTGAGGAGAAATGG + Intronic
963898263 3:150709075-150709097 TGGCAGTCTTTGAGGAAAAATGG - Intergenic
964083240 3:152785596-152785618 TGGCACTTGGTGAGGAAAGGAGG + Intergenic
965239974 3:166183575-166183597 TAGCATTTGTTGAGAATAAAAGG - Intergenic
965633067 3:170752932-170752954 TGGCATCTGTTCAGGAAAGAGGG - Intronic
965979862 3:174674675-174674697 TTGAAGTTGATGAGGAAACAGGG + Intronic
966113384 3:176431212-176431234 TTGCAGCTGCTGAGTAAAAAAGG + Intergenic
966772121 3:183513554-183513576 TGGCTGTTGATGAGCAAAGAAGG + Intronic
967243258 3:187462265-187462287 TGGTAGATGTTGGGGAAAATGGG + Intergenic
968366762 3:198191478-198191500 TGCCAGCTGTTGGGAAAAAAAGG - Intergenic
969236311 4:5867485-5867507 TGGGAGTTGTACTGGAAAAATGG - Intronic
970254233 4:14150682-14150704 TGGCAGGTGCTGGGTAAAAATGG + Intergenic
970512065 4:16790977-16790999 TAGAAGTTGCTGAGCAAAAAGGG - Intronic
970662205 4:18298521-18298543 TGAGAGTGGTTAAGGAAAAAGGG + Intergenic
971209982 4:24606915-24606937 TGGCAGGGGCTGAGGAGAAAGGG + Intergenic
971403190 4:26295215-26295237 TGGCCGTTGTCCAGGAAGAAAGG + Intronic
972023647 4:34348297-34348319 TGGCAGATCTTTAGGAAAAAAGG - Intergenic
972097194 4:35363357-35363379 TTGGTGTTCTTGAGGAAAAAGGG - Intergenic
972321996 4:37980612-37980634 TGTCAGTTTATGAGAAAAAATGG + Intronic
972411695 4:38801736-38801758 TAGCTGTTGTTAAGGGAAAAAGG - Intronic
972560673 4:40225729-40225751 TGGCAGAGGGTGAGGAAGAAAGG - Intronic
973982899 4:56321165-56321187 AGGCAGTTGTGGAGGATAAACGG + Intronic
976775175 4:88698938-88698960 AGGCAGTGGGTGAGGAAGAAGGG - Intronic
976953790 4:90868324-90868346 TGGGAGTGGTGGGGGAAAAAGGG - Intronic
977359431 4:95983978-95984000 TTGGAGCTGTTTAGGAAAAAAGG + Intergenic
977848580 4:101796360-101796382 TGGCAGTTTTTGATAAATAAAGG - Intronic
979077048 4:116284945-116284967 TGGCCGTTCTTGATGAGAAAGGG - Intergenic
979568486 4:122184670-122184692 TAGCAGTTGCTAAGAAAAAAAGG + Intronic
981103069 4:140852007-140852029 TAGCAGTTTTTGAGGAATACTGG + Intergenic
981162165 4:141511095-141511117 TGGCAGTTGTAGGGGAAGAGGGG + Intergenic
981733770 4:147927309-147927331 AAGCAGTTGTTATGGAAAAAAGG - Intronic
981928297 4:150163459-150163481 TAGTAGTTATTGAAGAAAAAAGG - Intronic
982466422 4:155738874-155738896 TAACACTTGTTGAGGAAGAATGG + Intergenic
982529358 4:156519745-156519767 TGTAAGTTATTGAAGAAAAAAGG + Intergenic
984179456 4:176463931-176463953 TGGCAGTTTTTGAGGAGTACTGG - Intergenic
984592992 4:181637146-181637168 TAGGAGTTGCTGAGGAAGAAGGG - Intergenic
984714607 4:182914814-182914836 TTCCAGTTGTTGATGACAAAAGG + Intronic
984780740 4:183523654-183523676 TGGCAGTTGTGGTAGAAACAGGG - Intergenic
984807870 4:183768033-183768055 TGGCAACTGTTGAGGAAGAGAGG + Intergenic
985041309 4:185894261-185894283 TGGCAGGTGTTGGGGAAAAGTGG + Intronic
986365608 5:7027245-7027267 TGAAGGTTGTTGAGGAGAAATGG + Intergenic
989604773 5:43233337-43233359 TGGCAGTTGTTAGGGACAAGAGG - Intronic
990660190 5:58005075-58005097 TGGTTGTTGTTGAGGGAAACAGG + Intergenic
992893556 5:81226987-81227009 TGTCAGTTGTTGAAGAAATAGGG + Exonic
993097804 5:83500645-83500667 TGGCAGTAGAAGAAGAAAAAAGG - Intronic
994144228 5:96374804-96374826 TGGTAGTTGTGGTGGAAGAAAGG + Intergenic
995519967 5:112993752-112993774 TGGCAGTCCTTCAGGGAAAAGGG - Intronic
