ID: 929527138

View in Genome Browser
Species Human (GRCh38)
Location 2:42715181-42715203
Sequence AAGTGGCAGCATTGTTGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 188}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929527131_929527138 28 Left 929527131 2:42715130-42715152 CCCTGTTGAAGTGGAGTTAGGTG 0: 1
1: 0
2: 0
3: 7
4: 150
Right 929527138 2:42715181-42715203 AAGTGGCAGCATTGTTGGCCTGG 0: 1
1: 0
2: 0
3: 15
4: 188
929527132_929527138 27 Left 929527132 2:42715131-42715153 CCTGTTGAAGTGGAGTTAGGTGA 0: 1
1: 0
2: 1
3: 12
4: 133
Right 929527138 2:42715181-42715203 AAGTGGCAGCATTGTTGGCCTGG 0: 1
1: 0
2: 0
3: 15
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929527138 Original CRISPR AAGTGGCAGCATTGTTGGCC TGG Intronic
900737913 1:4310708-4310730 AGGTGACAGCAATGGTGGCCAGG + Intergenic
900967923 1:5972244-5972266 AAGTCTCTGCATTGTTTGCCTGG - Intronic
901315641 1:8305942-8305964 GAGAGGTAGCATTGTGGGCCTGG - Intergenic
902121855 1:14173035-14173057 AAGTGGCAGAAGTGGTGCCCTGG - Intergenic
903742007 1:25563770-25563792 GAGTGGCAGCAGTGTTGTCTGGG + Exonic
903958958 1:27044629-27044651 AAGTTGGAGAAGTGTTGGCCTGG + Intergenic
905116269 1:35643478-35643500 AAGTGGAGACATTGTTGGGCCGG + Intergenic
905318644 1:37099770-37099792 AAGAGGCAGCATTGTGGAGCAGG - Intergenic
905537416 1:38733818-38733840 AAGTAGACGCATTGTTTGCCAGG - Intergenic
915269520 1:154743556-154743578 AAGTGGCACCATTGTAAGTCAGG - Intronic
917312684 1:173693105-173693127 GAGTTTCACCATTGTTGGCCAGG - Intergenic
917486524 1:175459787-175459809 ATGTGGCAGTATTGCTGGCTAGG - Intronic
920156637 1:203957381-203957403 AGGTTTCACCATTGTTGGCCAGG + Intergenic
920303006 1:205000958-205000980 AAGCTGCAGCCTTGGTGGCCAGG - Intronic
921218652 1:212957893-212957915 AAGTGTAAGCTGTGTTGGCCAGG - Intronic
921541045 1:216415971-216415993 GAGTTTCACCATTGTTGGCCAGG - Intronic
921881064 1:220254460-220254482 AAGTTGCAGAATTCTTTGCCAGG - Intronic
1064065993 10:12181945-12181967 TAGAGGCAGTGTTGTTGGCCAGG - Intronic
1064871654 10:19944653-19944675 AAATAGAAGCATTGGTGGCCGGG + Intronic
1065047936 10:21760878-21760900 AAGAGGCAGTATTTTAGGCCAGG + Intronic
1065777126 10:29131263-29131285 AAGTGGTACCATTCTTGGCCAGG + Intergenic
1066346343 10:34590664-34590686 AAGTGTGATCATTGTTGGACAGG - Intronic
1066520452 10:36212692-36212714 AAGTGGCAGCATTGTAGTGGAGG - Intergenic
1068657781 10:59592719-59592741 GAGTGGCAGCCTTATTGGGCGGG + Intergenic
1068832227 10:61508470-61508492 GAGTTTCATCATTGTTGGCCAGG - Intergenic
1070662628 10:78318429-78318451 CAGTGCCAGCACTGTTGGCAGGG - Intergenic
1072060287 10:91803319-91803341 AGGTGTCACCATTGTTGCCCAGG - Intronic
1072693535 10:97586933-97586955 AAGTGGCAGGATTCTTGCCCAGG - Intronic
1072782798 10:98261725-98261747 AAGAGGCAGCAATTGTGGCCAGG + Intronic
1074813204 10:117125760-117125782 GAGTGGGAGCATTATTGGCAGGG - Intronic
1075222290 10:120595591-120595613 AAGTGGCAGAGATGTTGGCAGGG - Intergenic
1076307619 10:129476063-129476085 AAGTGACAGCAGTGATGTCCAGG - Intronic
