ID: 929527510

View in Genome Browser
Species Human (GRCh38)
Location 2:42719421-42719443
Sequence GGTGAGTTAGAAACAGGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 297}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929527510 Original CRISPR GGTGAGTTAGAAACAGGGAA GGG (reversed) Intronic
900200035 1:1400341-1400363 GGTGAGGCAGGAAGAGGGAAGGG + Intronic
900621759 1:3590751-3590773 GGTGATGGAGAAACAAGGAAGGG + Intronic
900871203 1:5304762-5304784 GGTGACTTTGAAACAGAGAAAGG - Intergenic
900977160 1:6025145-6025167 GGGGAGGTAGAAAGAGGAAAAGG - Intronic
901149573 1:7092267-7092289 GGTTTGTTAGGACCAGGGAAGGG + Intronic
901756190 1:11442999-11443021 GGGGAGTGAGAAAAAGGGAGAGG + Intergenic
902007136 1:13241285-13241307 TTTGAGTTTGAGACAGGGAAGGG + Intergenic
902026187 1:13385585-13385607 TTTGAGTTTGAGACAGGGAAGGG + Intergenic
902560599 1:17274786-17274808 GGTGAGAGAGAGACAGGGAATGG + Exonic
902759777 1:18573541-18573563 GGTGTGTTGGAAACAGAGGAAGG - Intergenic
905474938 1:38219404-38219426 GGTGGTTTAGGAAGAGGGAAGGG + Intergenic
906535927 1:46550978-46551000 GGTGAACAAGGAACAGGGAAGGG - Intronic
907702714 1:56804911-56804933 GGTGAGTTAGAGGCAGGAAGTGG - Intronic
908207369 1:61864682-61864704 CATGAGTTAGAGACAGGGACAGG - Intronic
910696287 1:90020426-90020448 GATGAGTAAGAAAAGGGGAAAGG - Intronic
911039923 1:93583370-93583392 GGAGAGCTGGAGACAGGGAAGGG + Intronic
912936893 1:114011493-114011515 GTGGAGTGAGAAACAGAGAAAGG - Intergenic
913161375 1:116148926-116148948 TGTGTGTGAGAAACCGGGAAAGG - Intergenic
913296836 1:117329740-117329762 AGAGAGTTAGAAATAAGGAAAGG + Intergenic
914957030 1:152172146-152172168 GGTGAGAAAGATACAGGGAAGGG + Intergenic
915062662 1:153199152-153199174 GGTGATTGATAAACAGTGAAAGG + Intergenic
915129865 1:153688682-153688704 AGTGAGTTAGAAGGAGGTAAAGG - Intronic
916252698 1:162754276-162754298 GCTGAGTTTGAAAGAGGGAAGGG + Intronic
916261935 1:162850919-162850941 GGTGAGGTGTAAACATGGAATGG + Intronic
917617371 1:176759829-176759851 GGTTAGTGAGGAACAGGGTAAGG - Intronic
918125177 1:181577414-181577436 GGTGGGTTGGAAAGAGGGGAAGG + Intronic
918343033 1:183582675-183582697 GCTGACTTGGAAACAGGAAAGGG - Intronic
921794132 1:219323395-219323417 GGTGAGTTTGAAAGAGGTTAGGG + Intergenic
921965157 1:221080101-221080123 GGTGGGTAAGAGACAGGAAAGGG + Intergenic
922444037 1:225681550-225681572 GGAGGGCTAGAAACAGGTAAAGG + Intergenic
922633378 1:227137855-227137877 GGTAGGTTACAAACTGGGAAGGG + Intronic
923467436 1:234261859-234261881 GGTGAGTGAGAAAAATGAAAGGG + Intronic
923772698 1:236951323-236951345 GGTGAGTCCCAAACAGGAAAAGG - Intergenic
923905912 1:238383436-238383458 GGTAAGTTCTAAACAGGAAATGG - Intergenic
1063255715 10:4325159-4325181 GGTGAAGTAGAAACGGGGCAGGG - Intergenic
1063352753 10:5371950-5371972 TGTGAGATAGAAGCAGTGAAAGG - Intronic
1064251295 10:13708288-13708310 GGTGGGTCAGATACAGGAAATGG - Intronic
