ID: 929527213

View in Genome Browser
Species Human (GRCh38)
Location 2:42716031-42716053
Sequence GAAGCAACCCAAAGCCTGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 144}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929527213 Original CRISPR GAAGCAACCCAAAGCCTGTA AGG (reversed) Intronic
900929893 1:5729883-5729905 GAAGCATCCCCAAGTCTGAAAGG + Intergenic
901289821 1:8115400-8115422 AATGCAACCCAAAGCCTCTTCGG - Intergenic
901467691 1:9433208-9433230 GAAGCAGTCCATAGCCTGTTAGG - Intergenic
901701243 1:11045688-11045710 GCAGCGACCCTAGGCCTGTAAGG - Intronic
902322916 1:15681554-15681576 GAAGAATCCCAAAGCTTGTTGGG + Intergenic
905417478 1:37814102-37814124 GGGGCAACCCAAAGCCTGGCTGG + Exonic
906434221 1:45781315-45781337 GAAGAAACCCAAAGCCAAGAAGG + Intergenic
906884721 1:49631914-49631936 GAAGCAACCTACAGGATGTATGG + Intronic
907810418 1:57864223-57864245 GAAGAAACACAAGGCCTGTTAGG + Intronic
910125948 1:83842605-83842627 GAAGAAATACAAAGGCTGTATGG - Intergenic
912245267 1:107955478-107955500 CAATCAAGCCAAAGCCTGGAAGG + Intronic
913270052 1:117084308-117084330 GATACAACGCAAAGGCTGTATGG - Intronic
915283221 1:154836802-154836824 GAAGCAGCCCTGAGCCTGGAGGG - Intronic
915748485 1:158182953-158182975 GATTCTACCCAAAGCCTGTATGG + Exonic
916115612 1:161482578-161482600 CAAGCAAACCAAAGCATGTGTGG - Intergenic
916750544 1:167719803-167719825 GAAGAAACCCAAGGCCAGCAGGG - Intergenic
918075839 1:181170841-181170863 GAGGCTACCAGAAGCCTGTAGGG + Intergenic
919960225 1:202459852-202459874 CAAGCAATCCAAAGACTGAATGG - Intronic
921190010 1:212700189-212700211 GAAGGACCCCAAAGGCTGCATGG - Intergenic
921900128 1:220441253-220441275 GAAGGAACCCAAATCTTGTGTGG + Intergenic
923609094 1:235473585-235473607 GAGGCAACTCAAAGCATGTCTGG + Intronic
924117715 1:240763775-240763797 TAAGGAACACAAAGCCTGTTTGG + Intergenic
924216911 1:241831970-241831992 GAAGAAACCCAAAGCCAAGAAGG + Intergenic
924709909 1:246523245-246523267 GAAGCCCCCCACACCCTGTATGG - Intergenic
1064237779 10:13592263-13592285 GAAGAAACCCAAAGCCAAGAAGG - Intronic
1064628665 10:17286814-17286836 GGAGCAACCCAGAGAGTGTATGG + Intergenic
1064670147 10:17705408-17705430 GAAGCAACCCAAACTGTTTAAGG - Intronic
1065656378 10:27955849-27955871 GAAGAAACCCAAAACCTGCCAGG + Intronic
1069050861 10:63792069-63792091 GAAGAAATCCAAAACCTGAATGG + Intergenic
1069565120 10:69458876-69458898 GAACCAACCCAAAGGCAGCAAGG - Intronic
1069725335 10:70573904-70573926 AAAGCAACCCAAAGCAAGCAGGG - Intergenic
1069932225 10:71890551-71890573 TAAGAAACCCTAAGCCTCTATGG + Intergenic
1070522010 10:77262148-77262170 GAAGCAACCCAAAGTGTCCATGG + Intronic
1071498355 10:86186106-86186128 GAAGAAACAGAAAGCCTGAATGG - Intronic
1071676202 10:87658844-87658866 GAACGAACCCAAAGGCAGTATGG - Intergenic
1072114891 10:92361217-92361239 GAAGAAATCCAAAACCTGAATGG - Intergenic