1076656503 10:132027361-132027383 ACGTGGCAGCACTGATGCCCTGG + Intergenic
1076776183 10:132699483-132699505 ATGTGGCTGCATTGCTGTCCAGG + Intronic
1078089221 11:8253682-8253704 AAGTGGGAGCAGTGCTGGCCTGG - Intronic
1078664623 11:13314295-13314317 AAGTGCCAGCATAGTTTACCTGG + Intronic
1079783688 11:24642925-24642947 AATTAGCAGGATTGTTGCCCTGG + Intronic
1079963294 11:26950302-26950324 AACTGGCAGTCTTGCTGGCCTGG + Intergenic
1080393406 11:31868759-31868781 AAGTGGGAGGATATTTGGCCTGG - Intronic
1081983674 11:47286249-47286271 CAGTGGCTCCATTGTTTGCCTGG + Intronic
1083634456 11:64112782-64112804 ATGTGGCACCCCTGTTGGCCTGG - Intronic
1084309306 11:68307369-68307391 AAGTGGTAGGATTATAGGCCGGG + Intergenic
1084492326 11:69485670-69485692 AGGGGTCAGCATTGCTGGCCAGG - Intergenic
1085249992 11:75136752-75136774 AAATGGCAGCATTGGCAGCCAGG - Intronic
1085551560 11:77378101-77378123 AAATGGCAGTATTGTTGGGAAGG - Intronic
1086066001 11:82745460-82745482 AAGTGGCAGGAGAGGTGGCCAGG + Intergenic
1086331324 11:85757033-85757055 AAGTGGCAGGAATGTTGACATGG + Intronic
1087795697 11:102452951-102452973 AAATGGCAGTTTTGTTGTCCTGG + Exonic
1091585626 12:1814720-1814742 AAGTGAGAGCAATGTTGGCTTGG - Intronic
1092846979 12:12592695-12592717 AGGTTTCACCATTGTTGGCCAGG - Intergenic
1093014546 12:14143154-14143176 AGGTTTCACCATTGTTGGCCAGG + Intergenic
1095474087 12:42567530-42567552 AAGTATAAGCATTATTGGCCAGG + Intronic
1096517905 12:52168011-52168033 ACGTGGCAGCATTTGTGTCCTGG - Intergenic
1097154362 12:57002064-57002086 AAGTGGCAGCCTGGATGGACAGG - Exonic
1103367288 12:120392593-120392615 AAGTGCTAGGATTATTGGCCAGG + Intergenic
1104457238 12:128924989-128925011 AAGAAGCAGCATTGTTTCCCAGG - Intronic
1106684212 13:32040721-32040743 AAGTGCCAGTATTCTTGGTCTGG + Intronic
1106912613 13:34479110-34479132 AGGTGGCAGCAGGCTTGGCCAGG + Intergenic
1107437041 13:40389365-40389387 AAGAGGCACCATTGTAGGTCAGG - Intergenic
1109569270 13:64164671-64164693 CACTGGTAGCAGTGTTGGCCTGG + Intergenic
1113984562 13:114303488-114303510 AAGAAGCAGAATTGTCGGCCCGG + Intronic
1114838121 14:26228553-26228575 GAGTTTCATCATTGTTGGCCAGG - Intergenic
1120185361 14:81388295-81388317 AAGTGCCATCACGGTTGGCCAGG - Intronic
1120216248 14:81683475-81683497 AAATGGTTGCATTCTTGGCCAGG - Intergenic
1124799242 15:32813906-32813928 AAGGGGCAGCATTTTTCTCCAGG + Intronic
1128768763 15:70266634-70266656 TTGTGGCAACACTGTTGGCCAGG - Intergenic
1128938086 15:71765134-71765156 AGGTGGCAGGATTGCTGGCTGGG - Exonic
1129166987 15:73784311-73784333 AAGTGTGAGCACTGTTGTCCTGG - Intergenic
1129864707 15:78896986-78897008 AAGTTGCAGAATTCTTTGCCAGG - Exonic
1132713872 16:1280977-1280999 AAGTTGCAACATTCTGGGCCTGG + Intergenic
1135196576 16:20399707-20399729 AAGTGGGGGCATTGTAGGCAGGG - Intronic
1138203358 16:55106312-55106334 AAGTAGCAGCATTTTTGACTTGG + Intergenic
1139582530 16:67881883-67881905 CGGGGGCAGCATTCTTGGCCTGG + Intronic
1141875364 16:86820345-86820367 CAGTGGCAGCATTGATCTCCTGG - Intergenic
1142787436 17:2235146-2235168 AAGTGGCAGCACTGGTTTCCAGG - Intronic
