ID: 929531433

View in Genome Browser
Species Human (GRCh38)
Location 2:42755506-42755528
Sequence GAGCTTTACTTACAAGAGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 158}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929531433_929531437 7 Left 929531433 2:42755506-42755528 CCTTCCTCTTGTAAGTAAAGCTC 0: 1
1: 0
2: 1
3: 6
4: 158
Right 929531437 2:42755536-42755558 TGTAGTCCAGTCATCCTAGGAGG 0: 1
1: 0
2: 0
3: 5
4: 127
929531433_929531438 8 Left 929531433 2:42755506-42755528 CCTTCCTCTTGTAAGTAAAGCTC 0: 1
1: 0
2: 1
3: 6
4: 158
Right 929531438 2:42755537-42755559 GTAGTCCAGTCATCCTAGGAGGG 0: 1
1: 0
2: 0
3: 4
4: 75
929531433_929531436 4 Left 929531433 2:42755506-42755528 CCTTCCTCTTGTAAGTAAAGCTC 0: 1
1: 0
2: 1
3: 6
4: 158
Right 929531436 2:42755533-42755555 TTCTGTAGTCCAGTCATCCTAGG 0: 1
1: 0
2: 0
3: 20
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929531433 Original CRISPR GAGCTTTACTTACAAGAGGA AGG (reversed) Exonic
905749075 1:40445968-40445990 GAGCTTTACTTCCAACATAAGGG + Intergenic
906178371 1:43796157-43796179 GAGCTATAGTCCCAAGAGGATGG + Intronic
908468733 1:64421180-64421202 GTGCTGTATTTACAAGAGAAGGG + Intergenic
909765460 1:79350184-79350206 GAGCTTTTCTTATAAGAAAAGGG - Intergenic
909846194 1:80397749-80397771 GAGCTTTACTTCCAAGTGTGTGG + Intergenic
910205954 1:84748880-84748902 AATCTTTACTTACATGAGGCGGG + Intergenic
910644035 1:89493704-89493726 GAGCTTTACTTCCAAGTATATGG - Intergenic
915981337 1:160421808-160421830 GAGCTTTACCTGCAACAGCATGG + Intronic
917440913 1:175067955-175067977 AAGCTTTACTTACTGGAGGGAGG + Intronic
917684700 1:177404323-177404345 GAGCTTTACTTCCAAGAATGTGG + Intergenic
919281219 1:195491809-195491831 TAGCTTGACTTTAAAGAGGATGG + Intergenic
921334216 1:214070158-214070180 GAGCTTTTCTAACATGAGGTTGG - Intergenic
921894488 1:220385283-220385305 GAGCTATACTTCCAAAATGAAGG - Intergenic
923187812 1:231591009-231591031 GAGGGTAACTTACAAGCGGAGGG - Intronic
924847585 1:247788667-247788689 GAGCTCTACTTCCAATAGTATGG - Intergenic
1068870498 10:61938560-61938582 GATCTTTTATTTCAAGAGGATGG + Intronic
1070361254 10:75691716-75691738 CAGCTGTAATGACAAGAGGAAGG + Intronic
1071070669 10:81689861-81689883 TAGCTTTCCTTACAAGAGAAAGG + Intergenic
1073975274 10:109093883-109093905 GAGCTTTACTTCCAAGTGTGTGG + Intergenic
1075173333 10:120136328-120136350 GAACTTTGCTTCCAAGAGCAAGG + Intergenic
1075895240 10:125989388-125989410 GAGCTTTACTCACAAAAGGAAGG - Intronic
1076533720 10:131162267-131162289 GAGCTTTAGCTACAAATGGAAGG + Intronic
1083091597 11:60205308-60205330 AAGTTTAACCTACAAGAGGAAGG + Intronic
1083189177 11:61036962-61036984 GAGCTTTTCATAGACGAGGACGG + Intergenic
1085190344 11:74615159-74615181 CAGCTTTACTGACAAGAACAGGG - Intronic
1090116083 11:123975778-123975800 CAGCTTACCATACAAGAGGAAGG - Intergenic
1091279395 11:134373533-134373555 GAGCTTTGCTTGCAAGCGAACGG + Intronic
1093363366 12:18260443-18260465 GAGCTTGACCTAGAAGTGGAGGG - Intronic
1095714919 12:45333486-45333508 GAGCTTTACTGCCATGATGAAGG + Intronic
1097257055 12:57685830-57685852 GAGCTTTCTTTTCTAGAGGAAGG - Intergenic
1106487578 13:30185833-30185855 GGTCTTTAGTTGCAAGAGGAAGG + Intergenic