1073222220 10:101884468-101884490 GAAACAAGCCAAATCCAGTAAGG + Intronic
1074089029 10:110229353-110229375 GAAGCTCCCCAAAGCCTTCAGGG - Intronic
1074567303 10:114592242-114592264 GAAGAAACCCAAAGGAGGTATGG + Intronic
1075380359 10:122013759-122013781 GAAGCAATTCAGAGCCTGTAGGG + Intronic
1075911021 10:126125935-126125957 GAAGCCACCCAAAGCGAGGAGGG + Intronic
1081483029 11:43506609-43506631 GATGCAATCCAGAGCCTGTGGGG + Intergenic
1085304414 11:75477025-75477047 GAAGGAACCCAATTCCTGTGTGG - Intronic
1086835818 11:91620910-91620932 GAAGAAATCCAAAACCTGAATGG + Intergenic
1087903543 11:103669882-103669904 GAAGCAACCAAAAGTATGGAGGG - Intergenic
1089834405 11:121357489-121357511 GGAGAAAACCAAAGCCTGCAGGG + Intergenic
1092777180 12:11953926-11953948 GAATCAAGCCAAACCCTGAAAGG + Intergenic
1097962494 12:65546165-65546187 GCAGCAGCCCACAGCCTGTCAGG + Intergenic
1105206629 13:18231152-18231174 GCAGCTGGCCAAAGCCTGTAAGG + Intergenic
1106618983 13:31355861-31355883 GTATCTACCCAATGCCTGTATGG + Intergenic
1110738971 13:78972160-78972182 GAAGCAAACCAAACTTTGTAGGG + Intergenic
1112724186 13:102283021-102283043 CAATCAGCCCAAAGCTTGTATGG + Intronic
1117457749 14:55914686-55914708 AAAGCAGCCCAGAGCTTGTATGG + Intergenic
1119357627 14:74019879-74019901 GCAGCAACTCCAGGCCTGTAAGG - Intronic
1120579928 14:86233986-86234008 GAAGAAACCCAAAACCTGAATGG + Intergenic
1127209707 15:56760590-56760612 GTAGCAAACTAAAGCCTGGAAGG - Intronic
1131455239 15:92578546-92578568 GAAGACCCCCAAAGCCTGTGAGG + Intergenic
1133658599 16:7891757-7891779 TTTGCAACCAAAAGCCTGTATGG + Intergenic
1138209664 16:55152864-55152886 CAAGCAAGCCAAAGACTGCAGGG - Intergenic
1138978568 16:62239017-62239039 GAAAAAACCCAAAACCTGTGAGG + Intergenic
1140526602 16:75628383-75628405 GAAAAAACCCAAATCCTTTAAGG + Intronic
1140648415 16:77060405-77060427 GAAGAAACACAAAGCATGGATGG + Intergenic
1140892726 16:79298796-79298818 GAAGCCCTCCAAAGCCTGCAAGG - Intergenic
1140934782 16:79660332-79660354 GAAGCAACCCAAATGGTGAATGG + Intergenic
1141178644 16:81737646-81737668 GATGAAAACCAAAGCCTGGATGG + Intergenic
1142484407 17:237317-237339 GAACAAATCCAAAACCTGTAAGG + Intronic
1143271417 17:5678299-5678321 GATGCTACACAAAGCCTGCAGGG - Intergenic
1145310721 17:21699891-21699913 CAAGCAGCTCAAAGCCTGCAAGG - Intronic
1145981214 17:29012856-29012878 GAGGCCACCCAAGGCCTGTCAGG + Intronic
1150171859 17:63004786-63004808 GAAGGTACCCAAAGCGGGTAAGG - Intergenic
1153481616 18:5553165-5553187 GAAGCTACTAAAAGACTGTAAGG + Intronic
1154012641 18:10588990-10589012 GAAGCAAACAACAGCCTGGAAGG - Intergenic
1157598713 18:48879417-48879439 GAAGCCACCCACAGCTTGTTGGG - Intergenic
1159261045 18:66013391-66013413 AAAGAAACACAAAACCTGTATGG - Intergenic
1165470233 19:35999181-35999203 GAGGCAACCCTCAGCCTGTAGGG + Intergenic
1165622759 19:37262217-37262239 GAAGGGACCTGAAGCCTGTAGGG - Intergenic
