ID: 929528173

View in Genome Browser
Species Human (GRCh38)
Location 2:42725770-42725792
Sequence GGATTCTGCAGTGCTGGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 349}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929528173_929528179 20 Left 929528173 2:42725770-42725792 CCTGCTCCAGCACTGCAGAATCC 0: 1
1: 0
2: 1
3: 28
4: 349
Right 929528179 2:42725813-42725835 GACACAGAGCCAGACAGCAAAGG 0: 1
1: 1
2: 3
3: 41
4: 565
929528173_929528180 21 Left 929528173 2:42725770-42725792 CCTGCTCCAGCACTGCAGAATCC 0: 1
1: 0
2: 1
3: 28
4: 349
Right 929528180 2:42725814-42725836 ACACAGAGCCAGACAGCAAAGGG 0: 1
1: 0
2: 2
3: 48
4: 455
929528173_929528175 -6 Left 929528173 2:42725770-42725792 CCTGCTCCAGCACTGCAGAATCC 0: 1
1: 0
2: 1
3: 28
4: 349
Right 929528175 2:42725787-42725809 GAATCCTTCTAGCGCCCTGCTGG 0: 1
1: 0
2: 0
3: 3
4: 40
929528173_929528181 22 Left 929528173 2:42725770-42725792 CCTGCTCCAGCACTGCAGAATCC 0: 1
1: 0
2: 1
3: 28
4: 349
Right 929528181 2:42725815-42725837 CACAGAGCCAGACAGCAAAGGGG 0: 1
1: 0
2: 5
3: 57
4: 543

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929528173 Original CRISPR GGATTCTGCAGTGCTGGAGC AGG (reversed) Intronic
900098700 1:951810-951832 GGATTCTGGAGAGCTAGGGCTGG - Intronic
900509852 1:3053564-3053586 GTAATCTCCAGTGCTGGAGGTGG - Intergenic
900640449 1:3685786-3685808 GGAAGCTGCTGTGCTGGGGCTGG + Intronic
901117072 1:6855610-6855632 GTAATCTCCAGTGCTGGAGGTGG - Intronic
903659223 1:24966683-24966705 AGATTCAGCAGAGCTGGGGCTGG - Intergenic
904058314 1:27686696-27686718 TGATCCTGCAGAGCTGCAGCTGG - Intergenic
904365981 1:30011041-30011063 GGACACTGCAGTGCGGGAGGCGG + Intergenic
905246423 1:36617647-36617669 AGAATCTGCATTCCTGGAGCTGG + Intergenic
906113239 1:43338386-43338408 GGGTTATGTAGGGCTGGAGCTGG - Intronic
906668528 1:47638536-47638558 GGATTCAGGGGAGCTGGAGCTGG + Intergenic
907388982 1:54144338-54144360 GGATTTGGCAGTGGAGGAGCTGG - Exonic
907595528 1:55716221-55716243 GGATAGGGCAGTGCTGGGGCTGG - Intergenic
908260379 1:62335647-62335669 GGACTCTCCAGTGTTGGAGGTGG - Intergenic
909181674 1:72432043-72432065 GTCCTCTGCAGTGCTGGAGTGGG + Intergenic
909195525 1:72616902-72616924 GGATGGTGCAGTCTTGGAGCTGG + Intergenic
911292254 1:96071380-96071402 GGACTCTGCAGTGCTGGTACTGG - Intergenic
911855959 1:102874941-102874963 GTAATCCGCAGTGTTGGAGCTGG + Intergenic
913056563 1:115167150-115167172 GGTTTCAGCAGTGATGAAGCAGG + Intergenic
913140942 1:115940839-115940861 TGATTCCCCAGTGCTGGAGGTGG - Intergenic
913283814 1:117209735-117209757 GGACTCTGCAGGGCTGGTGGGGG - Intronic
913350893 1:117857768-117857790 GGATTCTGTAGTGCTGGGGTGGG + Intergenic
913969745 1:143405643-143405665 GCAGTCTCCAGTGCTGGAGTTGG + Intergenic
914064118 1:144231236-144231258 GCAGTCTCCAGTGCTGGAGTTGG + Intergenic
914115032 1:144735118-144735140 GCAGTCTCCAGTGCTGGAGTTGG - Intergenic
915023591 1:152805261-152805283 GGATGCTGCAGTTCTGGGGGAGG - Exonic
915277271 1:154798016-154798038 GGAGGCTCCAGTGATGGAGCTGG - Intronic
917171535 1:172181621-172181643 GCAGTCTGCAGGCCTGGAGCTGG - Intronic
918431692 1:184467475-184467497 GGTTTCTGCTGTGCTGGGGCAGG - Intronic
920348009 1:205319034-205319056 GGATACTTCAGTGCGGGAGAGGG - Intronic
922167425 1:223127841-223127863 GGAGTCTGCAGAGCTCCAGCAGG - Intronic
922892037 1:229068905-229068927 CAATTCAGCAGTGCTGGAGCTGG - Intergenic
923038514 1:230302200-230302222 GCATGCTGCGGTGCTGGAGGTGG - Intergenic
923554944 1:234993156-234993178 GGGTGCTGCAGGGCAGGAGCAGG + Intergenic
