ID: 929532056

View in Genome Browser
Species Human (GRCh38)
Location 2:42759220-42759242
Sequence CTGCTGAGATGGAGGAAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 648
Summary {0: 1, 1: 1, 2: 4, 3: 62, 4: 580}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929532056 Original CRISPR CTGCTGAGATGGAGGAAAAA TGG (reversed) Intergenic
901751632 1:11413659-11413681 CTGCTGAGAGGGAGGGACATGGG + Intergenic
902717208 1:18280959-18280981 CTGCTGACATGGAGTGGAAATGG - Intronic
902848817 1:19136509-19136531 TTGCAGAGTTGGAGGAAAAAAGG + Intronic
903295134 1:22338943-22338965 CTGCTGAGCAGAAGCAAAAAGGG - Intergenic
903395668 1:23000097-23000119 CTGATGAGAAGGAGAAAAACTGG + Intergenic
904930519 1:34083265-34083287 AGGCTGAGATGTAGGAAAGAGGG + Intronic
905134350 1:35787018-35787040 CTCCTGTGAAGGAGGAACAACGG + Intergenic
905688590 1:39926511-39926533 CTGCTGATGTGGAGGAGAGATGG - Intergenic
906899259 1:49815649-49815671 CTGGTGAGAATGTGGAAAAAAGG - Intronic
907528640 1:55070549-55070571 CTGCTGAGTTGGAGAGAAGAGGG + Intronic
908819794 1:68073529-68073551 CTGCTGAGGTGGCAGAGAAAAGG - Intergenic
909015049 1:70371825-70371847 CTGATGAGAAGGAGAAAAACTGG - Intronic
909359940 1:74748210-74748232 CTACTGAGCTGGAGAAAATAAGG + Intronic
911737816 1:101356826-101356848 CTGCTGAGAATGTGGAAAAAAGG - Intergenic
913545693 1:119866980-119867002 CTCCTGAGATGGATGCAAAGGGG + Intergenic
914334671 1:146703575-146703597 CTGGTGAGGCAGAGGAAAAAAGG - Intergenic
915358043 1:155268413-155268435 GAGCTGAGTTGGAAGAAAAAAGG + Intronic
916471987 1:165132924-165132946 ATGCTGGGATGGAAGAAAAAAGG + Intergenic
916497780 1:165360631-165360653 TTGGTGAGAGGGAAGAAAAAAGG + Intergenic
916849611 1:168690206-168690228 CTGCAGAGGAGGAGAAAAAACGG - Intergenic
916875948 1:168969150-168969172 ATGGGGAGATGTAGGAAAAAGGG + Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
917461337 1:175233030-175233052 CTGCTGAGAGTGAAGAAATAGGG - Intergenic
917965796 1:180177756-180177778 CCGCTGGGGTGGAGGAAAAGAGG - Intronic
919055186 1:192561841-192561863 TTGCACAGTTGGAGGAAAAATGG + Intergenic
919100786 1:193094860-193094882 CATCAGAGGTGGAGGAAAAATGG - Intergenic
919576744 1:199319524-199319546 CTGGTGAGATTGTGGAGAAAAGG - Intergenic
920648368 1:207819327-207819349 CTGCTGAGATTCAGAAAGAAGGG + Intergenic
920849261 1:209617648-209617670 CTGATGAGTTGGAGAAAAAATGG - Intronic
920948566 1:210552406-210552428 TGGCTGAGATGGTGGAAATACGG + Intronic
920972109 1:210751637-210751659 CTGCTGAGAGGTAGGAGAAGAGG + Intronic
921019205 1:211221056-211221078 CTGCAGTGATCCAGGAAAAAAGG - Intergenic
921372732 1:214441504-214441526 ATGCTGATATTCAGGAAAAAAGG + Intronic
922061239 1:222094406-222094428 CTGCTCTAATGGAGGAAAATTGG - Intergenic
923260594 1:232264368-232264390 CTGCAGAGATGGAGAAAAAATGG - Intergenic
923749541 1:236734898-236734920 TTGCCAAGATGGAGGAAGAAAGG + Intronic
923777203 1:236990394-236990416 CAGCTGTGATGGGGGGAAAAGGG - Intergenic
924044221 1:240011307-240011329 CTGGTCAGATGGAGGAAAGTTGG - Intergenic
924900865 1:248397695-248397717 CTGCTGAGGTTGTGGAGAAAAGG + Intergenic
1062767742 10:78705-78727 CTGCTGAGACAGAGTAGAAATGG + Intergenic
1063001653 10:1929899-1929921 CTGCTAGAATGAAGGAAAAATGG + Intergenic
1063021437 10:2132909-2132931 CTGCTGATGAGAAGGAAAAATGG + Intergenic
