ID: 929520354

View in Genome Browser
Species Human (GRCh38)
Location 2:42644493-42644515
Sequence ATGCTATTATAGGTGTGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 92}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929520344_929520354 14 Left 929520344 2:42644456-42644478 CCTCAAACAATCCTCCCACCTCG 0: 4
1: 322
2: 2585
3: 8028
4: 23488
Right 929520354 2:42644493-42644515 ATGCTATTATAGGTGTGGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 92
929520346_929520354 3 Left 929520346 2:42644467-42644489 CCTCCCACCTCGGACTCCCAAAA 0: 14
1: 1612
2: 35836
3: 127267
4: 179690
Right 929520354 2:42644493-42644515 ATGCTATTATAGGTGTGGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 92
929520347_929520354 0 Left 929520347 2:42644470-42644492 CCCACCTCGGACTCCCAAAAGTG 0: 1
1: 73
2: 497
3: 1369
4: 6857
Right 929520354 2:42644493-42644515 ATGCTATTATAGGTGTGGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 92
929520343_929520354 19 Left 929520343 2:42644451-42644473 CCTGGCCTCAAACAATCCTCCCA 0: 102
1: 2269
2: 13473
3: 37025
4: 75621
Right 929520354 2:42644493-42644515 ATGCTATTATAGGTGTGGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 92
929520349_929520354 -4 Left 929520349 2:42644474-42644496 CCTCGGACTCCCAAAAGTGATGC 0: 1
1: 0
2: 8
3: 261
4: 1054
Right 929520354 2:42644493-42644515 ATGCTATTATAGGTGTGGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 92
929520348_929520354 -1 Left 929520348 2:42644471-42644493 CCACCTCGGACTCCCAAAAGTGA 0: 1
1: 4
2: 168
3: 699
4: 1798
Right 929520354 2:42644493-42644515 ATGCTATTATAGGTGTGGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929520354 Original CRISPR ATGCTATTATAGGTGTGGCC TGG Intronic
905771412 1:40640341-40640363 AAGCTATTATAGGTGGGGAAGGG - Intronic
906794068 1:48682716-48682738 ATAATACTATAGGTATGGCCTGG + Intronic
908972883 1:69858489-69858511 ATGCTAATATTGGTGTAGCCTGG - Intronic
909049905 1:70754310-70754332 ATGCTCTCATGGGAGTGGCCAGG + Intergenic
909186184 1:72489264-72489286 ATGCATTTTTAGGTGGGGCCAGG - Intergenic
915655877 1:157360145-157360167 ATTCTATTTTTGGTGAGGCCAGG - Intergenic
915673458 1:157509756-157509778 ATTCTATTTTTGGTGAGGCCAGG + Intergenic
916575025 1:166059471-166059493 ATGCTATAATTGGTTTGGGCAGG + Intronic
919227748 1:194729669-194729691 ATGGTATTATAAGTGTTCCCAGG + Intergenic
919690613 1:200525311-200525333 ATGCTGTTCTTGGTGAGGCCTGG - Intergenic
920888168 1:209954128-209954150 AAGCTATTAAAGGTGTGGTCAGG + Intronic
922097859 1:222457968-222457990 ATGCTTTTATGGGTTAGGCCCGG + Intergenic
1064169956 10:13022262-13022284 ATGCCCTTATAGGTGTGGAAGGG - Intronic
1064566883 10:16648873-16648895 ATGCTTTTATAGTTGTGACTTGG - Intronic
1064771478 10:18728174-18728196 AAGCTATTACAGCTGTGGCTGGG - Intergenic
1066471820 10:35705646-35705668 AAGCTATTGTTAGTGTGGCCTGG - Intergenic
1070587583 10:77778550-77778572 ATGCTTTTATATGTTTGCCCAGG - Intergenic
1071811633 10:89188233-89188255 ATGTTATTTTAGGTGTGGAGGGG - Intergenic