1063607641 10:7536815-7536837 TGATTCAGCAGGTCTGGAGCAGG + Intergenic
1064258758 10:13767829-13767851 GGTTTCTGCAGTGTCTGAGCTGG + Intronic
1066488080 10:35867740-35867762 GGAATCTCCAGTGTTGGAGGTGG + Intergenic
1066757188 10:38722872-38722894 AGCTTCTGCAGTGGTGGGGCTGG - Intergenic
1067942962 10:50671387-50671409 GGATGTGGCTGTGCTGGAGCTGG - Intergenic
1068043538 10:51857419-51857441 AGATTCTGAAGTCCTCGAGCAGG - Intronic
1068369773 10:56096880-56096902 GTGTTCTGCAGTGTTGGAGTTGG - Intergenic
1070494984 10:77013328-77013350 GGATTCAGAAGTCCTGGGGCTGG - Intronic
1070552761 10:77503817-77503839 GGATTTTTCAGTGCTGGAAGGGG + Intronic
1070631033 10:78084823-78084845 TGCTTCTGGAGTGCTGGAGGAGG + Intergenic
1070864206 10:79696348-79696370 GGATGTGGCTGTGCTGGAGCTGG - Intergenic
1071631105 10:87218574-87218596 GGATGTGGCTGTGCTGGAGCTGG - Intergenic
1073385456 10:103123743-103123765 AGAATCTAAAGTGCTGGAGCTGG + Intronic
1073474811 10:103745922-103745944 GGAGTGGGGAGTGCTGGAGCGGG - Intronic
1073483154 10:103799592-103799614 AGATTCTGCAATGCAGGAGTGGG + Intronic
1073665386 10:105526672-105526694 AGATTCTGCAGTGCTGGTCTGGG + Intergenic
1074987073 10:118668264-118668286 TGAGTCTGCAGGTCTGGAGCAGG - Intergenic
1075159456 10:120010558-120010580 GTATTCCGCAGTGTTGGAGGTGG - Intergenic
1075163312 10:120043359-120043381 GCATTCTGCGTGGCTGGAGCAGG + Intergenic
1077213710 11:1385565-1385587 GGAATCTTCAGTGTTGGAGATGG - Intergenic
1078147419 11:8731051-8731073 GGATTCTGGGGTGAAGGAGCTGG + Exonic
1078840750 11:15073963-15073985 GGATTCTGCAGAGTTGGGTCCGG + Intronic
1080169330 11:29280622-29280644 GGTTTCTCCATTGTTGGAGCTGG + Intergenic
1080214005 11:29820375-29820397 GGTTTCTTCAGTGCTAGATCTGG + Intergenic
1081683401 11:45024648-45024670 GGAGTCTGCAGTACAGGAGAGGG + Intergenic
1083012932 11:59421357-59421379 GCAATCTCCAGTGCTGGAGGTGG - Intergenic
1083255404 11:61492404-61492426 GGAATCCTCAGTGCTGGAGGTGG + Intergenic
1083799545 11:65038624-65038646 GGAGTCTGCAAGGCTGGACCAGG + Exonic
1084167675 11:67383584-67383606 TGAGTCTGCAGGGCTGGAGGTGG - Intronic
1084194521 11:67516869-67516891 GGATGCTGAGGTGCTGGAGCTGG - Intergenic
1084756178 11:71240271-71240293 GGGTTCTGCACTGCTGGCTCTGG - Intronic
1085529637 11:77183789-77183811 TGACTCTGCAGTGGAGGAGCTGG - Intronic
1086103887 11:83128996-83129018 TGAGTCTGCAGAGCTGGATCTGG - Intergenic
1087682400 11:101231777-101231799 GGCTCCTGCAGTGCAGCAGCAGG + Intergenic
1089271854 11:117307013-117307035 GGATTCTGACGTGGGGGAGCTGG - Intronic
1089520769 11:119061648-119061670 GGTTTCTGCAGTGTTGGGGAAGG - Intergenic
1090198500 11:124837845-124837867 GAAGTCTTCAGTGCTGGAGGAGG - Intergenic
1090521525 11:127484995-127485017 TGCTTCTGCTGTCCTGGAGCTGG + Intergenic
1090534350 11:127624420-127624442 GGATTCTGCTTTGTTGCAGCTGG - Intergenic
1092852829 12:12646519-12646541 GGATTGAGGAGGGCTGGAGCTGG + Intergenic
1093295926 12:17391638-17391660 GTAATCTTCAGTGCTGGAGGAGG + Intergenic
1094708759 12:32940567-32940589 GTAATCTCCAGTGCTGGAGGTGG + Intergenic
1095983914 12:47987361-47987383 GGATCCTGGAGGGCTGGAGGTGG - Intronic
1096188285 12:49598430-49598452 GGATCCTGCAGTCCTGGCTCTGG - Intronic
1099816725 12:87658263-87658285 GGATTATAAAGTGCTGGAGATGG + Intergenic
1101310630 12:103575499-103575521 GAAACCTCCAGTGCTGGAGCGGG - Intergenic
1102768111 12:115450969-115450991 GGGTGCTGCAGCCCTGGAGCTGG - Intergenic
1103135841 12:118506888-118506910 GCAATCTGCAGTGTTGGAGATGG + Intergenic
1104823970 12:131695265-131695287 GGATGCTGCAGAGGTGGAGGTGG - Intergenic
