ID: 929520817

View in Genome Browser
Species Human (GRCh38)
Location 2:42649073-42649095
Sequence GAGTGGTACTAGAGGCCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 206}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929520817_929520827 9 Left 929520817 2:42649073-42649095 CCCCCTGGCCTCTAGTACCACTC 0: 1
1: 0
2: 2
3: 13
4: 206
Right 929520827 2:42649105-42649127 CTGTTATCGGCCGGGTGTGGTGG 0: 1
1: 3
2: 31
3: 432
4: 2523
929520817_929520825 1 Left 929520817 2:42649073-42649095 CCCCCTGGCCTCTAGTACCACTC 0: 1
1: 0
2: 2
3: 13
4: 206
Right 929520825 2:42649097-42649119 TTTAATAGCTGTTATCGGCCGGG 0: 1
1: 0
2: 0
3: 14
4: 205
929520817_929520823 -4 Left 929520817 2:42649073-42649095 CCCCCTGGCCTCTAGTACCACTC 0: 1
1: 0
2: 2
3: 13
4: 206
Right 929520823 2:42649092-42649114 ACTCATTTAATAGCTGTTATCGG 0: 1
1: 0
2: 2
3: 10
4: 215
929520817_929520826 6 Left 929520817 2:42649073-42649095 CCCCCTGGCCTCTAGTACCACTC 0: 1
1: 0
2: 2
3: 13
4: 206
Right 929520826 2:42649102-42649124 TAGCTGTTATCGGCCGGGTGTGG 0: 1
1: 0
2: 2
3: 50
4: 381
929520817_929520824 0 Left 929520817 2:42649073-42649095 CCCCCTGGCCTCTAGTACCACTC 0: 1
1: 0
2: 2
3: 13
4: 206
Right 929520824 2:42649096-42649118 ATTTAATAGCTGTTATCGGCCGG 0: 1
1: 0
2: 0
3: 16
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929520817 Original CRISPR GAGTGGTACTAGAGGCCAGG GGG (reversed) Intronic
901382154 1:8881636-8881658 GAGTGTCACTTGAGCCCAGGAGG + Intergenic
902642459 1:17775464-17775486 GAGAGGTACCAGAGGCCAGGAGG + Intronic
903475118 1:23614132-23614154 AAGTGGTAGCAGAGGCCAGGTGG + Intronic
904884635 1:33726871-33726893 GAGTGTTATTAAAGGCCAGATGG + Intronic
906093313 1:43201360-43201382 CAGTGGTACTAGATGTCAGAGGG + Intronic
907778303 1:57540791-57540813 GATAGTTACCAGAGGCCAGGAGG + Intronic
908357679 1:63338438-63338460 GAGGAGTACTTGAGCCCAGGAGG + Intergenic
909256885 1:73435859-73435881 GAGTGGAACACGAGGTCAGGAGG + Intergenic
910688910 1:89946225-89946247 GAGGGTTACTTGAGCCCAGGAGG + Intergenic
914822326 1:151114251-151114273 GAGGGTCACTGGAGGCCAGGAGG + Intronic
915180632 1:154056242-154056264 GAGTGTCACTTGAGCCCAGGAGG - Intronic
915307723 1:154990253-154990275 AAGAGGTACTAGGGGCCTGGAGG + Exonic
915560570 1:156684867-156684889 GAGGAGAACTAAAGGCCAGGTGG + Intergenic
918190120 1:182165592-182165614 GAGTATTGCTTGAGGCCAGGAGG + Intergenic
918430177 1:184451378-184451400 GAGGGTTACTTGAGCCCAGGAGG - Intronic
919534142 1:198765757-198765779 GAGTGGGAATAGAGGCAAGGAGG - Intergenic
919990094 1:202703557-202703579 GAGTGGTGATGGAGGCCAAGAGG - Intronic
922335228 1:224613966-224613988 GAGTGTTGCTTGAGCCCAGGAGG - Intronic
922559263 1:226556606-226556628 GAGATGAACTAGAAGCCAGGAGG + Intronic
922762502 1:228141512-228141534 GTGTCTTACGAGAGGCCAGGCGG + Intronic
922810314 1:228411714-228411736 GAGGGTCACTTGAGGCCAGGAGG - Intronic