1107400392 13:40063637-40063659 GAGTTTTACATGGAAGAGGAGGG - Intergenic
1113807893 13:113120647-113120669 AAACTTTATTTACAAGAGCAGGG - Exonic
1115096995 14:29649248-29649270 GAGCTTTACTTTTTAGAGGCAGG + Intronic
1116723917 14:48536527-48536549 GAGCCTTACTTGCATGGGGAAGG - Intergenic
1118929085 14:70223548-70223570 GAGTTTTTCCTACAAGAAGAAGG - Intergenic
1119135913 14:72219720-72219742 GACCTTAAATCACAAGAGGAAGG - Intronic
1120069934 14:80091251-80091273 GAGCTTTACTTCCAAGTATATGG - Intergenic
1120510401 14:85406542-85406564 GAGCCTTGTTTACAAGAAGAGGG - Intergenic
1124649743 15:31465803-31465825 GAGCTCCACCTCCAAGAGGAAGG + Intergenic
1126527336 15:49670899-49670921 AAGCTGTACTTAAAAGAGGGAGG + Intergenic
1127645179 15:60951025-60951047 GAGCTTTACTTCCAAGTGTGTGG - Intronic
1127748359 15:62004926-62004948 GAGCTTTACTTCCAAGTATATGG + Intronic
1131331466 15:91503220-91503242 GAGCTTTACTTCCAAGTAGGTGG - Intergenic
1131821208 15:96275819-96275841 GAGTTTTACTTAGTAAAGGAAGG + Intergenic
1134243789 16:12524832-12524854 GAGCAGTACTTACACGAAGAAGG - Exonic
1134642067 16:15837264-15837286 CTTCTTTACTTTCAAGAGGAAGG + Intronic
1141342246 16:83213791-83213813 GAACTTTTCTTAGAAGAGGATGG + Intronic
1145713131 17:26994566-26994588 GAGCTTTCAGGACAAGAGGAGGG + Intergenic
1146379190 17:32316012-32316034 GAGCTGGACTAACAAGAGGAAGG - Intronic
1147617983 17:41841822-41841844 GAGCTTTGTTTACAAGTGGCTGG + Exonic
1149059197 17:52402024-52402046 GAGTTTTACTTAGAATTGGAAGG - Intergenic
1150880132 17:69015092-69015114 GTGCTTTACTCAGAAGGGGAGGG + Intronic
1153487361 18:5613366-5613388 GAGCATTACTGCCAAGAGGCAGG - Intronic
1155612596 18:27683631-27683653 GACATTTAGTTACTAGAGGAGGG - Intergenic
1157587264 18:48811831-48811853 TAGCATTACTGACAAGAGGTGGG - Intronic
1159089446 18:63831241-63831263 CAGCTGTAGTTACAAGAGAAAGG + Intergenic
1159394050 18:67833142-67833164 GAGCTTTAGAAAAAAGAGGAAGG + Intergenic
1160667798 19:341219-341241 GAGCCTGACTAACAAGGGGATGG + Intronic
1161969429 19:7568600-7568622 GAGCTTTGCTGACTAGGGGAGGG + Intergenic
1164786159 19:30932770-30932792 TTGCTTTTCTTACAAAAGGAGGG + Intergenic
1165102534 19:33447341-33447363 GGGCTTTTCTAACAAGAGGGTGG + Intronic
1166134918 19:40770382-40770404 AAGCTTTTTTTAGAAGAGGATGG - Intergenic
1167199016 19:48051084-48051106 GATCTTTCCTTATAAGAGCAAGG + Intronic
925852087 2:8091628-8091650 GAGCTTTCCTTACTAGATGCTGG - Intergenic
926906734 2:17812733-17812755 GAGCATTCATTACATGAGGAGGG - Intergenic
928287483 2:30005669-30005691 GAGATTTTCTTACCAGAAGAAGG + Intergenic
929531433 2:42755506-42755528 GAGCTTTACTTACAAGAGGAAGG - Exonic
931754488 2:65360182-65360204 GAGCTTTACTGACAGGTGGAAGG + Intronic
933479031 2:82831351-82831373 CAGCTTTACTCACAAGATGAAGG + Intergenic
936493898 2:113000416-113000438 CTGCTTTACTTCCAAGAGGGAGG + Intergenic
938322771 2:130376223-130376245 GAGCTTTCTTAACAAGAGAACGG - Intergenic
940727036 2:157345792-157345814 GAGCTTTACCTCCAAGAACATGG + Intergenic
943036202 2:182749061-182749083 GAGCTTTACTTCCAAGGGTGTGG + Intronic
948030961 2:234816998-234817020 GAATTTTTTTTACAAGAGGAAGG + Intergenic
1169184230 20:3599826-3599848 GAGCTGTCCTTTCAAGATGAAGG + Intronic