1104902836 12:132198419-132198441 TGATTCTGCGGGGCTGGGGCTGG + Intronic
1105532952 13:21236767-21236789 TGATTCTGCAGTTCTGGGGTGGG + Intergenic
1105842615 13:24267954-24267976 TGATTCTGCAGACCTGGGGCAGG + Intronic
1106144768 13:27040896-27040918 GGAGGCTGCAGGGCTGGAGGAGG - Intergenic
1106448548 13:29858891-29858913 GAATCATCCAGTGCTGGAGCTGG + Intergenic
1107455284 13:40549378-40549400 GGATTCTGCAGCCCTGGAGATGG + Intergenic
1110989805 13:82025807-82025829 GTAATCTCCAATGCTGGAGCTGG - Intergenic
1112006604 13:95259014-95259036 GGACTCTGGAGAGCAGGAGCTGG + Intronic
1112319415 13:98393697-98393719 GAATTCGGAAGTGCTGGAGCAGG + Exonic
1112451148 13:99510728-99510750 GTATTCTCCAGTGTTGGAGGTGG - Intronic
1112610410 13:100949607-100949629 GGAATCTGGAGGGATGGAGCAGG - Intergenic
1112853569 13:103736139-103736161 GGCTTCTGCTGTGATGGAGAAGG - Intergenic
1113345400 13:109472764-109472786 GCCTTGTGCTGTGCTGGAGCTGG + Intergenic
1113825199 13:113247223-113247245 GTGATCTGCAGTGCTGGAGGTGG - Intronic
1115673595 14:35644659-35644681 AGATTTTTCATTGCTGGAGCAGG + Intronic
1119466671 14:74863676-74863698 GGGGTCTGTAGGGCTGGAGCTGG + Exonic
1119963744 14:78889702-78889724 GGATTCTGCAGTACAGCAGCAGG + Intronic
1120230153 14:81833154-81833176 TGGTTCTGCTGTGCTGGAGGTGG - Intergenic
1120842053 14:89094628-89094650 GTAATCTGCAGTGCTGGAGGTGG + Intergenic
1121628351 14:95403991-95404013 GGAATCCCCAGTGCTGGAGGTGG + Intergenic
1121855589 14:97266598-97266620 GGAGTCTGCAGTGTAGGAGAGGG - Intergenic
1123004915 14:105316497-105316519 ATGTGCTGCAGTGCTGGAGCAGG - Intronic
1123028147 14:105438294-105438316 GGTCTGGGCAGTGCTGGAGCTGG + Intronic
1124341696 15:28894174-28894196 GGACTCTGCAGTGGTAGAACCGG + Intronic
1124437965 15:29666618-29666640 GGATGCTGGAGGGCTGGTGCAGG - Intergenic
1124487118 15:30128323-30128345 GGATTTTGTAGAGCTGAAGCTGG + Intergenic
1124542204 15:30597298-30597320 GGATTTTGTAGAGCTGAAGCTGG + Intergenic
1124756407 15:32410000-32410022 GGATTTTGTAGAGCTGAAGCTGG - Intergenic
1125368381 15:38943317-38943339 GAATTCTACAGTGCTGGTGTTGG + Intergenic
1125731962 15:41897544-41897566 AGACGCTGCAGGGCTGGAGCAGG + Exonic
1129117358 15:73371958-73371980 GGCTGCTGCAGTGCTGCAGCGGG + Intergenic
1129129921 15:73484386-73484408 GGCTTCTTCTGTCCTGGAGCTGG + Intronic
1129153467 15:73703378-73703400 GGATTCACCAGGGCTGGAGCTGG + Intronic
1129206246 15:74038625-74038647 GGAATTTGCAGTGGTGGTGCTGG - Intronic
1131112949 15:89776788-89776810 AGAGTCTGCAGTGCCGGCGCAGG + Exonic
1132796647 16:1727741-1727763 GGAAGCTGCACTGCTGGCGCGGG - Intronic
1132871841 16:2118841-2118863 GGTTTCTGCAGGGCAGGGGCAGG + Exonic
1133503654 16:6389290-6389312 GGACTCTGCAGAGATGGTGCAGG + Intronic
1133767861 16:8850345-8850367 AGCTTCTGCAGTGCTGGGGATGG - Intergenic
1134237747 16:12480836-12480858 GGTCTCTGCTGTGCAGGAGCTGG + Intronic
1134583529 16:15391932-15391954 GGCTGCTGCAGAGCTGGAGGGGG + Intergenic
1135735888 16:24931371-24931393 GGTTTCGGGGGTGCTGGAGCGGG + Exonic
1136159383 16:28408638-28408660 GGACTCTGCAGTGCGGGGGAGGG + Intergenic
1136203704 16:28706656-28706678 GGACTCTGCAGTGCGGGGGAGGG - Intronic
1136720340 16:32314853-32314875 AGCTTCTGCAGTGGTGGGGCTGG + Intergenic
1136725393 16:32353245-32353267 AGCTTCTGCAGTGGTGGGGCTGG + Intergenic
1136838717 16:33521129-33521151 AGCTTCTGCAGTGGTGGGGCTGG + Intergenic
1136843727 16:33559303-33559325 AGCTTCTGCAGTGGTGGGGCTGG + Intergenic
1137272068 16:46908369-46908391 GGAGTCTGCAGTCCTGGGGTGGG + Intronic