1072395773 10:95039020-95039042 ATGCCATTATGGTTGTGCCCTGG + Exonic
1074078902 10:110152285-110152307 GGGCCATTAGAGGTGTGGCCTGG + Intergenic
1075308721 10:121392487-121392509 ATGCTATTATAGGCTGGGCGTGG - Intergenic
1076390878 10:130100920-130100942 AAGCTATAATAGCTGAGGCCGGG + Intergenic
1079426979 11:20352888-20352910 CTGGGATTACAGGTGTGGCCTGG - Intergenic
1079576430 11:22008997-22009019 ATGTTATTATAGTGGTGTCCTGG + Intergenic
1081444425 11:43116810-43116832 ATGCTATTGCTGGTGTGACCTGG - Intergenic
1088237522 11:107741673-107741695 CTGCTCTTGTAGGAGTGGCCAGG + Intergenic
1091220045 11:133925361-133925383 ATTCTCTTCTAGGTGTGTCCAGG - Intronic
1092102509 12:5897377-5897399 ATGCTCTTGTATGGGTGGCCAGG - Intronic
1100294876 12:93251535-93251557 ATGATATTATAGATAAGGCCTGG - Intergenic
1101720833 12:107349258-107349280 ATGATGTTATAGATGAGGCCAGG - Intronic
1101811503 12:108111864-108111886 GATCTATTACAGGTGTGGCCTGG - Intergenic
1104863686 12:131939919-131939941 ATGTAATGATAGGTGTGGCTGGG + Intronic
1108428314 13:50327643-50327665 ATAATATTATAGGTGGGGTCTGG + Intronic
1121565218 14:94904286-94904308 ATGCTATTGCAGGTGTGAACAGG - Intergenic
1121859665 14:97305266-97305288 ATGCTATTAGAGGTCTGCACAGG + Intergenic
1124153932 15:27208906-27208928 GTGAAATTATATGTGTGGCCAGG - Intronic
1124848523 15:33313641-33313663 ATGCTTTTAAAGGTGTTGTCTGG - Intronic
1125831580 15:42720539-42720561 ATCCTAGGATAGGTGGGGCCAGG - Exonic
1129207370 15:74045067-74045089 ATGCTGTGATGGGTGGGGCCTGG - Exonic
1134329819 16:13240474-13240496 ATGCTAATATTGGTGTTCCCTGG - Intergenic
1138238027 16:55402048-55402070 ATGCTGTTATAGGTGGGACATGG + Intronic
1143695459 17:8612553-8612575 ATTTTATCATAGGTATGGCCAGG + Intronic
1144135340 17:12289807-12289829 ATGCTCTTGGAGGTGTGGCCTGG - Intergenic
1153190603 18:2533673-2533695 ATGAAATTAGAGGTGTTGCCAGG + Intergenic
1153468712 18:5418140-5418162 GTGCTCATATAGGTGTGGGCTGG - Intronic
1156156448 18:34308287-34308309 ATATTATTATTGGTATGGCCTGG + Intergenic
1167635963 19:50655944-50655966 AAGCTATTCTGGGTGTGGCATGG + Intronic
927029324 2:19104199-19104221 ATGGTATGATGGGTGAGGCCAGG - Intergenic
929520354 2:42644493-42644515 ATGCTATTATAGGTGTGGCCTGG + Intronic
930851492 2:55965790-55965812 ATGCAATGATAGGTCTGGCCAGG + Intergenic
931943914 2:67284309-67284331 ATGCCATTGTAGGACTGGCCTGG + Intergenic
933328106 2:80863905-80863927 ATGCTCTTGTAGGAGTGGCCAGG + Intergenic
934884326 2:98011276-98011298 ATGCTATTTTAGAGGTGGTCAGG - Intergenic
938731410 2:134150817-134150839 AGCACATTATAGGTGTGGCCTGG + Intronic
943234544 2:185300692-185300714 ATGCTTTTACAGGAGTGACCAGG + Intergenic
946574639 2:221061561-221061583 ATGCTGTTCTAGGTCTGGTCAGG + Intergenic
948667046 2:239542649-239542671 ATGGTATTAAAGGTAGGGCCAGG - Intergenic
1169931338 20:10836287-10836309 ATGCAATCATATGTTTGGCCAGG - Intergenic
1172071201 20:32258516-32258538 CTGAAATTATAGGTGTGGCCTGG + Intergenic
1174972375 20:55290475-55290497 CTGGGATTATAGGTGTGGCCCGG + Intergenic