1066030217 10:31413874-31413896 GGTCAGTTAGAAACACAGATTGG - Intronic
1066289683 10:34002394-34002416 GGTGACATTGAAACAGGGACTGG + Intergenic
1068251093 10:54441815-54441837 AGTGATTGAGAGACAGGGAAAGG + Intronic
1068602802 10:58973508-58973530 GGTCAGTCAGAAACAGGATAAGG - Intergenic
1069756341 10:70776303-70776325 GGTAAGTTGGACACAGAGAATGG - Intronic
1071147967 10:82597510-82597532 GGTGAATTAGAAGCAGGGGCAGG + Intronic
1071256533 10:83876853-83876875 GCTGAGTTGGACACAGGCAAGGG - Intergenic
1073768900 10:106713488-106713510 GGTGAATTAGAAACATGAAAAGG - Intronic
1074399542 10:113130286-113130308 GGTGAGCTGGAATCTGGGAAGGG + Intronic
1075185033 10:120248260-120248282 GATCAGTTACATACAGGGAAAGG - Intergenic
1075988108 10:126805908-126805930 AATGAGTTAGACTCAGGGAAGGG + Intergenic
1077922210 11:6650128-6650150 GGTGAGAGAGAAAGAAGGAAAGG - Intronic
1079085192 11:17440173-17440195 GCTGAGATAGAGAGAGGGAAGGG - Intronic
1079300784 11:19277203-19277225 GGGGAGTTTGAAGGAGGGAATGG + Intergenic
1081979088 11:47255011-47255033 GGTGAGCAGGAAACTGGGAATGG + Intronic
1082992729 11:59222182-59222204 GGAGGGTTAGGAACAGGGAGAGG - Intergenic
1085196308 11:74673987-74674009 GGTGAGTTAGTATCAGGACAGGG + Intergenic
1086016700 11:82176691-82176713 GGTGAGAAAGTAACAGGAAACGG + Intergenic
1086476985 11:87187362-87187384 TGTGAGATGAAAACAGGGAATGG + Intronic
1086895694 11:92309554-92309576 GGTGGGAAAGAAACAGGGAGAGG - Intergenic
1089783572 11:120892119-120892141 GGAGAGTTCCAGACAGGGAATGG + Intronic
1090281283 11:125458241-125458263 GGGAACTTAGAAACAGGGGAGGG - Intronic
1091244839 11:134083293-134083315 AGTGAGGGAGAAATAGGGAAAGG - Intronic
1091641302 12:2239591-2239613 GGACAGTCACAAACAGGGAAGGG - Intronic
1091875081 12:3926936-3926958 GGTAAGATAGAAACACTGAAAGG + Intergenic
1092807007 12:12233556-12233578 GGTGAGAGATAAAAAGGGAAAGG + Intronic
1093377961 12:18454496-18454518 CGTGAGGTATACACAGGGAAAGG + Intronic
1093668904 12:21848962-21848984 GGTGTGTTGGAAGCAGGGCATGG - Intronic
1094568343 12:31620011-31620033 GGGAAGTTAAAAAAAGGGAAGGG - Intergenic
1096073139 12:48787222-48787244 GGGGAGATAAGAACAGGGAAGGG - Intronic
1096080899 12:48831821-48831843 GGTGAGGTGGAGCCAGGGAAAGG - Intronic
1096569998 12:52517080-52517102 GGTGAGATTGAAAGAGGGCAAGG - Intronic
1096745501 12:53724368-53724390 GGGGAGTAAGGAAGAGGGAAAGG - Intronic
1098986445 12:77017624-77017646 GGTATGTTAGAAAAAGGGAATGG + Intergenic
1099121984 12:78702013-78702035 TGTGGGATAGAAACAGGAAATGG - Intergenic
1100861414 12:98811011-98811033 GGGGAGGAAGAAACAGGAAAAGG + Intronic
1101213656 12:102559968-102559990 GGTGAGTGAGAAAAGGGCAAAGG - Intergenic
1103112797 12:118296066-118296088 AGTGAGTTAGATCCAGGGAGTGG + Intronic
1104586256 12:130050386-130050408 GGTAAGTTAGAATCTGGGATAGG - Intergenic
1104605402 12:130184144-130184166 GCTGAGGAAAAAACAGGGAAAGG - Intergenic
1106019810 13:25903762-25903784 AGTGACTTGGAAACAGGGTAAGG - Intronic