1138924296 16:61571926-61571948 GTAATCTGCAGTGTTGGAGGTGG - Intergenic
1139449414 16:67017659-67017681 GGATTCTGCAGTGCTAGGAAAGG + Intergenic
1139635318 16:68255078-68255100 GGTTTCTGCCGGACTGGAGCTGG + Intronic
1139884536 16:70198958-70198980 GCACTCTGCAGGGCTGGAGTGGG + Intergenic
1141168387 16:81675845-81675867 GGATTCAGCAGGTCTGGGGCGGG + Intronic
1141202771 16:81910529-81910551 GGATCCGGCAGTGCTGGACCCGG - Exonic
1141759414 16:86017997-86018019 AGATTCTGCAGAGCTGGTCCAGG + Intergenic
1142031926 16:87842800-87842822 TGACTCTGCAGGCCTGGAGCGGG + Intronic
1203001038 16_KI270728v1_random:164509-164531 AGCTTCTGCAGTGGTGGGGCTGG - Intergenic
1203006091 16_KI270728v1_random:202916-202938 AGCTTCTGCAGTGGTGGGGCTGG - Intergenic
1203132640 16_KI270728v1_random:1700913-1700935 AGCTTCTGCAGTGGTGGGGCTGG - Intergenic
1203148882 16_KI270728v1_random:1821415-1821437 AGCTTCTGCAGTGGTGGGGCTGG + Intergenic
1203153892 16_KI270728v1_random:1859601-1859623 AGCTTCTGCAGTGGTGGGGCTGG + Intergenic
1143579973 17:7819712-7819734 GGATTCTGCAGGTCTGGGGTGGG + Intronic
1143838469 17:9711913-9711935 GGACTCTGAAGTGCTGGGGTTGG + Intronic
1144012282 17:11161253-11161275 GTAATCTCCAGTGCTGGAGGCGG + Intergenic
1144502551 17:15801694-15801716 GGATTCTGCAGTGCATGGGGTGG - Intergenic
1145164728 17:20604348-20604370 GGATTCTGCAGTGCATGGGGTGG - Intergenic
1146615767 17:34356348-34356370 TGAATCTGCTGAGCTGGAGCTGG - Intergenic
1147010784 17:37445559-37445581 GAATTCAGCAATGCTGGGGCAGG - Intronic
1147439850 17:40441424-40441446 GGCTTCTGCTGTACTGGAGCTGG - Intergenic
1147859861 17:43512633-43512655 GGCTTCTGTAGTTCTGTAGCAGG + Intronic
1148619175 17:49021843-49021865 GTCTACTGAAGTGCTGGAGCGGG + Intronic
1150291193 17:63983374-63983396 GGATTTTTCACTCCTGGAGCTGG - Intergenic
1150978727 17:70118741-70118763 GTATTCCCCAGTGCTGGAGGGGG - Intronic
1152028119 17:77824842-77824864 GTATTCTGCAGTGCTGGAGTTGG - Intergenic
1153490385 18:5641052-5641074 GTAATCTGCAGTGCTGGAGGTGG + Intergenic
1153554385 18:6295830-6295852 GTAATCTCCAGTGCTGGAGGTGG + Intronic
1153601787 18:6788086-6788108 GTAATCTGCAGTGCTGGTGGTGG + Intronic
1154041471 18:10860135-10860157 GGAGTCTGGAGTGTTGGAGAGGG + Intronic
1154490857 18:14921118-14921140 GGAATCAGCAGTGGTGGAGAGGG + Intergenic
1155861131 18:30901174-30901196 GTAATCTCCAGTGCTGGAGTTGG - Intergenic
1156503778 18:37576362-37576384 GGTTGCTGCAGTGCTGAAGCTGG - Intergenic
1158969089 18:62649888-62649910 GGATTCTCCAAAGCTAGAGCAGG + Intergenic
1160941664 19:1622937-1622959 GTCTGCTGCTGTGCTGGAGCGGG + Intronic
1162525411 19:11203598-11203620 GGATTCGGGGGGGCTGGAGCGGG + Intronic
1162844669 19:13382967-13382989 GGATTCTGGAGTCCTGTGGCTGG - Intronic
1163303137 19:16460633-16460655 GGCTTCTGGAGTGGAGGAGCAGG - Intronic
1164160719 19:22623937-22623959 GGAGTCTGGAGTGCAGGTGCCGG - Intergenic
1164820684 19:31248937-31248959 GGATGCTGGGGTGATGGAGCAGG + Intergenic
1165303652 19:34989673-34989695 AGTTTCTGCAGTGATGGAGGGGG - Intergenic
1166002651 19:39887002-39887024 GGAGTCTGCAGAGCTGGAAAGGG + Intronic
1166005437 19:39903254-39903276 GGAGTCTGCAGAGCTGGAAAGGG + Intronic
1166358793 19:42243080-42243102 GGATACTGCAGTTCCGGAGATGG + Intronic
1167083960 19:47296441-47296463 TAATTCAGCAGGGCTGGAGCAGG + Intronic
1167321562 19:48799916-48799938 GGATTCTGCAGGGCAGGGGTGGG - Intronic
1168251962 19:55146648-55146670 GGACTCCGCAGGTCTGGAGCTGG - Intronic
1168523555 19:57071358-57071380 TGATTCTGCAGTGAGGGAGGGGG + Intergenic