923651494 1:235878226-235878248 GAGGGGGACTCCAGGCCAGGAGG + Intronic
923954505 1:239000275-239000297 GAGTAGAATTAGAGGGCAGGAGG + Intergenic
1064118201 10:12596793-12596815 AAGGGGGACTGGAGGCCAGGAGG - Intronic
1065063387 10:21932248-21932270 GGGTGTTACTTGAGCCCAGGAGG + Intronic
1067704313 10:48595742-48595764 GAGGATTACTTGAGGCCAGGAGG - Intronic
1069059517 10:63880720-63880742 GAATAGCACTATAGGCCAGGTGG - Intergenic
1070162123 10:73873172-73873194 GAGTGTGACTAGAGGTCTGGTGG - Intronic
1071162959 10:82772793-82772815 GAGTGTTGCTTGAGCCCAGGAGG - Intronic
1071429824 10:85598460-85598482 CAGTGGTCCTAAAGGCCACGAGG - Intergenic
1072000983 10:91195572-91195594 GAGGATTACTTGAGGCCAGGAGG - Intronic
1072966841 10:99981269-99981291 GAGAGTTACTTGAGCCCAGGAGG - Intronic
1076402994 10:130195468-130195490 GACTGGCAGAAGAGGCCAGGTGG + Intergenic
1077506328 11:2931461-2931483 CGGGGGTACTGGAGGCCAGGAGG + Intergenic
1079715960 11:23745149-23745171 GAGTGTTACTTGAACCCAGGAGG - Intergenic
1082771200 11:57208915-57208937 GAGGGTCACTTGAGGCCAGGAGG + Intergenic
1083859461 11:65412146-65412168 GTGTGGGTCTGGAGGCCAGGTGG - Exonic
1083948568 11:65940778-65940800 GAGTGTCACTTGAGCCCAGGAGG + Intergenic
1087235964 11:95718984-95719006 GAGAATTACTAGAGTCCAGGAGG - Intergenic
1089210517 11:116797772-116797794 GAGTAGAGATAGAGGCCAGGGGG - Intergenic
1090181883 11:124706897-124706919 GAGTATTACTTGAGCCCAGGAGG + Intergenic
1090433233 11:126664169-126664191 GAATGGTAATAGAGGATAGGAGG - Intronic
1092069744 12:5623027-5623049 AAGTGTTTCCAGAGGCCAGGTGG + Intronic
1092452412 12:8615214-8615236 GAGTGTCACTTGAGCCCAGGAGG - Intergenic
1093443240 12:19224909-19224931 GAGGATTACTTGAGGCCAGGAGG + Intronic
1095410048 12:41911606-41911628 GAGGGGTACTGGAGGAAAGGGGG + Intergenic
1095984180 12:47988718-47988740 GAGGATTACTAGAGGCCAGTGGG - Intronic
1096977995 12:55710671-55710693 GAGTGTCACTTGAGCCCAGGAGG + Intronic
1101275169 12:103191649-103191671 GAGGATTACTAGAGACCAGGAGG + Intergenic
1101463887 12:104926992-104927014 GAGGGTTACTTGAGCCCAGGAGG + Intronic
1104271533 12:127286860-127286882 GAGTGTTACTTGAGCCCGGGAGG - Intergenic
1104305539 12:127607586-127607608 TAGTGGTGATAGAGGCCAGAGGG + Intergenic
1105953481 13:25255947-25255969 GAGTGGGAATGGAGGCTAGGAGG - Intronic
1107372540 13:39768325-39768347 GAGTGGCAGTAGGGGCCAGGAGG - Intronic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1112015845 13:95330747-95330769 GAGGATTACTTGAGGCCAGGAGG + Intergenic
1116848374 14:49885299-49885321 CAATGGTAATAAAGGCCAGGTGG - Intergenic
1121079674 14:91097304-91097326 GAGGGTTGCTTGAGGCCAGGAGG + Intronic
1122132859 14:99615452-99615474 GAGGGTTACTAGAGCCCGGGAGG + Intergenic
1122654031 14:103245146-103245168 GAGTATCACTAGAGCCCAGGAGG - Intergenic
1123126805 14:105952697-105952719 GAGTGTGGCTTGAGGCCAGGAGG - Intergenic