1106548523 13:30751431-30751453 GGTGAGTTAAAAAGAGAGGAAGG + Intronic
1107372491 13:39767843-39767865 GGTGAGCTAGAGACAGCAAAGGG + Intronic
1107833346 13:44393692-44393714 AGTGAGTTCAAAAGAGGGAAAGG - Intronic
1108522316 13:51257640-51257662 GGAGAGTGAGCAAGAGGGAAGGG - Intronic
1108971933 13:56387743-56387765 TGTGAGTGTGAAACAGAGAAAGG - Intergenic
1110355255 13:74559962-74559984 GGGGAGTTAGAGAAAAGGAAGGG - Intergenic
1112871878 13:103982044-103982066 GGGGACTTACAAACATGGAAAGG + Intergenic
1113113640 13:106851138-106851160 GCTGAGTTAGACACAAGGCAGGG + Intergenic
1113711102 13:112466199-112466221 GGTGAGTCAGGCACAGAGAAAGG + Intergenic
1114339346 14:21726911-21726933 GGAGAGTTTGAATCAAGGAAGGG + Intergenic
1114779361 14:25520839-25520861 AATGAGTCAGAAACAGGGGAAGG - Intergenic
1116497219 14:45575542-45575564 TGTGTGTTAGAAACTGGGCAAGG + Intergenic
1117436653 14:55721472-55721494 GGTTAGTGAGAAGCAGAGAAAGG + Intergenic
1118259752 14:64235841-64235863 GGGGAGTTAAACACAGGGCAGGG - Intronic
1120943080 14:89967963-89967985 AATGTGTTAGAAATAGGGAAGGG - Intronic
1121833090 14:97068880-97068902 GGTAAGATAGAGAGAGGGAACGG + Intergenic
1122863897 14:104594920-104594942 AGTGAGTTAGAATCAGGAAGTGG - Intronic
1123579302 15:21702429-21702451 GCTGCGCTAGAAACAAGGAAGGG + Intergenic
1123615929 15:22144940-22144962 GCTGCGCTAGAAACAAGGAAGGG + Intergenic
1125491133 15:40149409-40149431 TGTGAGTTAGAAACATGCACTGG + Intergenic
1126463992 15:48943962-48943984 AGTAAGGTAGAAAGAGGGAACGG + Intronic
1126878619 15:53070923-53070945 AATGAGATAGAAAAAGGGAAGGG + Intergenic
1127669055 15:61177090-61177112 GGTGCGTTATAAACACTGAATGG - Intronic
1127778127 15:62284922-62284944 AGTGAGTTAGAAAAATAGAAAGG - Intergenic
1128372521 15:67050707-67050729 GGTCAGTTAGCACCAGGGGAGGG - Intergenic
1129503444 15:76060816-76060838 GGTGACTGTGAAACAGGGATGGG - Intronic
1131466624 15:92660661-92660683 GTTGTGTTAGGAACAAGGAAGGG + Intronic
1202988172 15_KI270727v1_random:436674-436696 GCTGCGCTAGAAACAAGGAAGGG + Intergenic
1133622847 16:7542847-7542869 GGAGAGGGAGAAAGAGGGAAAGG + Intronic
1133988388 16:10685639-10685661 GATGAGATAGAGACAGAGAAAGG - Intronic
1135796207 16:25445269-25445291 GGTCAGCTAGAAAATGGGAAAGG + Intergenic
1137812391 16:51365129-51365151 GGTGAGAAAGAACCAGGGCACGG + Intergenic
1139134419 16:64184488-64184510 TGTGAGTCAGAAATGGGGAATGG - Intergenic
1139153638 16:64414925-64414947 GGTGAGTTAGATGCAGGCATGGG - Intergenic
1139211893 16:65086078-65086100 GATGCCTTTGAAACAGGGAATGG - Intronic
1139440364 16:66963691-66963713 GGTGCTTTGGAAACAGGGACGGG - Intronic
1139539042 16:67600089-67600111 TGAGATTTAGAAAGAGGGAAAGG + Intronic
1140522099 16:75590531-75590553 GTTGAGTTAGAAAGAGGCACAGG - Intergenic
1141737190 16:85861508-85861530 GGTGAGTTTGGAAAATGGAAAGG + Intergenic
1142910056 17:3081497-3081519 GGTCAGATAGAAACAAAGAAGGG - Intergenic