1168700201 19:58433835-58433857 GAATTCTCCAGTGCTGAATCAGG + Exonic
925142823 2:1561670-1561692 AGAGGCAGCAGTGCTGGAGCTGG + Intergenic
925382097 2:3435627-3435649 GGACTCTGCGCTGCTGGAGCAGG - Intronic
926436567 2:12844454-12844476 GGCTTCTGCAGTGTTCTAGCAGG - Intergenic
927171634 2:20375298-20375320 GGAATGTCCAGTGTTGGAGCTGG - Intergenic
927177279 2:20419634-20419656 GGAATGTCCAGTGTTGGAGCTGG - Intergenic
929528173 2:42725770-42725792 GGATTCTGCAGTGCTGGAGCAGG - Intronic
929572453 2:43031176-43031198 GGAGTCTACAGTTCTGCAGCTGG + Intergenic
929920483 2:46167904-46167926 GGAGCCTGCTGTGCTGGAACAGG - Intronic
930081928 2:47457604-47457626 GGAATCCCCAGTGCTGGAGGTGG - Intronic
931365168 2:61613054-61613076 GAATTCTGGAGTGCTTTAGCAGG + Intergenic
931439310 2:62276809-62276831 GTAATCTGCAATGCTGGAGGTGG + Intergenic
931439596 2:62278853-62278875 GTAGTCTGCAGTGCTGGAGGTGG + Intergenic
931454096 2:62393508-62393530 GGATTCTACAGTACAGGACCTGG - Intergenic
932528162 2:72495937-72495959 GGTTTCTGCTGTCCTGGGGCTGG + Intronic
932734621 2:74246045-74246067 GGGTGCTGCAGAGCAGGAGCAGG - Intronic
932799323 2:74725835-74725857 GGATGCTGCAGAGTTGGAGGAGG + Intergenic
933604551 2:84368579-84368601 GTATTTTGCAGTGGTGGAGTGGG - Intergenic
934174439 2:89566554-89566576 GCAGTCTCCAGTGCTGGAGTTGG + Intergenic
934284755 2:91640904-91640926 GCAGTCTCCAGTGCTGGAGTTGG + Intergenic
934320494 2:91967313-91967335 AGCTTCTGCAGTGGTGGGGCTGG - Intergenic
935057323 2:99578896-99578918 GGATTCAGCAGGGCTGGGGTGGG + Intronic
936418969 2:112346189-112346211 GTAGTCTGGAGTGCAGGAGCAGG - Intergenic
936663763 2:114571148-114571170 GTAATCTCCAGTGCTGGAGACGG + Intronic
936854852 2:116944913-116944935 GTAATCTCCAGTGCTGGAGGTGG - Intergenic
937328587 2:121007420-121007442 GTAATCTCCAGTGCTGGAGGAGG - Intergenic
937541360 2:122958244-122958266 GTTTTATGCAGTGCTGGAGATGG + Intergenic
937624245 2:124025452-124025474 GGATTCTTCGGAGCTGCAGCTGG - Exonic
938692759 2:133807543-133807565 GTTTTCTGCTGTGCTGCAGCTGG - Intergenic
939019210 2:136939160-136939182 GGTTTCTGCATTCCTGTAGCTGG + Intronic
939448281 2:142337709-142337731 GAAATCTCCAGTGCTGGAGGTGG + Intergenic
942415130 2:175750779-175750801 GTAGTCTCCAGTGCTGGAGGTGG + Intergenic
943373331 2:187044441-187044463 GTAATCTGCAATGCTGGAGGTGG + Intergenic
944857597 2:203783512-203783534 GGATTCTGTAGGCCTGGAGAAGG + Intergenic
945060838 2:205907296-205907318 CAATTCTGCTTTGCTGGAGCTGG + Intergenic
945313692 2:208346617-208346639 AGATTTGACAGTGCTGGAGCTGG + Intronic
948359923 2:237412866-237412888 GGAGTCTGCTGTGCTGGATGGGG - Intronic
1170237487 20:14123420-14123442 GGATGCTGCAGTGCTGATGAAGG - Intronic
1170755827 20:19206166-19206188 TCATTCTGCAGTTCTGGGGCTGG + Intergenic
1174364728 20:50049747-50049769 GGAGTCTCCAGGGCTGGGGCAGG - Intergenic
1174450543 20:50617424-50617446 GGATTGTGCAGAGTGGGAGCTGG - Intronic
1175342562 20:58243075-58243097 GGATGCTCCAGTGCTGGTCCTGG - Intergenic
1175653717 20:60750810-60750832 GGAGTCTGCAGGGCTGGTGAAGG + Intergenic
1176033339 20:63024387-63024409 CCACTCTGCAGTGCGGGAGCTGG + Intergenic
1176185490 20:63776109-63776131 GGCTGCTGCATTGCTGGGGCAGG - Intronic
1176454985 21:6900022-6900044 GGATTCTGTAGTGCCTGAGATGG + Intergenic
1176833158 21:13765070-13765092 GGATTCTGTAGTGCCTGAGATGG + Intergenic
1177675613 21:24294822-24294844 GTACTCTGCAGTGTTGGAGGTGG - Intergenic
1179642641 21:42757553-42757575 TGATTCCTCAGTTCTGGAGCTGG + Intronic
1180010910 21:45050634-45050656 GGCTCCTCCAGTGCAGGAGCTGG + Intergenic