1202905947 14_GL000194v1_random:72594-72616 GAGTGGAACTTGAGGCCAGGTGG + Intergenic
1126162608 15:45628285-45628307 GAGGGGTGCTTGAGCCCAGGAGG - Intronic
1127739222 15:61883110-61883132 GAGTATCACTTGAGGCCAGGAGG - Intronic
1128019913 15:64381290-64381312 GTGTGGTACTGGAGGGCGGGGGG - Intronic
1128867632 15:71126380-71126402 GGGTGTTACTAGAGGCCAAGTGG + Intronic
1129597246 15:76974547-76974569 GAGTGGTCCTGTATGCCAGGGGG + Intergenic
1129649209 15:77469434-77469456 GAGGGGTGCTTGAGACCAGGAGG - Intronic
1131988057 15:98064993-98065015 GTGAGGTACAAGAGGCCAGAGGG - Intergenic
1132238026 15:100236611-100236633 GAGGATCACTAGAGGCCAGGAGG + Intronic
1133887392 16:9843417-9843439 GAGTATCACTTGAGGCCAGGAGG - Intronic
1134761222 16:16716928-16716950 GAGTATTACTTGAGCCCAGGAGG + Intergenic
1134984837 16:18642248-18642270 GAGTATTACTTGAGCCCAGGAGG - Intergenic
1135069898 16:19342720-19342742 GTGTGGTTACAGAGGCCAGGTGG - Intergenic
1136515986 16:30768565-30768587 GAGTGGGACTGGAGGCCACCTGG - Intronic
1137853040 16:51765398-51765420 GAGCAGTACATGAGGCCAGGTGG + Intergenic
1138344377 16:56311256-56311278 GAGTGGAACCTGAGCCCAGGTGG + Intronic
1138566755 16:57839101-57839123 GAGGATTACTTGAGGCCAGGAGG + Intronic
1139022154 16:62763061-62763083 GAGTGGGATTAAAGGACAGGGGG + Intergenic
1143033237 17:3979784-3979806 GAGGACTGCTAGAGGCCAGGAGG - Intergenic
1144821540 17:18078174-18078196 GAGTATTACTTGAGCCCAGGAGG + Intergenic
1145981143 17:29012391-29012413 GAATAGTATTAGATGCCAGGAGG - Intronic
1147371237 17:39994529-39994551 GACTGTTACTAGAGGAGAGGAGG - Intronic
1148779534 17:50113531-50113553 TAGTGGTAATAGTGGGCAGGGGG - Intronic
1148915006 17:50969175-50969197 GAGTGGTACTAAAAGCCATGAGG - Intronic
1150179532 17:63102219-63102241 GAGTGTTGCTTGAGCCCAGGAGG + Intronic
1151001447 17:70381528-70381550 CACTGCTAATAGAGGCCAGGTGG - Intergenic
1151886922 17:76928315-76928337 GAGTGGAAATAGAGGCAGGGAGG + Intronic
1152405978 17:80098182-80098204 AAGGGCTACTAGAGGCCAGTGGG + Intronic
1153961818 18:10146763-10146785 GAGTGGCAACAGAGTCCAGGTGG + Intergenic
1154281228 18:13005021-13005043 TTGTGGTACTAGAGGCAAGAGGG + Intronic
1155238949 18:23847401-23847423 GAGTGCTGCTGGAGCCCAGGCGG + Intronic
1157138633 18:45083780-45083802 GTGGGATTCTAGAGGCCAGGAGG - Intergenic
1158751246 18:60263790-60263812 GAGTGGTGCTAAAGAGCAGGGGG + Intergenic
1161408450 19:4103079-4103101 GAGTAGGACCAGGGGCCAGGGGG + Intronic
1162277704 19:9670649-9670671 GATGGTTACTAGAGGCCAGAAGG + Intronic
1162584005 19:11547930-11547952 CAGAGGTCATAGAGGCCAGGAGG + Intronic
1163113640 19:15176671-15176693 GAGGGTTACTTGAGCCCAGGAGG + Intronic
1163422608 19:17222651-17222673 GGGTGGATCTAGAGGTCAGGAGG + Intergenic
1165485757 19:36094663-36094685 GAGGGTCACTTGAGGCCAGGAGG + Intronic
1165758698 19:38308527-38308549 GTCTGGTAGTAGAGGCCAAGAGG + Intronic