1142910235 17:3083082-3083104 GGTCAGATAGAAACAAAGAATGG - Intergenic
1144457811 17:15433240-15433262 GGGGAGGTAGAGCCAGGGAAGGG - Intergenic
1144481394 17:15632425-15632447 GGTGAGAGAGAGTCAGGGAAGGG - Intronic
1144547199 17:16208360-16208382 TGTGAGTTAGAAATACAGAACGG - Intronic
1144916907 17:18731297-18731319 GGTGAGAGAGAGTCAGGGAAGGG + Intronic
1145008120 17:19349281-19349303 GGTGACCAAGAAACAGGTAAAGG - Intronic
1147466941 17:40617559-40617581 GGTGAGCTATAAAGAGTGAAGGG + Intergenic
1150230829 17:63549652-63549674 TGTGAGTTGGAAAAGGGGAAGGG - Intergenic
1150665409 17:67131292-67131314 GGTGATATAGGAACAGGGTATGG - Intronic
1151829718 17:76542488-76542510 GGAGAGTCAGAAACATGGGAAGG + Intronic
1152663554 17:81554003-81554025 GGTGAGTTAGACACAAGCGAAGG + Intergenic
1154462312 18:14605052-14605074 GATGAGTTAGAAACAGAAAATGG + Intergenic
1156655262 18:39277648-39277670 GGTGAGTTTGAAAATGTGAATGG + Intergenic
1158206437 18:54998573-54998595 GGGGAGAAAGAAAAAGGGAAAGG - Intergenic
1159070307 18:63615366-63615388 GGGAAGTTAGAACCAGGGAAAGG + Intergenic
1160067848 18:75594132-75594154 GGAGAGTCAGAGACAGAGAAAGG + Intergenic
1160176487 18:76599596-76599618 GGTTAGTTAGATACAGAGTATGG + Intergenic
1160277326 18:77449455-77449477 GGTAAGTTGGAAACCAGGAAAGG + Intergenic
1161765788 19:6207855-6207877 TGTGAGAAAGAAAGAGGGAAGGG + Intergenic
1161786478 19:6329416-6329438 GGTGTGTTTGTACCAGGGAAGGG + Intronic
1162099308 19:8330259-8330281 GATGAGTAAGAACCAGGGGAAGG + Intronic
1163360275 19:16841632-16841654 GCTGTATTAGAGACAGGGAAAGG - Intronic
1166978440 19:46618793-46618815 GGAGAGTTAAAAACAGGTCAAGG - Intergenic
1166986306 19:46661535-46661557 GGTGATCTATAAATAGGGAATGG + Intergenic
925344369 2:3160083-3160105 AGTGAGTTAGAAACAGCTGAGGG - Intergenic
926310894 2:11675528-11675550 GCTGAATTAGAAACAGAGGAAGG - Intergenic
927656943 2:24956891-24956913 AGTGAGATAGAAATAGAGAAAGG - Intronic
928465754 2:31520794-31520816 GGTGGGTTGGGGACAGGGAAGGG - Intergenic
928692869 2:33819223-33819245 TGTGTGCTAGAAAAAGGGAAGGG - Intergenic
929527510 2:42719421-42719443 GGTGAGTTAGAAACAGGGAAGGG - Intronic
930735742 2:54776742-54776764 GTTGAGTTAGAAACAGGACGTGG - Intronic
931590171 2:63874312-63874334 GGTGGGTTGGAAAGAGGTAAAGG + Intronic
932294718 2:70614864-70614886 GGTGAGTGAGAAACAGTCAGTGG - Intronic
935700808 2:105810111-105810133 GCAGTGATAGAAACAGGGAAAGG + Intronic
935733262 2:106084178-106084200 GGTGAGTTAGGAACAGAGCAGGG + Intergenic
935954623 2:108363329-108363351 GGTGAGGTAGAAACAAAGCAAGG - Intergenic
936288484 2:111199953-111199975 GGTGAGTGACACACAGGGGAGGG - Intergenic
940848332 2:158664158-158664180 GGAGAGTTAGAAGCAGGGATTGG + Intronic
942374707 2:175325094-175325116 TGTGAGTTTGAAATGGGGAAAGG - Intergenic
943294090 2:186115130-186115152 GGTCAGTTAGAAACAAAGAATGG - Intergenic
943391104 2:187268908-187268930 GGTTACTCTGAAACAGGGAAGGG - Intergenic