1165971039 19:39629956-39629978 GAAGCAACCTCAACCCTGTCTGG - Intergenic
925499905 2:4490930-4490952 GAAGCAACTCACATCTTGTATGG - Intergenic
929463930 2:42128017-42128039 GTAGCAGCCCAAAGCCTGTGTGG - Intergenic
929527213 2:42716031-42716053 GAAGCAACCCAAAGCCTGTAAGG - Intronic
929606642 2:43239192-43239214 GAAGCAAACCAGAGCCTTCAGGG + Intronic
929652056 2:43689924-43689946 GTGGCAACCCAATGTCTGTAGGG + Intronic
934114478 2:88772722-88772744 AAAGCAACCCAAAGCCTAATGGG + Intergenic
934801347 2:97164146-97164168 AAAGCAACCCAAAGCCTAATGGG + Intronic
937263592 2:120601872-120601894 GATGCAACCCAAAGTCTCTTCGG - Intergenic
937647889 2:124286129-124286151 GAAGAAACCAAAAGCCGGAAAGG + Intronic
939813580 2:146866538-146866560 GTAGCAACACAAAGCCTGTTAGG + Intergenic
941731457 2:168922417-168922439 GAATGGACCAAAAGCCTGTATGG - Intergenic
942053961 2:172165306-172165328 TAAGGAACACAAAGCCTGTTTGG - Intergenic
942144284 2:173011066-173011088 GAAGAACCCCACAGCCTCTAGGG - Intronic
942975404 2:182011306-182011328 GAAGAAATCCAAAACCTGAATGG - Intronic
1169309265 20:4521419-4521441 GAGGCACTCCCAAGCCTGTAGGG - Intergenic
1173122427 20:40305970-40305992 GAAGCAAGCCATAGCCTTTTTGG - Intergenic
1175113068 20:56662677-56662699 GAAACATCACAAACCCTGTAAGG - Intergenic
1177204650 21:17997258-17997280 GCTGCAATCCAAAACCTGTATGG + Intronic
1178755497 21:35345612-35345634 GTTGCATCCCAAATCCTGTATGG + Intronic
949432435 3:3991960-3991982 GAAGCAAACCATTGCCTGTAAGG + Intronic
949923534 3:9022911-9022933 GAGGCAACCCAAGGCTTGTTAGG + Intronic
952571672 3:34725214-34725236 GAAGCAACCCAAATGCTCCAAGG + Intergenic
954943245 3:54393986-54394008 GAAGCATCCTAGACCCTGTATGG - Intronic
956700102 3:71951391-71951413 GAAGTCACCCAAAGCCTTCAGGG + Intergenic
956777417 3:72577091-72577113 GAACCAACACACAGCCTGGATGG - Intergenic
959145872 3:102543978-102544000 GAAGAATCCCAAAGCCGGTAGGG + Intergenic
959847231 3:111047949-111047971 GAAGCAACACAAATCCTGTTTGG - Intergenic
963505631 3:146181286-146181308 GAAGAAACCCAAAGTCTGAGTGG - Intergenic
966276381 3:178175921-178175943 TAAGCAACAAAAAGCTTGTACGG + Intergenic
968733612 4:2283876-2283898 GAAGCAGCCGACAGACTGTAGGG + Intronic
969026626 4:4178165-4178187 GAAGAACCCCAAAGCTTCTATGG - Intergenic
969811663 4:9652958-9652980 GAATCAAGCTAAAGCCAGTATGG + Intergenic
973120078 4:46511021-46511043 GAAACAAGCCAAATCTTGTAAGG - Intergenic
975295501 4:72730247-72730269 GAAGAAATCCAAAACCTGAATGG + Intergenic
975825763 4:78317947-78317969 CAAGCAGCCCAAAGCCTTTATGG - Intronic
980842523 4:138282308-138282330 TAAGCAACCTAAAGCATGGAGGG + Intergenic
983617613 4:169725322-169725344 GTGGCAAGCCAAAGCCTGAAAGG + Intergenic
984906923 4:184636963-184636985 GAAACAACCCTAAACCTGTCTGG + Intronic
986482474 5:8202921-8202943 GAAGCAGCCAAGAGTCTGTAGGG - Intergenic
991481653 5:67087527-67087549 GAAACAACCCAAACACAGTAGGG - Intronic
992575570 5:78107164-78107186 GAAGCAACCAAAAGAATGAAAGG + Intronic