1167847816 19:52178812-52178834 GAGTGTCACTTGAGCCCAGGAGG - Intergenic
926121553 2:10243762-10243784 GAGTGGGGGGAGAGGCCAGGGGG - Intergenic
926690380 2:15729131-15729153 AAGTGGGACTAGGGCCCAGGTGG + Intronic
927774520 2:25892121-25892143 GAGAATTACTTGAGGCCAGGAGG - Intergenic
928105867 2:28470256-28470278 GAATGGTGCCAAAGGCCAGGTGG - Intronic
928202330 2:29256160-29256182 GAGTGGTTCCAGGGGACAGGAGG + Intronic
929520817 2:42649073-42649095 GAGTGGTACTAGAGGCCAGGGGG - Intronic
929904810 2:46036498-46036520 GAGGGTCACTAGAGCCCAGGAGG + Intronic
933171128 2:79127263-79127285 AAGTGTTACTAGAGGAAAGGAGG - Intergenic
934090494 2:88546601-88546623 GAGGATTACTTGAGGCCAGGAGG + Intergenic
935885612 2:107616178-107616200 GAGGAGTACTTGAGCCCAGGAGG + Intergenic
937097240 2:119243294-119243316 GGCTGGGACAAGAGGCCAGGTGG - Intronic
938824962 2:134995471-134995493 GAGTAAAATTAGAGGCCAGGAGG + Intronic
939453451 2:142401493-142401515 CAGTGGTACTGGGGTCCAGGTGG - Intergenic
939562824 2:143752170-143752192 CACTGGTAATAGAGGCCAGCTGG - Intronic
940212982 2:151274968-151274990 GAGGATTACTTGAGGCCAGGAGG - Intronic
941307606 2:163891206-163891228 GAGGGTTACTTGAGCCCAGGAGG + Intergenic
941521467 2:166549898-166549920 GATGGATACTAGAGGCCGGGAGG - Intergenic
941790787 2:169549552-169549574 GAGGAGTACTTGAGCCCAGGAGG - Intronic
942645181 2:178102646-178102668 GAGGATTACTTGAGGCCAGGAGG - Intronic
942885623 2:180919830-180919852 AAGTGCTAGTAGAGGCCATGTGG + Intergenic
945195759 2:207236354-207236376 GACTGGTGCTAGAGGTCATGGGG - Intergenic
1172602728 20:36195094-36195116 GAAGGGAACTAGAGGCCAAGTGG - Intronic
1172979278 20:38928660-38928682 CACTGGAACTAGAGGCCAGAGGG + Intronic
1173275693 20:41579346-41579368 GAGAGGTGCTTGAGCCCAGGAGG + Intronic
1176625308 21:9087350-9087372 GAGCGGAAGTTGAGGCCAGGTGG + Intergenic
1180207563 21:46271249-46271271 GAGGGTTGCTTGAGGCCAGGAGG - Intronic
1180216941 21:46330205-46330227 GAGGGTCACTTGAGGCCAGGAGG - Intronic
1180975476 22:19845575-19845597 GGGTGGTTCCTGAGGCCAGGAGG + Intronic
1182192539 22:28477782-28477804 CAGTTGTACGAGAGGGCAGGTGG - Intronic
1183872985 22:40754446-40754468 GAGAGGTACTTGAACCCAGGAGG + Intergenic
1184513707 22:44947447-44947469 GAGAGGTTCTATAGGGCAGGGGG - Intronic
1184517938 22:44974322-44974344 GAGGGTCACTTGAGGCCAGGAGG + Intronic
950319756 3:12040268-12040290 GAGTGGTAATAGGAGGCAGGAGG + Intronic
951591664 3:24272254-24272276 GAGTATCACTAGAGCCCAGGAGG + Intronic
952044483 3:29302234-29302256 GAGGGTTACTTGAGCCCAGGAGG - Intronic
953484202 3:43279507-43279529 GAGAATTACTTGAGGCCAGGAGG - Intergenic
953767082 3:45751741-45751763 GGGTGGCACTGCAGGCCAGGAGG - Intergenic
959531048 3:107433738-107433760 GAGTGTTGCTTGAGCCCAGGAGG + Intergenic
961927539 3:130497111-130497133 GATGGCTACTAGAGGCTAGGGGG - Intergenic
962403437 3:135080555-135080577 GAGTGGTCCTGGAGGAGAGGGGG + Intronic