943902206 2:193454917-193454939 AGGGAGTCAGAAAGAGGGAAAGG + Intergenic
944130034 2:196337743-196337765 AGTGAGCTAGGAAAAGGGAAAGG + Intronic
944315662 2:198283232-198283254 ACTGAGTTAGAAACAGTAAAAGG - Intronic
944596849 2:201268824-201268846 GGAGATTTAGACACAGAGAAGGG - Intronic
944634072 2:201657540-201657562 AGGGAGTTACAAACATGGAAAGG - Intronic
944645645 2:201778514-201778536 GATGAATAAGAGACAGGGAAAGG + Intronic
947882792 2:233534362-233534384 GGGGAGGTAGAGACAGGCAATGG - Intronic
1169439534 20:5622599-5622621 AGTGAGTGAGCAACAGGGCATGG - Intergenic
1171158535 20:22899455-22899477 GCAGAGTTAGAAACATGCAAGGG - Intergenic
1173007714 20:39153117-39153139 TGTGGGTTAGAAAGAGGGAATGG - Intergenic
1173707604 20:45124051-45124073 GGTCAGATAGAGGCAGGGAAGGG + Intronic
1173855022 20:46244711-46244733 GGTGAGGGAGAAAAGGGGAAGGG + Intronic
1174197406 20:48783290-48783312 GGTGAGACAGAAACAGAGGATGG + Intronic
1176031663 20:63015900-63015922 GGGGAGGTGGAGACAGGGAAAGG - Intergenic
1176812197 21:13553315-13553337 GATGAGTTAGAAACAGAAAATGG - Intergenic
1177902638 21:26935194-26935216 GGTGAGTTAGAAATGGGTAATGG - Intronic
1178066624 21:28911460-28911482 AGTAAGTTAGAAAGAGGAAACGG - Intergenic
1179184478 21:39074290-39074312 GATGGGTTACAAACAGGGAGAGG - Intergenic
1179823951 21:43953292-43953314 GGTGAAATGGAAACAGGGACGGG + Intronic
1182103774 22:27674675-27674697 GGAGAGTGAGGAAGAGGGAAAGG - Intergenic
1182907703 22:33952355-33952377 GGTGAGCTAGAACCAGAGAAAGG - Intergenic
1182953117 22:34396368-34396390 GGGGAGGGAGAGACAGGGAAGGG - Intergenic
1183336196 22:37248178-37248200 GGGGAGGGAGAAACAGGGAGAGG - Intergenic
1183505819 22:38208370-38208392 GGGGTGTGGGAAACAGGGAAAGG - Intronic
1184088467 22:42280013-42280035 GGTGAGTTACTAGCAGGGACAGG + Intronic
1184512308 22:44940826-44940848 GGTGAGATGGATACAGGGGAAGG + Intronic
1184520000 22:44987801-44987823 GGTGAGATAGAGAGAAGGAAGGG - Intronic
1184780585 22:46647296-46647318 GGTGATGGAGAAACAGGGATTGG - Intronic
949224737 3:1681055-1681077 GGTGAGACAGAGAGAGGGAAGGG + Intergenic
950031294 3:9855578-9855600 TGTGAATTAGAAAGTGGGAAAGG - Intergenic
950258936 3:11529887-11529909 GGTGAGTAAGAAAAGGGCAAAGG - Intronic
951328247 3:21332022-21332044 GATCAGTTAGAAACAGAAAAGGG - Intergenic
953183428 3:40617191-40617213 GGTGAGTCAGGAAAAGGAAATGG + Intergenic
953284816 3:41596411-41596433 GATGAGTAAGATACAGGGAAGGG + Intronic
954452176 3:50577613-50577635 GGTGAGTTTGAAACCTGAAAAGG - Intronic
955650769 3:61191663-61191685 GATTAGTTTAAAACAGGGAAAGG + Intronic
955995096 3:64672296-64672318 GATTAGCAAGAAACAGGGAAAGG + Intronic
956321093 3:67997061-67997083 GCTGAGTTAGGAAAAAGGAAGGG + Intergenic
956831931 3:73059609-73059631 GGAGTGTTAGAATAAGGGAAGGG + Intronic
957162313 3:76625900-76625922 GGTGTGTTAAAAAGAGTGAAGGG + Intronic
957488196 3:80889930-80889952 TGCGAGATAGAAACAGGAAAAGG + Intergenic