993606134 5:89992716-89992738 GAATCATCCCAAAGGCTCTAGGG - Intergenic
994720429 5:103373626-103373648 GTAGCAACCCATAGCCTGCCAGG + Intergenic
994991652 5:107004486-107004508 GAAGAAACCCAAAGTCTCCAGGG + Intergenic
995645695 5:114308630-114308652 GAAGCTGGCCAAAGCCAGTATGG + Intergenic
998620653 5:143790951-143790973 AAAGAAACACAAAGCCTGTGTGG + Intergenic
1000400362 5:160820326-160820348 GAAGAAATCCAAAACCTGAACGG + Intronic
1000804879 5:165777409-165777431 TATACAACCCACAGCCTGTAGGG + Intergenic
1000844492 5:166262384-166262406 GAAGCAACCAAAGGCTTATATGG + Intergenic
1002929522 6:1623961-1623983 AAAGCGACCCAAACCCTGGAGGG + Exonic
1004344526 6:14836542-14836564 GAAAGAACCCAATGCCAGTAGGG + Intergenic
1005532102 6:26718511-26718533 GAAGGAACCCACAGGCAGTAAGG + Intergenic
1005538693 6:26783154-26783176 GAAGGAACCCACAGGCAGTAAGG - Intergenic
1007744443 6:44034749-44034771 GAAGTGACTCAAGGCCTGTAGGG - Intergenic
1008858330 6:56118382-56118404 GAAGAAATCCAAAACCTGAAAGG + Intronic
1016892134 6:149017025-149017047 GAAACAAACCAAAGCTTGTGCGG - Intronic
1018852335 6:167649688-167649710 GACCAAACCCAAAGTCTGTAGGG + Intergenic
1031444912 7:121841031-121841053 AAAGCATCCCAAATCCTGTAAGG - Intergenic
1032939504 7:136772404-136772426 GAAAAAACCCAAAACCTGAATGG + Intergenic
1033037199 7:137885770-137885792 GAAACAAGCCACAGCCTGTCAGG - Intronic
1038543559 8:28408777-28408799 GAAGCAACCAAAAGGCAGCATGG + Intronic
1038577746 8:28719578-28719600 GAAGCTATTCAAAGACTGTAGGG + Intronic
1040523309 8:48196344-48196366 GAAGCAACTCAAAGCTGGGAGGG - Intergenic
1042804188 8:72754259-72754281 AAGGCAGCCCAAAGCCTGGAAGG + Intronic
1044829882 8:96236691-96236713 GGAGAAACCCAAGGCCTGAAAGG - Intergenic
1045944447 8:107779783-107779805 AAAGGAAACCAACGCCTGTAAGG + Intergenic
1050817576 9:9834623-9834645 GGAGCAACCCAAAGCCTCTGGGG + Intronic
1051793888 9:20841453-20841475 GAAGAAATCCAAAACCTGAATGG - Intronic
1054944757 9:70784058-70784080 GAAGAACCCTAAAGCCTGTTTGG - Intronic
1056451031 9:86716885-86716907 GTAGCAACCCAAAGGATGCAAGG - Intergenic
1058269087 9:102947024-102947046 CCAGCAACCCAAAGCCTCCATGG + Intergenic
1060049956 9:120371505-120371527 TAAGCAACCCAGAGCCTTTTAGG - Intergenic
1060544662 9:124452929-124452951 GAGGCATCCCAAAGCCTGGAAGG + Intronic
1187199239 X:17118969-17118991 GAAGAATCGCAAAGCCTCTATGG - Intronic
1188186555 X:27123533-27123555 GAAGCAAACCACAGCCAGTCAGG + Intergenic
1192377037 X:70573249-70573271 GATGCAATCCAAAGCCTTAATGG - Intronic
1192733787 X:73828882-73828904 GAAGCAACTCAAAGACATTATGG - Intergenic
1192821427 X:74649534-74649556 GAAGAAATCCAAAACCTGAAAGG - Intergenic
1193791134 X:85816171-85816193 AAGGCAACCCAAAGCCAGTTTGG - Intergenic
1199526388 X:148796622-148796644 GAACCAACCCACAGCCTCAAAGG - Intronic
1202575492 Y:26320094-26320116 CAAGCAATCCAAAGACTGAATGG + Intergenic