1180308739 22:11151372-11151394 AGCTTCTGCAGTGGTGGGGCTGG - Intergenic
1180547216 22:16513183-16513205 AGCTTCTGCAGTGGTGGGGCTGG - Intergenic
1180704866 22:17803089-17803111 TGATTCTGCAGGTCTGGGGCAGG + Intronic
1182145230 22:27993305-27993327 TGCTGCTGCACTGCTGGAGCCGG + Exonic
1182801881 22:33038366-33038388 GTTTTCTGCAGAGCTGGAGGAGG - Intronic
1184170743 22:42758329-42758351 GGAGTCTGCAGTGATGGAGAAGG - Intergenic
1184244338 22:43228333-43228355 GGAGCATGCACTGCTGGAGCCGG - Intronic
1185032138 22:48449728-48449750 AGATTCTGCAGCGCTGGTGGGGG - Intergenic
1185256917 22:49838959-49838981 GGAATCTGCAGAGGCGGAGCCGG + Intergenic
949200835 3:1377779-1377801 GGATTCTCCAGAGCTGTAGAAGG + Intronic
950297108 3:11841741-11841763 GCTTTCTGCAGTGCTGCTGCTGG - Intronic
950310904 3:11956923-11956945 GTAATCTCCAGTGCTGGAGGTGG + Intergenic
952423194 3:33149353-33149375 TGATTCAGCAGTCCTGGGGCAGG + Intergenic
953439687 3:42906749-42906771 GGAATTTGCAATGCAGGAGCAGG + Intronic
954369576 3:50163168-50163190 GCATTCTGCAGTGCTGGTTTAGG + Intronic
954406032 3:50345528-50345550 GGAAGCTGAAGTGCTGGTGCGGG - Exonic
954460228 3:50622358-50622380 AAATTCTTCAGTGCTGGAGAAGG - Intronic
954589371 3:51768319-51768341 GTATTCCGCAGTGTTGGAGGTGG - Intergenic
954652322 3:52172623-52172645 GTATTCTGCAGTAGTGGAGGAGG - Intergenic
954804853 3:53211998-53212020 GGAATCTCCAGTGTTGGAGGTGG - Intergenic
956717924 3:72094661-72094683 GAACTATGCAGTCCTGGAGCAGG + Intergenic
957800101 3:85066941-85066963 AGATCTTGCAGTGCTGGGGCAGG + Intronic
958560982 3:95745581-95745603 GTAAACTGCAGTGCTGGAGATGG - Intergenic
959696480 3:109254088-109254110 GTAATCTCCAGTGTTGGAGCAGG + Intergenic
961092114 3:124122214-124122236 GCAGTCTGCAGTGCTGGTGGAGG + Intronic
961597177 3:128027754-128027776 GGAGGCTGCAGTTCTGGAGATGG + Intergenic
962926515 3:139998761-139998783 AGACTCTGCAGTTCTGAAGCTGG - Intronic
965397157 3:168173728-168173750 GTAATCTCCAGTGCTAGAGCTGG - Intergenic
965612992 3:170564367-170564389 ACACTCTCCAGTGCTGGAGCTGG + Intronic
966579433 3:181543396-181543418 GGATGCTTCAGTGATGGAGAAGG - Intergenic
966619632 3:181950036-181950058 GGATACTGAAGGACTGGAGCTGG - Intergenic
967282142 3:187833026-187833048 GGGCCCTGCTGTGCTGGAGCAGG + Intergenic
967953473 3:194858924-194858946 CTATTCTGCTCTGCTGGAGCTGG + Intergenic
968908378 4:3464654-3464676 GGATGGTGCTGGGCTGGAGCCGG + Intronic
969354977 4:6619997-6620019 GCATGCTGCACCGCTGGAGCTGG + Exonic
969368284 4:6713288-6713310 GTAATCTCCAGTGTTGGAGCTGG - Intergenic
969496745 4:7530529-7530551 GGATTCTGCATCGATAGAGCAGG + Intronic
969622564 4:8286008-8286030 GCATCCTGCAGGGCTGCAGCAGG - Intronic
969828291 4:9775497-9775519 GCAATCTCCAGTGCTGGAGTTGG + Intronic
970074009 4:12196745-12196767 GTAATCTCCAGTGCTGGAGGTGG - Intergenic
970402572 4:15731868-15731890 GGAGGCTGCAGGGCTGGAGGAGG - Exonic
971310722 4:25523649-25523671 GGATTCTGCTTTGCTCCAGCAGG + Intergenic
974786094 4:66621243-66621265 CATTTCTGCAGTGCTGGAGCTGG - Intergenic
975476212 4:74826155-74826177 GGATTCTGTAGTGATGAAACCGG + Intergenic
976095550 4:81504993-81505015 GGCTTCTTCAGTGCAGGATCAGG - Intronic
979362139 4:119777099-119777121 GTAATCTCCAGTGCTGGAGATGG - Intergenic
979366478 4:119830603-119830625 GGATGCTGCAGTGGAGCAGCTGG + Intergenic
979779709 4:124635409-124635431 GTAATCTGCAGTGTTGGAGAAGG + Intergenic
985280202 4:188278728-188278750 GGATTCTGCACTGCTGTTGATGG + Intergenic
985731442 5:1551520-1551542 GGCACCTGCCGTGCTGGAGCTGG + Intergenic