959478770 3:106845694-106845716 GGAGAGTTAGAGTCAGAGAAAGG + Intergenic
960844719 3:121994985-121995007 GGTGGGGTGGAAGCAGGGAAGGG + Intronic
961568011 3:127777362-127777384 GGTAAGGTAGACACAGAGAATGG - Intronic
961783440 3:129335210-129335232 TGTGAATTAGAAAGTGGGAAAGG - Intergenic
962742035 3:138368989-138369011 TGTGAGCTAGAAACAAAGAAGGG - Intronic
964450956 3:156812737-156812759 GAGAAGTTAGCAACAGGGAAGGG + Intergenic
965088915 3:164137717-164137739 AGTGAGTTACAAATATGGAAAGG + Intergenic
966485837 3:180468881-180468903 GGTCAGTTAGAAACAAAGAATGG + Intergenic
967211622 3:187175233-187175255 GGCGAGTTAGAAACCGGGGATGG - Intronic
967470191 3:189851967-189851989 GCTAAGTAGGAAACAGGGAACGG + Intronic
967478941 3:189952598-189952620 GTGGAGGTAGAAATAGGGAATGG - Intergenic
968027083 3:195451513-195451535 GGTGAGGTTGAAACAGGAATGGG + Intergenic
969536611 4:7760281-7760303 GATGAGTAAGATACAGGGGAAGG + Exonic
969722436 4:8899868-8899890 GGCGAGATGGAAACTGGGAAAGG - Intergenic
970426226 4:15948609-15948631 TGAGAGTTAGATAAAGGGAATGG + Intergenic
970458995 4:16254249-16254271 GAAGAGTGAGAAACAGTGAAAGG - Intergenic
973652687 4:53012295-53012317 GGTAAATTTGAAATAGGGAAAGG + Intronic
975600169 4:76090905-76090927 GGGGACTGGGAAACAGGGAAAGG - Intronic
975815358 4:78211166-78211188 AGTGGGTTATAGACAGGGAAAGG + Intronic
976429752 4:84948695-84948717 GCTGAGCTATAAACAGGAAAAGG - Intronic
978532854 4:109731584-109731606 GGCAAGTTAGAAACATAGAAAGG + Intergenic
978546915 4:109880036-109880058 GGTCAGTTAGAAACAAAAAAAGG + Intergenic
985249840 4:188012752-188012774 TGTGGGTTAGAAACTTGGAAAGG - Intergenic
985619659 5:947533-947555 AGTGAGTTAGCACCAGGGACAGG + Intergenic
988560904 5:32280164-32280186 GGAGAGGTAGAAAAAGGGTAGGG + Intronic
988929771 5:36026413-36026435 GGCTGGGTAGAAACAGGGAAGGG - Intergenic
989691108 5:44145418-44145440 GGCCAGTTAGAAACAAAGAAAGG - Intergenic
990121732 5:52462843-52462865 GTTGAGTTTGAAGAAGGGAAAGG - Intergenic
992164699 5:74038140-74038162 GCTGAGTCAAAAACTGGGAAAGG - Intergenic
992203952 5:74411786-74411808 GGGGAGGCAGAAGCAGGGAAAGG - Intergenic
993269180 5:85771367-85771389 GGTGAATCAAAAGCAGGGAAAGG + Intergenic
996184031 5:120454940-120454962 GGATATTTAGAAATAGGGAAAGG - Intergenic
997615395 5:135242822-135242844 ATTGATTTAAAAACAGGGAATGG - Intronic
998566857 5:143223548-143223570 GGTGGGTTAGAGGCAGGCAAGGG - Exonic
999121302 5:149211454-149211476 GATGAATTAGAAACAGGGAAGGG + Intronic
1000720919 5:164705566-164705588 GGTGAATTTGAAATAGGCAATGG - Intergenic
1001006221 5:168052751-168052773 GCTGAGTTATAAACCGAGAATGG - Intronic
1003504499 6:6728539-6728561 GGTAAGTTAGAAAGAGAGGAAGG + Intergenic
1004219116 6:13730353-13730375 GGGGAGTTAAAAATATGGAAAGG - Intergenic
1004786505 6:18974001-18974023 AGTGAATTAGAAGCAGGTAATGG - Intergenic
1005361967 6:25039371-25039393 TGTGAGTTAGAAACAGGAACAGG - Intronic
1005674526 6:28140543-28140565 GGGGAGTTAGTAATTGGGAAGGG + Intergenic