1169242548 20:3996810-3996832 GAGGTTTACACCCAAGAGGAGGG + Intronic
1170416533 20:16148632-16148654 GAGTTTTACTTCCAAGAGTTTGG + Intergenic
1170645054 20:18190376-18190398 GAGCTCTATTTACAGCAGGATGG + Intergenic
1170818457 20:19735355-19735377 GTGCTTTACTTGCAAGATAAGGG + Intergenic
1174418473 20:50383671-50383693 GAGCTGAACTGAAAAGAGGATGG - Intergenic
1174672977 20:52325072-52325094 GAGTTTTCCATGCAAGAGGAGGG + Intergenic
1180799910 22:18626920-18626942 GAGCCTCACCTACAGGAGGATGG - Intergenic
1181221805 22:21368346-21368368 GAGCCTCACCTACAGGAGGATGG + Intergenic
1184859812 22:47166911-47166933 GAGCTCTGCTTACAAGGGTAGGG - Intronic
1185108323 22:48886647-48886669 GAGCTCTACTTACAGGGGGTCGG + Intergenic
955888660 3:63627048-63627070 GAGCATCATTTAGAAGAGGAAGG - Intergenic
956285968 3:67610583-67610605 AAACATTACTCACAAGAGGAAGG + Intronic
959206402 3:103312394-103312416 TACCTTTACTTACAGGAAGATGG - Intergenic
960557758 3:119047733-119047755 GAGCTTTACTTCCAAGTGTGTGG - Intronic
960631279 3:119733899-119733921 GAGCTTTAACTACATGAGAAAGG - Intronic
961842914 3:129732707-129732729 GAGCTGTGGTTACAAGAGGGTGG - Intronic
962648367 3:137463034-137463056 GAGCATCACTAACAAGGGGAAGG - Intergenic
965243108 3:166229036-166229058 GAGCTTTACTTACAAGTATGTGG - Intergenic
965254694 3:166390843-166390865 TAGCTATTCTTACAAGAGTAAGG + Intergenic
967285517 3:187865080-187865102 GAGCTTTACTTCCAAGAATGTGG - Intergenic
967513947 3:190344959-190344981 GACTTTTACTTAGAAGAGTATGG + Intronic
970158847 4:13169017-13169039 TAGCTATACTGACTAGAGGAAGG - Intergenic
970429882 4:15978830-15978852 GAGCTTTGCTTGCCAGAGGTCGG - Intronic
971872669 4:32264303-32264325 AAGCTTTACTAACTAGATGAAGG - Intergenic
974393861 4:61309790-61309812 GAGCTGTTCTTGCAATAGGATGG + Intronic
974878832 4:67729826-67729848 GAGATTTACTTACTTGAAGAGGG + Intergenic
975789496 4:77933268-77933290 GAGCTGTAGTCACAAGAGGGTGG + Intronic
982870813 4:160576629-160576651 GAGCTTTACTTCCAAGTATATGG - Intergenic
983932465 4:173467849-173467871 GCTTTTTAATTACAAGAGGATGG + Intergenic
984291513 4:177801005-177801027 GAGCAGTAGTTACCAGAGGATGG - Intronic
986724628 5:10585081-10585103 GTGCTTTACTCACAAAGGGAAGG + Intronic
988880535 5:35496969-35496991 GAGCTTTACTTCCAAGTGTGTGG - Intergenic
992030120 5:72712721-72712743 AGGCTTAACTTTCAAGAGGAGGG + Intergenic
992699234 5:79323979-79324001 GAAAGTTATTTACAAGAGGATGG - Exonic
994919571 5:106026302-106026324 AAGCTTTACTTACAAGTGTGTGG - Intergenic
995218778 5:109625016-109625038 GAGCTTTACTTCCAACTGTATGG + Intergenic
995677008 5:114673470-114673492 GAGCTTTACTTCCAAGTGTGTGG - Intergenic
1000468463 5:161609461-161609483 GAGCTTTACTTCCAAGCAGGTGG + Intronic
1001262444 5:170243183-170243205 GAGCTTTACTTCCAAGTATATGG + Intronic
1002420114 5:179141669-179141691 AAGCTTTACTGCCAAGAAGACGG + Intronic
1003682475 6:8269559-8269581 GAAATGTTCTTACAAGAGGAAGG + Intergenic
1005886909 6:30103869-30103891 GAGCTCTACATACAGCAGGAGGG + Intronic
1008620492 6:53266608-53266630 GAGCTTTAGGTCCAAGGGGAGGG + Intergenic
1008939621 6:57032116-57032138 AAGCTTTATTTAGAACAGGAAGG + Intergenic
1011984665 6:93428447-93428469 GAGATTAACTTACAAAAAGATGG - Intergenic