985766835 5:1784517-1784539 GGAGTCCACAGGGCTGGAGCCGG + Intergenic
986472863 5:8093384-8093406 GTAATCTCCAGTGTTGGAGCTGG - Intergenic
986595298 5:9415820-9415842 ATGTTCTGCAGTGCTAGAGCTGG + Intronic
989343501 5:40403768-40403790 GAATTCTCCAGTGCTGGAAGAGG + Intergenic
989555775 5:42792834-42792856 GGATTTTAGAGTGCAGGAGCTGG + Intronic
990325352 5:54670376-54670398 GGATTCTGCAGTGTTGATGAGGG - Intergenic
990544674 5:56811021-56811043 GGATTCAGCAGAGTTGGACCAGG + Intergenic
992005158 5:72470366-72470388 AGATTCTGCAGGGCAGGAGGAGG + Intronic
992843117 5:80715861-80715883 GTAATCCCCAGTGCTGGAGCAGG - Intronic
992905120 5:81338299-81338321 GTAATCCCCAGTGCTGGAGCAGG + Intronic
993869767 5:93238738-93238760 GTATTCTTCAGTGTTGGAGGTGG - Intergenic
997546339 5:134711353-134711375 GGAATCTGCAGTGCTGCTTCAGG - Intronic
999112175 5:149131246-149131268 TGATTCTGCAGGACTGGGGCAGG + Intergenic
1000891881 5:166810636-166810658 GGCTCCTGCAGTGCAGCAGCGGG + Intergenic
1001831312 5:174791478-174791500 TGATTCTGTAGGGCTGGAGAAGG - Intergenic
1002471896 5:179440415-179440437 GGAGTCTTCAGTGTTGGAGGTGG - Intergenic
1003534292 6:6962771-6962793 TGGGTCTGCAGTGCTGGGGCTGG - Intergenic
1003557539 6:7154290-7154312 TGATTCAGCAGGGCTGGAGTGGG - Intronic
1005159593 6:22843573-22843595 GCATTCTCCATGGCTGGAGCAGG - Intergenic
1005990534 6:30899202-30899224 TGATGCTTCGGTGCTGGAGCCGG + Exonic
1006727685 6:36211502-36211524 GGATGCAGCTGTGCTGGAGCAGG + Exonic
1006984034 6:38166137-38166159 GGGTTCTGCTGTGCTGGGGGAGG - Intergenic
1007285842 6:40746799-40746821 GGATCCTGCAGGGTGGGAGCTGG - Intergenic
1007507684 6:42348924-42348946 AGACTTTGCAGTGGTGGAGCTGG - Intronic
1008511035 6:52276082-52276104 GGATTCTGCTGTGCAGGAATGGG + Intronic
1010070404 6:71737568-71737590 GGATTCTCAAGTTCTGGAGGGGG + Intergenic
1011338406 6:86285216-86285238 GGCTCCTGCAGTGCAGCAGCAGG + Intergenic
1015999590 6:139029294-139029316 GGACTCTGCAGCGCCGGAGGTGG + Intronic
1017315906 6:153031097-153031119 AGATGTTGCAGGGCTGGAGCAGG + Intronic
1017573794 6:155778951-155778973 GTAATCTCCAGTGCTGGAGGTGG + Intergenic
1018424160 6:163664794-163664816 GGATGCAGCAGGGCTGGACCAGG + Intergenic
1018727044 6:166620979-166621001 GGATTCTGCAGGCATGGAGCAGG - Intronic
1019001555 6:168757706-168757728 GTAATCTGCAGTGTTGGAGATGG + Intergenic
1019506698 7:1395046-1395068 AGATTCTGCAGGGCTGGAGGTGG - Intergenic
1020469578 7:8520842-8520864 GAATTCTGCAGTGATGGACAAGG - Intronic
1020722887 7:11771748-11771770 GGAATCTCCAATGCTGGAGTTGG + Intronic
1020793176 7:12651341-12651363 AGAATCTGCAGTGGTGCAGCCGG - Intronic
1022029982 7:26483734-26483756 GGGTTCTGCTGTTCTGGAGACGG + Intergenic
1022225444 7:28358021-28358043 GGGTTCTACAGTGAAGGAGCTGG + Intronic
1022301661 7:29107654-29107676 TGATTCTGCAGATCTGGAGAGGG - Intronic
1022515378 7:30971893-30971915 GGATTCTGGTGTGCTGCAACTGG - Intronic
1022887468 7:34661362-34661384 GGATTCCCCAGGGCTGGACCAGG - Intronic
1023091152 7:36618675-36618697 GGATTCTGCAGTCTCTGAGCTGG + Intronic
1023527105 7:41116329-41116351 GGAGACTGTAGAGCTGGAGCAGG + Intergenic
1023844786 7:44114490-44114512 GGTTGCTGCAGTGTTGGAGTAGG + Exonic
1024300759 7:47885800-47885822 GGACTCTGCAGTCCTGGGGGAGG - Exonic
1025937628 7:66049776-66049798 GTAATCTCCAGTGCTGGAGATGG - Intergenic
1026104090 7:67407504-67407526 GAATTCTTTATTGCTGGAGCCGG - Intergenic
1027266266 7:76496793-76496815 GGATGCTGCAGTGTGGGAGCAGG + Intronic
1027317646 7:76994911-76994933 GGATGCTGCAGTGTGGGAGCAGG + Intergenic
1028410842 7:90528908-90528930 GTAATCTCCAGTGCTGGAGGTGG + Intronic