1143018937 17:3906424-3906446 AAGAAGTACCATTGTTGGCCGGG - Intronic
1144810142 17:17993788-17993810 AGGTGCCAGCATTCCTGGCCAGG + Intronic
1146702516 17:34973589-34973611 AGGTGGCAGCATGGGTGGTCAGG + Intronic
1147022939 17:37553247-37553269 TGGTGGCAGCAGTGTTGGCAAGG - Exonic
1147687002 17:42292198-42292220 AGGTGGCAGCATTGCACGCCGGG + Intronic
1149720246 17:58836724-58836746 AAGTGCCAGGATTATTGGCCGGG + Intronic
1150634575 17:66903965-66903987 CAATGGCAGCATTCATGGCCAGG + Intergenic
1151331271 17:73410610-73410632 AAGAAGCAGCATTATCGGCCGGG - Intronic
1153576302 18:6525080-6525102 AAGTGAAATGATTGTTGGCCAGG + Intronic
1158958832 18:62570244-62570266 AAGTGGGAGTATTGTTGGCATGG + Intronic
1163798830 19:19352954-19352976 AGGTGGCAGCCTTGGGGGCCGGG + Intronic
1165650694 19:37486014-37486036 GAGTTGCAGCCTTGTTGCCCAGG - Exonic
1166398721 19:42462042-42462064 AAGAAGCAGAATTGTGGGCCAGG + Intergenic
1167480073 19:49724737-49724759 AAGAAACATCATTGTTGGCCGGG - Intergenic
1168609011 19:57784101-57784123 AGGTTTCACCATTGTTGGCCAGG + Intronic
926157207 2:10462984-10463006 AGGTGCCAGCAATCTTGGCCAGG + Intergenic
928223295 2:29423375-29423397 AAGGGCCCACATTGTTGGCCAGG - Intronic
928412655 2:31066725-31066747 CAGTGGTGGCAGTGTTGGCCTGG - Intronic
929258360 2:39838662-39838684 AGGTGCCAGCAGTGTTGGACTGG + Intergenic
929527138 2:42715181-42715203 AAGTGGCAGCATTGTTGGCCTGG + Intronic
929595106 2:43170732-43170754 GAGTGGCTGCATTGCTGGCAGGG + Intergenic
930633276 2:53777849-53777871 AAGTGTAAGCAATCTTGGCCAGG + Intronic
930699439 2:54444695-54444717 AAGTTGCAGAGTGGTTGGCCTGG - Intergenic
932234495 2:70110103-70110125 AAGTGGCTGCCGTGTTGGACAGG - Intergenic
932279810 2:70480860-70480882 AAGAGGCAGGAATGTTGGCATGG - Intronic
932576793 2:72966795-72966817 AAGAGGAAGCACTGTGGGCCTGG - Intronic
937543551 2:122988686-122988708 CAGTGGCTGCACTGCTGGCCAGG - Intergenic
938096631 2:128468187-128468209 CACTAGCAGCATTTTTGGCCTGG + Intergenic
941893389 2:170605560-170605582 AAGTGGCATCATGTTTGGCCGGG + Intronic
942893697 2:181022990-181023012 AAGTGGAACCACTGTTGGTCGGG - Intronic
944832179 2:203543853-203543875 AGGTTTCAGCAATGTTGGCCGGG - Intergenic
945335876 2:208592205-208592227 AATTGGCAGCATGGGTGGGCAGG + Intronic
1170298623 20:14857244-14857266 AAGTGGGAGCATTCTTGGTCAGG - Intronic
1170614787 20:17939802-17939824 AAGTCACAGCCTTTTTGGCCTGG + Intergenic
1171204224 20:23266705-23266727 AAGTGGATGCATGCTTGGCCTGG - Intergenic
1172114739 20:32567019-32567041 AAGGGGCAGCATTTGTGTCCTGG + Intronic
1172516973 20:35541927-35541949 GCGTGGCAGCATCGTTGGGCGGG + Intergenic
1173205589 20:40990845-40990867 AAGTGGCAGCAAAGCTGGCTGGG + Intergenic
1175869138 20:62199348-62199370 AAAATGTAGCATTGTTGGCCAGG + Intronic
1176311122 21:5150131-5150153 GAGTTTCATCATTGTTGGCCAGG - Intronic
1179845930 21:44111904-44111926 GAGTTTCATCATTGTTGGCCAGG + Intronic
1180878843 22:19189394-19189416 AAGTGGCAGCAAGGTTGGAGAGG - Intronic
1181765962 22:25092424-25092446 AAGTGGGAGCCTTGTGGGCCAGG + Intronic