996330736 5:122325559-122325581 TGAGAGTTGTTTAGTAAAAAGGG - Intronic
999083957 5:148870773-148870795 TGTCAGTGGTTCAAGAAAAATGG - Intergenic
999534082 5:152498436-152498458 AGGCAGATGTAGAGGAAAAATGG + Intergenic
999821553 5:155233861-155233883 GGGGAGTTGTAGAGGAAGAAAGG + Intergenic
1000944577 5:167404933-167404955 TGGCAGTTGTGGAGGGGAATGGG - Intronic
1002725985 5:181296678-181296700 TGCCAGCTGTTGGGAAAAAAAGG - Intergenic
1002829818 6:809546-809568 TGGCAGATGTGAAGGAAGAAGGG + Intergenic
1003481677 6:6539770-6539792 TGGCTATTTATGAGGAAAAAAGG - Intergenic
1003495811 6:6662229-6662251 TGGCACATGTTGATGAAAGAGGG + Intergenic
1003714251 6:8628804-8628826 TGGCAGCTGCTGAAGAAACATGG - Intergenic
1004108992 6:12696093-12696115 TGACAGATGAAGAGGAAAAATGG - Intergenic
1006137593 6:31905029-31905051 TGGCAGAAGTTGGGGAAGAAGGG - Intronic
1007734412 6:43971793-43971815 TGGCAGTAATTGAGAAAAAGAGG + Intergenic
1007973730 6:46078998-46079020 GGGGAGATGTTGGGGAAAAAGGG + Intronic
1008900279 6:56606320-56606342 TGGCAGTTGGAGAGGAAGAAAGG - Intronic
1008958592 6:57243203-57243225 AGGCAGTTATTGAGGGGAAAGGG - Intergenic
1009310702 6:62148996-62149018 GGGCAGTTATTGGGGAAAGAGGG - Intronic
1009438750 6:63650725-63650747 TTGCACTTGTTCTGGAAAAAAGG + Intronic
1010419789 6:75660114-75660136 TGGCATTTGTTGAGGAGTATAGG + Intronic
1011484542 6:87828539-87828561 AGGCAGTTAGTGAGGAAACAGGG - Intergenic
1011779296 6:90769147-90769169 TGACAGTTGTTCTGGGAAAAAGG + Intergenic
1013488392 6:110619791-110619813 TGGCAGTTGGGGAGGAAGACTGG - Intronic
1014139159 6:117920376-117920398 TGGCAGTTGTGGAGGAAAAACGG - Intronic
1014750260 6:125247115-125247137 TGGAAGGGGTAGAGGAAAAAGGG + Intronic
1014785479 6:125613847-125613869 TAGTAGTGGTAGAGGAAAAATGG - Intergenic
1015179189 6:130343998-130344020 TGGGGGTTATTGAGGTAAAAGGG - Intronic
1015732641 6:136363995-136364017 TGGCAGCAGCTGAGGAAAACTGG - Intronic
1016045378 6:139475513-139475535 TGTCAGTTGTTGAAGGAAGAAGG - Intergenic
1017469291 6:154723794-154723816 TGACAGTTGTTGGGATAAAAGGG - Intergenic
1019204786 6:170350878-170350900 TTGCAGTCGTGGAGGAGAAAAGG - Intronic
1019209268 6:170391933-170391955 TGGCCGTTGTTTAAGAAGAACGG - Intronic
1020590839 7:10134692-10134714 TGGCATTTGTTCAAGAACAAAGG + Intergenic
1021698483 7:23295722-23295744 TGGCAGTTTTGGGGGAAAGAGGG + Intergenic
1022133826 7:27428831-27428853 TGGAAGTTAATGTGGAAAAAAGG + Intergenic
1022620278 7:31976852-31976874 TGGCAGATAATGAGGATAAAGGG - Intronic
1023017187 7:35980340-35980362 GGGCATTTATTGTGGAAAAATGG - Intergenic
1023727175 7:43155356-43155378 TGGAAGTTGGAGGGGAAAAAAGG + Intronic
1024846980 7:53657165-53657187 TGCCAGTGCTTGAGGAAAAATGG + Intergenic
1028147640 7:87336088-87336110 TGGTAGCTCCTGAGGAAAAAAGG - Intergenic
1028766925 7:94570216-94570238 AGGCAGTAGTGGAGGAAATAGGG - Intergenic
1029146372 7:98449070-98449092 TGGGGGTTGTTGATGGAAAAAGG - Intergenic
1029202654 7:98849385-98849407 TGGCAGAGGGTGAGGGAAAAGGG - Intronic
1031493018 7:122412355-122412377 TGCCAGTTGGAGAGGAATAAGGG + Intronic
1033307605 7:140236490-140236512 TGGGAGTTGGTGAGAGAAAAGGG - Intergenic
1033668776 7:143469489-143469511 TGGCAGATGTAGAGGATGAAAGG + Intergenic
1035973928 8:4285665-4285687 TGGCAGTGGTGTAGGAAGAATGG + Intronic
1037020111 8:13959589-13959611 TGGTACTTGCTTAGGAAAAAGGG + Intergenic