974102233 4:57429801-57429823 AAGAGCAACTAGAGGCCAGGAGG + Intergenic
977047881 4:92090260-92090282 GAGTGGTCCTAGTGACCCGGCGG + Intergenic
981921339 4:150087960-150087982 GAATGGGACTAGCAGCCAGGAGG + Intronic
981921381 4:150088526-150088548 GAGGACTGCTAGAGGCCAGGAGG - Intronic
985276662 4:188244291-188244313 GGGTGATACCAGAGGCCAGGAGG - Intergenic
985751648 5:1682077-1682099 GAGGGACACTAGAGACCAGGAGG - Intergenic
988652894 5:33172961-33172983 GAGAAATACTAGAGGCTAGGAGG + Intergenic
991389469 5:66126711-66126733 GAGGGTCACTGGAGGCCAGGAGG + Intergenic
992547836 5:77832483-77832505 CAGTGGGACTAGAGGCGAGGAGG - Intronic
994222932 5:97217355-97217377 GAGGGTTACTTGAGCCCAGGAGG + Intergenic
994362467 5:98868235-98868257 GAGGGGCACTTGAGCCCAGGAGG + Intronic
995004247 5:107171805-107171827 GAGGATTACTTGAGGCCAGGAGG + Intergenic
997177457 5:131794140-131794162 GAGGATTACTAGAGCCCAGGAGG + Intronic
997222508 5:132181164-132181186 GCGTGTTCCTAGAGGTCAGGTGG - Intergenic
998305066 5:141067797-141067819 GAGTATTGCTTGAGGCCAGGAGG - Intergenic
1000268101 5:159657556-159657578 GAGTGGAACTCCAGACCAGGGGG + Intergenic
1001200331 5:169710249-169710271 CAGTGGAAATGGAGGCCAGGTGG + Intronic
1004069616 6:12287025-12287047 GAGTGTCACTTGAGCCCAGGAGG + Intergenic
1005870860 6:29973849-29973871 CAGTGGTTCCAGGGGCCAGGGGG + Intergenic
1006596018 6:35192863-35192885 GGATGGGACTGGAGGCCAGGAGG - Intergenic
1007746186 6:44044163-44044185 GAGTGGGACTGGAGGCCTGGAGG - Intergenic
1010873993 6:81078458-81078480 TAGAGGCACTTGAGGCCAGGAGG - Intergenic
1014852725 6:126361684-126361706 GAGTGGTGCTAGTGACCAAGGGG - Intergenic
1016782633 6:147976754-147976776 GAGTGGAACTGGAGGCCCGAAGG + Intergenic
1018354790 6:163001295-163001317 GAGTGGTGCTACTGGCCACGGGG + Intronic
1018389679 6:163332489-163332511 GAGTTGGATTAGTGGCCAGGGGG - Intergenic
1018390846 6:163340806-163340828 GAGTGGGATTAGAAGACAGGAGG - Intergenic
1019776586 7:2915203-2915225 GAGTGGTGGGAGGGGCCAGGCGG + Intronic
1020089699 7:5332341-5332363 GAGGACTGCTAGAGGCCAGGAGG + Intronic
1020656208 7:10930712-10930734 GAGGATTACTTGAGGCCAGGAGG + Intergenic
1022782328 7:33599028-33599050 TAGTGGTACCAGAGACCAGATGG + Intronic
1022791465 7:33693430-33693452 CAGTGGTACTAAAGGTTAGGAGG + Intergenic
1024201127 7:47106706-47106728 GTGTGGTGCTAGAAGTCAGGAGG - Intergenic
1024466992 7:49721981-49722003 GGGGGATACTAGAGGACAGGAGG - Intergenic
1024721396 7:52140828-52140850 GAGTGGTAGAAGAGGTCAGAGGG - Intergenic
1026520853 7:71116966-71116988 GAGAGGTCCTTGAAGCCAGGAGG - Intergenic
1026914210 7:74110121-74110143 GAGGGTCACTAGAGGTCAGGAGG + Intronic
1027393408 7:77727688-77727710 GAGGTGTACTTGATGCCAGGAGG - Intronic
1027469467 7:78555047-78555069 GAGGGTTACTTGAGTCCAGGAGG + Intronic
1028844416 7:95463255-95463277 GAGGGTCACTTGAGGCCAGGAGG - Intergenic