1183347078 22:37313798-37313820 AAGTTGCAGCATTCTGGGGCTGG - Exonic
1184425484 22:44406763-44406785 AAGTGGCAGCAGGGCTAGCCAGG + Intergenic
1185291864 22:50031313-50031335 AAGGAGCAGCATAGGTGGCCTGG + Intronic
951606768 3:24442987-24443009 GAGTTTCACCATTGTTGGCCAGG - Intronic
952143466 3:30504918-30504940 TAGAGGCGGCCTTGTTGGCCAGG + Intergenic
952828616 3:37544830-37544852 AAGAGGCAACATTGTTGCCAAGG + Intronic
953246621 3:41199517-41199539 CTGTGGCAGCAGCGTTGGCCCGG + Exonic
960088288 3:113613693-113613715 AATTGGGAGCATTGTTGTTCTGG + Intronic
961613543 3:128160542-128160564 AAGTTGCAGGATTGCTGGGCAGG + Intronic
962868468 3:139467382-139467404 AAGTAGGAGCTCTGTTGGCCAGG + Intronic
962991420 3:140580781-140580803 AAGTGGCAGCATTTTATCCCTGG - Intergenic
964670569 3:159220652-159220674 AAGTGGCTGCTCTGTTGTCCTGG + Intronic
965950217 3:174299568-174299590 GGGTTTCAGCATTGTTGGCCAGG - Intergenic
967900998 3:194452161-194452183 CAGTGTCAACCTTGTTGGCCAGG - Intronic
968839035 4:2987643-2987665 CAGAAGCAGAATTGTTGGCCAGG + Intronic
970460116 4:16266170-16266192 AAGTAGCATTATTATTGGCCTGG + Intergenic
970743290 4:19263730-19263752 TAGTGGGTGCATTGCTGGCCTGG - Intergenic
972675233 4:41254103-41254125 AAATGGCAGAATTCTTAGCCAGG - Intergenic
973684901 4:53359830-53359852 TAGTGGCATTATTGTTGGCAAGG - Intronic
979649652 4:123114890-123114912 CAGTGGCAGCACCTTTGGCCAGG + Intronic
982878956 4:160686328-160686350 CAGTGGCAGCAATGGTGGCATGG - Intergenic
983916765 4:173300771-173300793 AAGTCCAAGCAGTGTTGGCCTGG + Intronic
983948765 4:173615995-173616017 AAGTTGCAGAATTCTTTGCCAGG + Intergenic
984492899 4:180457983-180458005 GAGTTTCACCATTGTTGGCCAGG + Intergenic
984660350 4:182367537-182367559 AAGTGGTAGCAGTGTTGACAGGG + Intronic
989342443 5:40391146-40391168 AAGTGGAAAGAATGTTGGCCTGG - Intergenic
989595684 5:43154118-43154140 AAGTGTCAGCATGGTGGGGCGGG + Intronic
990824422 5:59881410-59881432 AAGTGGCACCATGGATTGCCAGG - Intronic
992113942 5:73521971-73521993 AAGGTCCAGCATTGCTGGCCAGG + Intergenic
992834826 5:80629967-80629989 AAAATGTAGCATTGTTGGCCAGG + Intronic
997155585 5:131552754-131552776 AAGTTGCATTTTTGTTGGCCTGG - Intronic
997441299 5:133910425-133910447 AAGAGGCTGCAATGGTGGCCTGG - Intergenic
1001932738 5:175684702-175684724 AAGTGGCAGCATTGGTGACATGG - Intronic
1002324770 5:178397126-178397148 CAGTGGCAGCATGGCTGGGCTGG + Intronic
1002396644 5:178961518-178961540 AATTAACAGCATTTTTGGCCAGG + Intronic
1004161413 6:13217180-13217202 AACTCTCAGCATTGTTGTCCAGG + Intronic
1005736796 6:28755486-28755508 AAATGACAGAATTGGTGGCCAGG + Intergenic
1013287037 6:108690747-108690769 AAGTGTCAGCTTTGGAGGCCTGG - Intergenic
1014322847 6:119952479-119952501 AAGTGGCAACAAGGTAGGCCGGG - Intergenic
1015720506 6:136236322-136236344 AAGTGTCATCATTCATGGCCAGG - Intronic
1015909065 6:138148472-138148494 AATTAGCAGCATTGTTGACTGGG - Intergenic
1016427295 6:143948261-143948283 GAGAGGCAGCATCGTGGGCCTGG + Exonic
1018847549 6:167566123-167566145 AAGTGACAGGAGTGCTGGCCAGG - Intergenic