1037060656 8:14505453-14505475 TGGCAGTAGTTGAGAAATTAAGG + Intronic
1037769776 8:21791513-21791535 TGGCAGATGCTCAGGAAATAAGG - Intronic
1039264442 8:35809157-35809179 TGGCAGTTGGTGGGGAGAAGAGG - Intergenic
1039530684 8:38259016-38259038 TGGTGGTGGTTGAGGAACAAAGG + Intronic
1040011711 8:42666591-42666613 TGGCATTTATTGAGGAAGAAAGG - Intergenic
1041324710 8:56652138-56652160 TGGCAGTGGTTGAGGAGCAGGGG + Intergenic
1041961900 8:63627437-63627459 TGGTAGTTGTTAAAGAACAAAGG - Intergenic
1042935786 8:74056743-74056765 TGGCAGTCAGTGAGGAAACAGGG + Intergenic
1042958214 8:74274536-74274558 TGGCAGTGGAGGAGGCAAAAGGG - Intronic
1043504751 8:80891313-80891335 TGGCAGGGGATGAGGATAAAAGG - Intergenic
1043784925 8:84386873-84386895 TGTCAGTTATTGAGGTGAAAAGG - Intronic
1044756980 8:95473795-95473817 TGGAAGTTGGTGAGGAAGGAGGG + Intergenic
1045511634 8:102816213-102816235 ATGAAGATGTTGAGGAAAAAAGG + Intergenic
1045731712 8:105249241-105249263 TGGCAGTTTGAGAAGAAAAAGGG - Intronic
1048658346 8:136568772-136568794 TCACAGTGGTTGAGGAAATAAGG - Intergenic
1050589724 9:7149041-7149063 TGGCAGTTGATGACGGCAAAAGG - Intergenic
1051244812 9:15099224-15099246 GGGTAGTAGTTGAGGACAAACGG - Intergenic
1051371976 9:16366437-16366459 TGGCAGTTGGTGAGGTCAGAGGG - Intergenic
1051512978 9:17900175-17900197 TGGTAGGTACTGAGGAAAAATGG + Intergenic
1053231609 9:36415156-36415178 TTGGTGTTGTTGAGGAAGAAGGG - Intronic
1053532834 9:38898894-38898916 TAGCAGTTCTTGAGGGAAACTGG - Intergenic
1054205060 9:62123323-62123345 TAGCAGTTCTTGAGGGAAACTGG - Intergenic
1054633299 9:67465047-67465069 TAGCAGTTCTTGAGGGAAACTGG + Intergenic
1055694707 9:78871289-78871311 TGGAAGTTGGTGTGGAAAACTGG + Intergenic
1056273802 9:84973207-84973229 TGGCAGTAGTTAAGAGAAAAAGG + Intronic
1057151381 9:92799006-92799028 TAGCAGTTCTTGAGGGAAACTGG + Intergenic
1057537982 9:95934066-95934088 AGGCAGCTGATGAGGGAAAATGG + Intronic
1058609580 9:106761032-106761054 TTGAAGTTATTGTGGAAAAATGG - Intergenic
1062751119 9:138254322-138254344 TGCCAGCTGTTGGGAAAAAAAGG - Intergenic
1186108759 X:6233091-6233113 TTGCAGAAGTTGAGCAAAAATGG + Intergenic
1186629826 X:11336764-11336786 TGGGAATTGGAGAGGAAAAAAGG - Intronic
1187368392 X:18683355-18683377 TAGCAGATATTGAGGAAAAGAGG + Intronic
1187520790 X:20012099-20012121 TGGGAGTTTTTCAGGAGAAAGGG - Intronic
1187713891 X:22082080-22082102 TGTCAGTTCCTGAGAAAAAAAGG - Intronic
1187991998 X:24884506-24884528 TGGCATTTGTTGGGGGAACAAGG + Intronic
1189353791 X:40296561-40296583 TAGCAGCTGCTCAGGAAAAAAGG - Intergenic
1190750405 X:53357106-53357128 TGGCAGAAGATGAGGAAAGAAGG + Intergenic
1190801604 X:53794564-53794586 TGGCAGAGGATGAGGAAAGAAGG + Intergenic
1196088808 X:111716435-111716457 AGGCAGTTGTTAAGGAATAAAGG - Intronic
1196312206 X:114182317-114182339 TGGCAATAGTAGAGAAAAAATGG + Intergenic
1196861950 X:120036974-120036996 AGGCTGTTGTGGTGGAAAAAAGG - Intergenic
1197161868 X:123332783-123332805 TGGCAGTAGTTGTGGAGAAGAGG - Intronic
1197651673 X:129072149-129072171 TGGCAATTCTTGAGGAATAGAGG + Intergenic
1199881982 X:151981197-151981219 GGGCAGTTGTTGAAGAAGGAAGG + Intergenic
1202373730 Y:24214914-24214936 TGCCAGTTGATGGGGAAGAAAGG - Intergenic
1202497051 Y:25455206-25455228 TGCCAGTTGATGGGGAAGAAAGG + Intergenic