1030271033 7:107668382-107668404 GGATTCTGCAGTAGATGAGCTGG + Intronic
1030799904 7:113837234-113837256 GTAATCTCCAGTGCTGGAGGTGG + Intergenic
1033497162 7:141910629-141910651 GGGTTCTGCATTGCTGGGGCGGG + Intronic
1033677462 7:143556895-143556917 GAGTCCAGCAGTGCTGGAGCTGG - Intergenic
1033694372 7:143772541-143772563 GAGTCCAGCAGTGCTGGAGCTGG + Intergenic
1033981534 7:147171024-147171046 GGATTCAGCAGACATGGAGCTGG - Intronic
1034908564 7:154973051-154973073 GCATTGGGCGGTGCTGGAGCTGG + Intronic
1035296619 7:157871010-157871032 GGCTCTTGCAGTGCTGGTGCTGG + Intronic
1036700729 8:11012138-11012160 AGCTTCTGCAGTGCTGGCCCTGG - Intronic
1038058852 8:23889905-23889927 TGATTCAGCAGTTCTGGGGCAGG - Intergenic
1038868478 8:31466074-31466096 GCCTTCAGAAGTGCTGGAGCAGG + Intergenic
1039082740 8:33749122-33749144 GGATTTTGCACTTCTGGAGCTGG + Intergenic
1039118323 8:34117125-34117147 GTAATCCCCAGTGCTGGAGCTGG + Intergenic
1039328050 8:36506341-36506363 GGACTCTACAAAGCTGGAGCTGG + Intergenic
1039825957 8:41174254-41174276 GTAATCTCCAGTGCTGGAGGTGG - Intergenic
1039995179 8:42526104-42526126 GAACTCTGCAGTGGTGAAGCTGG + Intronic
1041673755 8:60517380-60517402 CATTTCCGCAGTGCTGGAGCTGG + Intronic
1041776700 8:61530467-61530489 GGATTCAGGAGAGCTGGGGCAGG - Intronic
1046549549 8:115697035-115697057 TGATTCTGTAGGGTTGGAGCGGG + Intronic
1047530992 8:125675088-125675110 GTAATCTCCAGTGCTGGAGGTGG - Intergenic
1048102674 8:131371290-131371312 GGCATCTGCAGTGGTGGAGAGGG - Intergenic
1049442646 8:142616319-142616341 GGATTCCGCAGTGGAGAAGCGGG - Intergenic
1049454698 8:142680989-142681011 GGAAGCTGCAGTGCTGGGACTGG - Intronic
1051248483 9:15135912-15135934 GGAGTCTGCAGTGCAGCGGCAGG + Intergenic
1051434653 9:17018209-17018231 GGGCTCTGCAGAGCTGGAGCTGG - Intergenic
1053186784 9:36023044-36023066 GTAATCCCCAGTGCTGGAGCTGG - Intergenic
1055962871 9:81836939-81836961 GTAATCTCCAGTGCTGGAGGGGG - Intergenic
1056578798 9:87875554-87875576 GCTGTCTGCAGTGCTGGAGTTGG + Intergenic
1057149837 9:92786763-92786785 GGATTTTGCCTTGCTGGTGCTGG + Intergenic
1058654387 9:107206741-107206763 GGATTATGCAGTGATGGGGAAGG + Intergenic
1060503689 9:124181930-124181952 GGAATCTACAGTGGTTGAGCTGG - Intergenic
1061493009 9:130956690-130956712 GAATTCTGCAGTATTGGAACTGG + Intergenic
1061786090 9:133029565-133029587 GGATTATGCAGTCTCGGAGCTGG + Intergenic
1062512938 9:136917408-136917430 AGAGTCTGCAGGGGTGGAGCAGG - Intronic
1062668513 9:137692757-137692779 GGCTTCACCAGGGCTGGAGCAGG - Intronic
1185711158 X:2304439-2304461 GGAATCCCCAGTGCTGGAGGTGG + Intronic
1186443643 X:9607389-9607411 GGATGAGGCAGTGCTGGTGCTGG + Intronic
1186538206 X:10371734-10371756 AGATTCTGCAGTGCTGGCTGAGG + Intergenic
1186955749 X:14679888-14679910 GGATTCTTAAGTGGTGAAGCAGG + Intronic
1189031391 X:37455070-37455092 GGAGTCTGTAGGGATGGAGCTGG - Exonic
1189103443 X:38213962-38213984 GTAATCTTCAGTGCTGGAGGTGG - Intronic
1189941366 X:46125720-46125742 TGCTTCTTCAGTGCTGGAACTGG + Intergenic
1190846611 X:54198352-54198374 GGATTCTGCACTGATGAAGTTGG + Exonic
1193934465 X:87600058-87600080 GGAATCCTCAGTGCTGGAGATGG + Intronic
1195814110 X:108866925-108866947 GTAATCTCCAGTGCTGGAGGTGG - Intergenic
1195992239 X:110694088-110694110 GGTCTTTGCAGGGCTGGAGCTGG - Intronic
1197706773 X:129639854-129639876 GGTCTCTGCAGTGCTGGAGGTGG + Intergenic
1200832759 Y:7703712-7703734 GGGTTCAGCAGATCTGGAGCAGG + Intergenic
1201187997 Y:11422418-11422440 AGCTTCTGCAGTGGTGGGGCTGG - Intergenic