1019621190 7:1992850-1992872 AGGTGACACCATTGTGGGCCTGG + Intronic
1019630845 7:2048909-2048931 AAATGGCAGCATGGTTGACGCGG - Intronic
1019747330 7:2708307-2708329 AAGCGCCAGTCTTGTTGGCCCGG + Intronic
1019803207 7:3103857-3103879 AAATGGGAGCAGTGTTGGCTCGG - Intergenic
1019933794 7:4241337-4241359 AAGTGTATGCATTCTTGGCCAGG + Intronic
1023717356 7:43057826-43057848 AGGTTTCACCATTGTTGGCCAGG + Intergenic
1023981483 7:45073185-45073207 AGTGGGCAGCATTGTTGGGCAGG - Intronic
1024620123 7:51149814-51149836 AAATAGCACCTTTGTTGGCCAGG + Intronic
1025022159 7:55488528-55488550 AATTGGCAGCATTGTGGTCCTGG - Intronic
1025868856 7:65411650-65411672 AAGGAGCAGCAGTGATGGCCAGG + Intergenic
1026144800 7:67737456-67737478 AAGTGTCAGCAGAGGTGGCCTGG + Intergenic
1030116972 7:106069409-106069431 GAGTGGCAGCATTTTTGCACTGG + Intergenic
1030971100 7:116056513-116056535 AAATGGCACCATTCTTGGCCTGG - Intronic
1031600403 7:123700731-123700753 AAGAGGTAGAATAGTTGGCCGGG - Intronic
1033705917 7:143885021-143885043 AAGTGGTCGCGTTTTTGGCCTGG - Intronic
1034292689 7:149945392-149945414 AACTGGAAGCATTGATGGCGGGG + Intergenic
1034820639 7:154213356-154213378 AAGTTGCAGCCTTCATGGCCTGG - Intronic
1035016401 7:155770158-155770180 AAGTGCCAGAATTGGTGTCCAGG + Intronic
1039855357 8:41407392-41407414 AAGTGGCACCATGGGTGGCATGG - Intergenic
1041167998 8:55110324-55110346 AAGTGACAGCATGGCTGGTCAGG + Intronic
1041617613 8:59926462-59926484 AAGTGGCATGATTGTTGGAAAGG + Intergenic
1044029705 8:87221019-87221041 AAGGGGCAGCCTGCTTGGCCAGG - Intronic
1045570563 8:103364739-103364761 AGGTGGGAGGATTGTTGACCAGG + Intergenic
1046346768 8:112939251-112939273 AAGTGGCATCAGTGTTGGAATGG + Intronic
1049361752 8:142215378-142215400 AGGTGGCAGCAATGGTGGTCAGG + Intronic
1051495872 9:17722146-17722168 AAGTGGCAGGATTGATACCCAGG + Intronic
1052092943 9:24352087-24352109 AAATGTCACCATTGTTTGCCAGG - Intergenic
1055667413 9:78566594-78566616 ATGTGGCAGCTGTGTGGGCCTGG - Intergenic
1057312156 9:93949335-93949357 GAGTGGCAGCTTTGTGGGCTAGG + Intergenic
1057431015 9:94994035-94994057 AAGTGGCAGCATGCGTGGCTCGG - Intronic
1058402971 9:104638011-104638033 AACTGGCAGCAGTGGTGGCAAGG - Intergenic
1060294479 9:122333874-122333896 AAATGGAGCCATTGTTGGCCAGG + Intergenic
1062504171 9:136864916-136864938 AAGTGGTAGAAATGTTGGCCGGG - Intronic
1186768417 X:12793789-12793811 AAATGGGAGGATTGATGGCCAGG - Intronic
1189418616 X:40835823-40835845 AAGTGGTTCCTTTGTTGGCCTGG - Intergenic
1191822499 X:65328047-65328069 AAGTTGCAGAATTCTTTGCCAGG + Intergenic
1195273113 X:103252700-103252722 AAGAGGCAGCAGTGTTGGGCAGG + Intergenic
1195281016 X:103332602-103332624 AAGAGGCAGCAGTGTTGGGCAGG - Intergenic
1196654038 X:118198325-118198347 AAGAGGCATCATTCTTGTCCAGG - Intergenic
1196692997 X:118580610-118580632 AAGAGAAAGCATTCTTGGCCGGG - Intronic
1198870805 X:141176166-141176188 AAGTGGCAGCATAGTTCTCTGGG + Exonic
1199620280 X:149694745-149694767 AAGTGTCACCCTTGTTGCCCAGG + Intronic
1201957871 Y:19646117-19646139 AAGTGGCAACATTTTTGCCCGGG + Intergenic