1013597952 6:111677695-111677717 GAACTTTACTTTCAAGGGAAAGG - Intronic
1017482916 6:154875021-154875043 GAGTTTGTCTTGCAAGAGGAAGG + Intronic
1020909800 7:14114813-14114835 GAACTTTACTTACAAAAACAGGG + Intergenic
1021042634 7:15882089-15882111 CAGCTCTATTTACAAGAGCAAGG - Intergenic
1022779197 7:33560854-33560876 GAGCTTAAATTGCAACAGGAGGG - Intronic
1022984699 7:35640285-35640307 GAGATTTACTTTCAAGGGGATGG - Intronic
1024194790 7:47048344-47048366 GAGGGTTACATACAAGAGAAAGG - Intergenic
1025252511 7:57361194-57361216 GAGCTGAACTGAAAAGAGGATGG + Intergenic
1031221471 7:118971957-118971979 AAGCTTTATTTACAAAAGCAGGG - Intergenic
1032928046 7:136631567-136631589 GAGTTTTAATTACAAAAGAATGG + Intergenic
1032948755 7:136883048-136883070 TAGCCTTACTCAAAAGAGGAAGG + Intronic
1035682971 8:1502006-1502028 GAGCTATGCTTACAAGAACAAGG + Intronic
1035954298 8:4059028-4059050 GAGCTTTACTTCCAACTGTATGG - Intronic
1040083215 8:43310694-43310716 GAGCTTTACTTCCAAGTAGGTGG + Intergenic
1040990100 8:53340384-53340406 GAGCTTTACTTCCAACTGTATGG - Intergenic
1042318694 8:67452144-67452166 GAGGTTCATTTACAACAGGAAGG + Intronic
1043375480 8:79644627-79644649 GAGGTGTTCTCACAAGAGGAAGG + Intronic
1044147934 8:88740885-88740907 TAGCTTTGCATACAAAAGGAAGG - Intergenic
1044286034 8:90412942-90412964 GACATTTGCTTACCAGAGGATGG - Intergenic
1044353606 8:91195249-91195271 GAGCTTTACTTCCAAGTGTGTGG + Intronic
1044369585 8:91393120-91393142 GCGTTTTAGTTACCAGAGGATGG - Intronic
1044487221 8:92767618-92767640 GACATTTACATACCAGAGGATGG - Intergenic
1045546845 8:103137268-103137290 GAGCTGTAATTAAAAGAGCACGG + Intronic
1046099652 8:109600005-109600027 GAGCTTTACTTCCTTCAGGAAGG + Intronic
1046571890 8:115976506-115976528 TAGCTTTAATTGCAGGAGGAGGG + Intergenic
1046828298 8:118716223-118716245 GTGCTTTACCTACCACAGGAAGG - Intergenic
1051486877 9:17618206-17618228 GAGCTCTACTTACCAGATGCTGG - Intronic
1056973425 9:91228959-91228981 GAGCTTTACTTCCAAGAATGTGG + Intronic
1059966951 9:119624733-119624755 GAGCTTTACTTCCAAGTATATGG + Intergenic
1060253481 9:122004847-122004869 GAGCTTTTATTACAGTAGGAAGG - Intronic
1061704262 9:132440595-132440617 CAGAGTTACTAACAAGAGGATGG - Intronic
1189139997 X:38593664-38593686 GTGGGTTTCTTACAAGAGGATGG + Intronic
1189434885 X:40983396-40983418 GAGATTTAAATACAAAAGGAAGG + Intergenic
1191123485 X:56929897-56929919 GAGGTTTACTTGAATGAGGAAGG - Intergenic
1194324736 X:92499890-92499912 GACCTTTACCTCCAAAAGGAAGG + Intronic
1195503484 X:105630207-105630229 GAGATTTACTCTCAATAGGAAGG - Intronic
1197170113 X:123423786-123423808 AAAATTTACTTACAAGATGAAGG + Intronic
1197178844 X:123512572-123512594 GAGCCTTTCTTAGAAGAGAAGGG - Intergenic
1197671770 X:129285005-129285027 GAGCGTTATTCAGAAGAGGAGGG + Intergenic
1198594679 X:138223486-138223508 AAACTTTACTTACAAAAGGCCGG + Intergenic
1200633470 Y:5619065-5619087 GACCTTTACCTCCAAAAGGAAGG + Intronic
1200774410 Y:7157512-7157534 GAGCTTTACTTCCAAGAATGTGG + Intergenic
1201627316 Y:16028644-16028666 GAGCTTTACTTCCAAGTGTGTGG - Intergenic
1202072715 Y:21009316-21009338 GAGCTTTACTTCCAAGTGTGTGG + Intergenic
1202079162 Y:21066341-21066363 GAGCTTTACTTCCAAGTGTGTGG - Intergenic