1031214600 7:118873951-118873973 GAGTGGGGCTAGAGGGAAGGTGG - Intergenic
1032724588 7:134578961-134578983 GAGTTGGATTTGAGGCCAGGTGG - Intronic
1036512633 8:9414617-9414639 GAGTGTGACTCCAGGCCAGGAGG - Intergenic
1037807388 8:22066371-22066393 GAGTGGGACCAGCGGCCGGGAGG + Intronic
1037876339 8:22550720-22550742 GACTGGTGCCAGAGGCCACGAGG - Intronic
1038806028 8:30792531-30792553 GAGGGTCACTTGAGGCCAGGAGG - Intronic
1039202916 8:35116594-35116616 GAGGGCTACTAGAGGGCAGAGGG - Intergenic
1039819386 8:41122695-41122717 GAGTATTCCTTGAGGCCAGGAGG - Intergenic
1042544576 8:69939828-69939850 GAGGTGTGTTAGAGGCCAGGCGG - Intergenic
1047773688 8:128050842-128050864 GAATGGAACTTGAGGACAGGTGG - Intergenic
1048383690 8:133891380-133891402 GAGGGTTGCTTGAGGCCAGGAGG - Intergenic
1048949963 8:139488398-139488420 TGGTGGTTCCAGAGGCCAGGAGG + Intergenic
1052409101 9:28099843-28099865 GAGTTGAACAAGAGGACAGGAGG - Intronic
1053656526 9:40222629-40222651 GAGCGGACCTTGAGGCCAGGTGG + Intergenic
1054152348 9:61615730-61615752 GAGTGGTACGAGGGGCCACGTGG + Intergenic
1054356939 9:64071072-64071094 GAGCGGAACTTGAGGCCAGGTGG + Intergenic
1054368629 9:64368851-64368873 GAGCGGACCTTGAGGCCAGGTGG + Intergenic
1054528090 9:66153656-66153678 GAGCGGACCTTGAGGCCAGGTGG - Intergenic
1054676257 9:67858603-67858625 GAGCGGACCTTGAGGCCAGGTGG + Intergenic
1054935099 9:70678355-70678377 GAGTAGCACTTGAGCCCAGGAGG - Intronic
1055511640 9:77000977-77000999 GAGTGTCACTTGAGCCCAGGAGG - Intergenic
1057472623 9:95371377-95371399 GAGGATTACTTGAGGCCAGGAGG - Intergenic
1058661930 9:107274462-107274484 GAGGGTTACTTGAGCCCAGGAGG - Intergenic
1060636692 9:125204915-125204937 GAAGGTTACTTGAGGCCAGGAGG - Intronic
1061692614 9:132345927-132345949 GAGTATTACTTGAGCCCAGGAGG + Intronic
1062271753 9:135713040-135713062 GACTGGGCCTTGAGGCCAGGAGG + Intronic
1062608295 9:137358776-137358798 GAGGGTCACTTGAGGCCAGGAGG - Intronic
1203748484 Un_GL000218v1:57811-57833 GAGCGGAACTTGAGGCCAGGTGG + Intergenic
1203561241 Un_KI270744v1:60209-60231 GAGCGGAACTTGAGGCCAGGTGG - Intergenic
1187461982 X:19495411-19495433 GAGTGGTACTCGTTGCCTGGGGG + Intronic
1187464296 X:19514692-19514714 GAGGGGGACTAGAGACGAGGGGG + Intronic
1187690676 X:21863176-21863198 GAGTGTTGCTTGAGCCCAGGAGG + Intronic
1190321824 X:49184317-49184339 GAGGGGTGCTGGAGGCCAGAGGG + Intronic
1191752390 X:64557029-64557051 GAGGAGTACTTGAGACCAGGAGG + Intergenic
1194763658 X:97824048-97824070 GAGAGTTATTAAAGGCCAGGAGG - Intergenic
1195717454 X:107830369-107830391 GGCTGCTAGTAGAGGCCAGGGGG + Intronic
1196704966 X:118709575-118709597 GAGGAGTGCTTGAGGCCAGGAGG + Intergenic
1201161827 Y:11172781-11172803 GAGCGGAACTTGAGGCCAGGTGG + Intergenic
1201370857 Y:13262651-13262673 GAGTGTTGCTTGAGCCCAGGAGG - Intronic
1201390110 Y:13489017-13489039 TAGTGGTAGCAGTGGCCAGGTGG + Intergenic