1176343064 21:5716032-5716054 ATGATATCAAAGGTGAGGCCTGG - Intergenic
1176475318 21:7148183-7148205 ATGATATCAAAGGTGAGGCCTGG - Intergenic
1176501763 21:7608424-7608446 ATGATATCAAAGGTGAGGCCTGG + Intergenic
1176537385 21:8114101-8114123 ATGATATCAAAGGTGAGGCCTGG - Intergenic
1203242329 22_KI270733v1_random:30457-30479 ATGATATCAAAGGTGAGGCCTGG - Intergenic
952752957 3:36840385-36840407 ATGCTATTGTAGGTTTGGGTAGG - Intronic
956334149 3:68144655-68144677 TTGATATAAAAGGTGTGGCCAGG - Intronic
958488114 3:94737998-94738020 ATCCAATTATGAGTGTGGCCTGG + Intergenic
959620837 3:108397232-108397254 ATGCTGAGATAGGTGGGGCCAGG - Intronic
959909022 3:111742253-111742275 ATGCTATTATGACTTTGGCCTGG - Intronic
960595154 3:119401767-119401789 CTGCTATTGTATGTGTGCCCCGG + Intronic
961187740 3:124930717-124930739 AAGCAGTTATAGGTGTGCCCTGG - Intronic
965796249 3:172442212-172442234 ATGATTTTCAAGGTGTGGCCGGG + Intergenic
972403237 4:38724420-38724442 GTGCTAGTTTGGGTGTGGCCTGG - Intergenic
972638919 4:40908502-40908524 GAGGCATTATAGGTGTGGCCTGG - Intronic
974902550 4:68019189-68019211 ATGTTATTTTTAGTGTGGCCTGG - Intergenic
977492437 4:97731981-97732003 ATGCTCTTATAGGGGCAGCCAGG + Intronic
978248714 4:106604988-106605010 ATGCTAGCATAGGTCTGGCATGG - Intergenic
978253182 4:106658207-106658229 ATACTACTATATGTGTGACCTGG - Intergenic
988260706 5:28883068-28883090 ATGCTCTGATAGATGTGGCAAGG - Intergenic
996217881 5:120891459-120891481 CTGCCCTTATAGGGGTGGCCAGG + Intergenic
1001494346 5:172177414-172177436 ATGCTATTGCAGATCTGGCCTGG + Intronic
1004085351 6:12442321-12442343 ATTCCATTAAAGATGTGGCCAGG - Intergenic
1006776641 6:36597988-36598010 AAGAAATTATAGCTGTGGCCAGG - Intronic
1008552518 6:52646668-52646690 GAGCTATTCTAGCTGTGGCCTGG - Intergenic
1013612452 6:111807806-111807828 CTGCTATTAAAGGTGAGGTCAGG + Intronic
1029901639 7:104047224-104047246 ATACTATTCAAAGTGTGGCCTGG + Intergenic
1042822786 8:72949921-72949943 ATGCTATTATGTGTGTGGACAGG - Intergenic
1043217688 8:77615541-77615563 ATTCTAATATAGGTTTGTCCTGG - Intergenic
1049652141 8:143775463-143775485 AAGTTATTATAGCTGAGGCCGGG + Intergenic
1050756521 9:9011055-9011077 ATGCTATGATATGTGTATCCTGG + Intronic
1055146902 9:72946698-72946720 ATGCTATTATAACTATAGCCAGG - Intronic
1056440680 9:86618033-86618055 AAGTTATAATAGGTGTGACCTGG + Intergenic
1059862367 9:118479017-118479039 ATGATATTATGAGTGTGACCAGG + Intergenic
1203458657 Un_GL000220v1:13534-13556 ATGATATCAAAGGTGAGGCCTGG - Intergenic
1187213462 X:17252527-17252549 ATGCGTATATAGGTGTGGCTGGG - Intergenic
1188686911 X:33080673-33080695 ATTATATTATAGATGAGGCCTGG - Intronic
1193928370 X:87520082-87520104 ATGGTTTTATAGGTGTGCCAAGG + Intronic
1196729866 X:118929849-118929871 ATAATAACATAGGTGTGGCCGGG - Intergenic
1197579440 X:128263338-128263360 ATAGAATTATTGGTGTGGCCTGG + Intergenic
1199714657 X:150498151-150498173 ATGCTGTTCTAGGTGTGGTCTGG - Intronic
1202058371 Y:20859726-20859748 ATGCTGTTATAAGTGTGGAAAGG + Intergenic