1006444054 6:34069055-34069077 GGGGAGTTACACACAGGGACAGG + Intronic
1007410282 6:41657417-41657439 GGTGAGGGAGAAGCAGGGACAGG + Intergenic
1008099655 6:47377381-47377403 GGGGAGTCAGAAGCAGGGGATGG + Intergenic
1010656816 6:78521213-78521235 GATGAGTTAGAAGCAGTGAATGG + Intergenic
1013234867 6:108189094-108189116 AGAGAGTTAGAAACAGAGGAAGG - Intergenic
1013289734 6:108709527-108709549 AGTGAGGTAGAAACAGGGGCAGG - Intergenic
1013719104 6:113001141-113001163 GGAGAGAGAAAAACAGGGAAAGG - Intergenic
1014737895 6:125116145-125116167 GGTAAGCTAGAAATAGGGAGAGG + Intergenic
1015383064 6:132591730-132591752 GCTGAAGAAGAAACAGGGAAAGG + Intergenic
1015967937 6:138713652-138713674 GGGAAGTTAGAAAGAGAGAAAGG + Intergenic
1017095431 6:150800528-150800550 GGTGAATTAGAAAAAGGCACCGG - Intronic
1017597935 6:156049569-156049591 GGTGAATTCCAAACAGTGAAAGG + Intergenic
1018039655 6:159910712-159910734 GGGGAGATAGAAACTGGAAAGGG - Exonic
1019872701 7:3780380-3780402 GGTCAGGTAGAAACAAAGAAAGG + Intronic
1020652511 7:10892640-10892662 GTTGAGTTAGGAACACTGAAAGG - Intergenic
1021139803 7:17010190-17010212 GGTTAGTTAGAAAAAGGAAATGG + Intergenic
1022199653 7:28103996-28104018 AGTGAGTGAGAAAGAGGGCAGGG - Intronic
1022785435 7:33632866-33632888 GGTGAGTTTGAATGAGGGGATGG + Intergenic
1022861645 7:34373592-34373614 AGTGAGCTAGGAACAGGGCATGG - Intergenic
1026177770 7:68012947-68012969 GCTGTGTTACTAACAGGGAAGGG + Intergenic
1026871008 7:73851808-73851830 TGTCAGTTAAAAATAGGGAAAGG - Intergenic
1027640775 7:80731208-80731230 GGTGAGAAAGAGCCAGGGAAAGG + Intergenic
1027959648 7:84929279-84929301 GGTGACTGAGAATCTGGGAAGGG - Intergenic
1028686670 7:93597483-93597505 TGTGAATTAGGAACAGGTAAGGG + Intronic
1029408289 7:100390967-100390989 GGTGAGGTGGAAAGAGGAAAAGG + Intronic
1030480553 7:110098243-110098265 GTTGAGGAAGAAACAGAGAATGG + Intergenic
1030613280 7:111711912-111711934 GGTGGATTAAAACCAGGGAATGG - Intergenic
1031214593 7:118873922-118873944 GGTGAGTTTGAAGCTAGGAATGG - Intergenic
1031473988 7:122200739-122200761 GGTTAGTTAAAAAGAGTGAATGG + Intergenic
1031571909 7:123369680-123369702 TGTGAGATAGAGAGAGGGAAGGG - Intergenic
1032903555 7:136338292-136338314 TGTGATTTAGAAACAGGAGAGGG - Intergenic
1033934174 7:146562108-146562130 GGTGATTTAGAAACAAGTTAAGG - Intronic
1035627608 8:1083372-1083394 GAAGATTTAGAAACAGAGAATGG - Intergenic
1037870465 8:22490277-22490299 GATGAGTCAGAAACAGGGTCAGG - Intronic
1038096671 8:24319714-24319736 GGTAAGTTTGAAACATGGGAAGG + Intronic
1040334131 8:46407542-46407564 GGGGAGTTTGAGACAGGCAAAGG + Intergenic
1040898318 8:52391174-52391196 GGTGGGTTCGCACCAGGGAAAGG - Intronic
1041104165 8:54425337-54425359 TGTGAATTAAAAACACGGAATGG - Intergenic
1041312752 8:56533233-56533255 GTTGAGATAGAAGCAGGGGAGGG - Intergenic
1041472345 8:58224915-58224937 TGTGAACAAGAAACAGGGAAAGG + Intergenic
1041748341 8:61233352-61233374 AGTGAGGTACAAACAGGGAATGG + Intronic
1045881552 8:107046083-107046105 GGAGAGGGAGAAACAGGGAGAGG + Intergenic
1046711067 8:117512230-117512252 AGTGAATTAGACAAAGGGAAAGG - Intergenic
1047787076 8:128163794-128163816 GGTGTGTTAGATGAAGGGAAAGG - Intergenic
1048245801 8:132797422-132797444 GTTTAGATAGACACAGGGAAAGG + Intronic
1049987730 9:967951-967973 GGTGAGAGAGAAAGAGAGAAAGG - Intronic
1050138293 9:2491250-2491272 GTAGAGGTAGACACAGGGAACGG - Intergenic
1050352863 9:4756893-4756915 GCTGAATTACAGACAGGGAAAGG + Intergenic
1051113824 9:13671495-13671517 TGAGAGTTAGAAACAGGAAGTGG + Intergenic
1051306487 9:15715995-15716017 GGAGAGATCGAAACAGGGTATGG + Intronic
1051718384 9:20009239-20009261 GGTCAGTTAGAAATAAAGAATGG + Intergenic
1052685132 9:31745870-31745892 GGTTAGTGACAAACTGGGAAAGG - Intergenic
1055913803 9:81379823-81379845 ATTGAGTCAGAATCAGGGAATGG - Intergenic
1057576480 9:96246646-96246668 GGCGGGATGGAAACAGGGAAGGG + Intronic
1058179920 9:101784880-101784902 GGTAAGTTAGAGAGAGAGAAAGG + Intergenic
1058565372 9:106278568-106278590 GCTGAGTTAGAAACTTGGAAAGG - Intergenic
1058644967 9:107122778-107122800 GGAGAGTTAGAAGTGGGGAAAGG - Intergenic
1060004893 9:119991398-119991420 GGTGAGAGAGGCACAGGGAAGGG + Intergenic
1060390143 9:123269743-123269765 GGTGTGTTAGAAAGATGAAAAGG - Intergenic
1060511272 9:124234588-124234610 GCTGAGAAAGAAACATGGAAAGG + Intergenic
1061916210 9:133755768-133755790 GGTGAGTGAGAAAGATGGAGAGG + Intergenic
1062555307 9:137111127-137111149 GGTGAGACAGGAGCAGGGAAGGG + Intronic
1185834656 X:3333959-3333981 GGTGAGATAGAAGCATAGAAAGG + Intronic
1187159802 X:16753784-16753806 GGAGAGCTACAAACATGGAAAGG - Intronic
1189122697 X:38411999-38412021 GGTAAGCAAGAAACAAGGAATGG + Exonic
1189222909 X:39388209-39388231 GATGAGTCGGAAGCAGGGAAAGG - Intergenic
1189591353 X:42515600-42515622 GGTAAGATAGAAACTTGGAACGG + Intergenic
1190044906 X:47103627-47103649 TGTGGGTTAGAAACAGGGCTGGG - Intergenic
1190141933 X:47854643-47854665 GGAGAGGGAGAGACAGGGAACGG + Intronic
1190328374 X:49220554-49220576 GGTGAGGGAGACACAGGGAATGG + Intronic
1190888035 X:54546410-54546432 GGTGAGGTAGAGAAAGGGAGTGG + Intronic
1190971417 X:55352744-55352766 GGTCAGATAGAAACAAAGAAAGG - Intergenic
1190980906 X:55455961-55455983 GGTGAGGGAGAGGCAGGGAAAGG + Intergenic
1190987791 X:55517219-55517241 GGTGAGGGAGAGGCAGGGAAAGG - Intergenic
1193203884 X:78725137-78725159 GGAGATTCAGAAAGAGGGAAGGG - Intergenic
1194531647 X:95056173-95056195 GTTGAGTCTGAAACAGAGAAAGG + Intergenic
1196026278 X:111044533-111044555 GTTGCTTTAGAAACAGGGAGAGG + Intronic
1197385774 X:125799112-125799134 GGGGAGGTAGGGACAGGGAAAGG + Intergenic
1199798931 X:151230515-151230537 GGAGAGTGAGAGACAGAGAAAGG + Intergenic
1200050234 X:153425412-153425434 GGTCAGTTAGAACCAGAGTATGG + Intergenic
1201522520 Y:14891617-14891639 TGTGAGATAGAAAGAGAGAAAGG - Intergenic