1063376033 10:5554974-5554996 CTGCTGAAGTGGAGAGAAAAGGG + Intergenic
1065100520 10:22326122-22326144 CTGCTGGGCTGGAGGACAAATGG + Intronic
1065154123 10:22852318-22852340 CTGCTGAGTTTGAGGAAGAAGGG + Intergenic
1065838052 10:29677173-29677195 CTGCTGAGCTGAAGGCAAAAAGG - Intronic
1066194589 10:33086589-33086611 TTGCCCAGAAGGAGGAAAAATGG + Intergenic
1067986948 10:51159807-51159829 ATGGTCACATGGAGGAAAAAAGG + Intronic
1068173114 10:53421937-53421959 CTGCTCTGGTGGAGGTAAAAGGG + Intergenic
1068704807 10:60063252-60063274 CAGCTGAAAAGGAGAAAAAAAGG + Exonic
1068857576 10:61812964-61812986 CTATTGAGATGGGGGGAAAATGG + Intergenic
1068871664 10:61951694-61951716 CTTCTGAGTGGGAGGAAAATAGG - Intronic
1069234552 10:66054361-66054383 CTGATGAGAATGTGGAAAAAGGG - Intronic
1069246209 10:66210256-66210278 CAGCTGATATGGGGAAAAAATGG + Intronic
1069336097 10:67352612-67352634 CTGCTAACATACAGGAAAAATGG - Intronic
1070515173 10:77198419-77198441 ATGCTGAGATGAAGAAAAGATGG - Intronic
1070640729 10:78167059-78167081 GTGTTCTGATGGAGGAAAAAGGG + Intergenic
1070752120 10:78970151-78970173 ATGCTGAGATGGAGAATAACGGG - Intergenic
1071679984 10:87695237-87695259 AAGCTCACATGGAGGAAAAACGG + Intronic
1073352541 10:102830242-102830264 ATGCTGAGAAGCAGGTAAAAAGG - Intergenic
1073748499 10:106497171-106497193 CTGCTAAGATGTAGGCATAAAGG + Intergenic
1073903036 10:108245300-108245322 CTCCTGACATGGTGGAGAAAAGG - Intergenic
1074399871 10:113133251-113133273 GTGTTGAGATGGAGGAATAAAGG - Intronic
1074642388 10:115401488-115401510 CTGCTGAAATGGAGAAAATGAGG + Intronic
1074848957 10:117423331-117423353 GTGCTGAGATGGAGGAGCACTGG + Intergenic
1076743962 10:132503622-132503644 CTCCCGAGATGGAGGAGAATGGG - Intergenic
1077069763 11:663490-663512 CTGAGGAGATGGAGGAGGAAAGG - Intronic
1077069780 11:663603-663625 CTGAGGAGATGGAGGAGGAAAGG - Intronic
1078746122 11:14116279-14116301 CTTCTTAAATGGAGCAAAAAAGG - Intronic
1078789368 11:14527259-14527281 CTGATGAGAAGGAGAAAAACTGG - Intronic
1079414170 11:20217491-20217513 CTGCTGAGGTAGAGGCAAGATGG - Intergenic
1079835680 11:25329503-25329525 CAGATGAGAAGGAGAAAAAATGG + Intergenic
1079879484 11:25907075-25907097 CTGGTGAGGTTGTGGAAAAAGGG + Intergenic
1080132663 11:28815085-28815107 GAGGGGAGATGGAGGAAAAAAGG - Intergenic
1080176169 11:29365404-29365426 GAGCTGAGATGGAGGATAATGGG - Intergenic
1081402106 11:42655510-42655532 CTGGTGAGGTTGTGGAAAAATGG + Intergenic
1081412113 11:42772051-42772073 ATGTGGAGATGGAGGAAAAAAGG + Intergenic
1083132911 11:60643110-60643132 CTGGTGAGGTTGAGGAGAAAAGG + Intergenic
1085265649 11:75236462-75236484 CTGCTGGGACAGAGGACAAAGGG + Intergenic
1085398649 11:76221247-76221269 CTGGTGAGATTGTGGAGAAAAGG + Intergenic
1085423244 11:76381183-76381205 CTGCTGAGAAGGCGGAAAGGAGG - Intergenic
1085725675 11:78952609-78952631 ATCCTGAGAAGGAGCAAAAATGG - Intronic
1085839298 11:79992710-79992732 CTGTTGAGATGGCAGAATAATGG + Intergenic
1085914184 11:80865020-80865042 CTGATGAGATTGTGGAGAAAAGG + Intergenic
1086070839 11:82797315-82797337 TTCCTGAGATGGAGGAGAAAGGG - Intergenic
1086418540 11:86614460-86614482 CTGCTCAGATGGAGCAAAGAGGG - Intronic
1086474315 11:87154574-87154596 CTGCTGATAGGAATGAAAAATGG - Intronic
1086499984 11:87442727-87442749 CTTCTGAGGTGGGGTAAAAATGG + Intergenic
1086725614 11:90179591-90179613 CTGCAGTGATGGGGGAAATAAGG + Intronic
1087334989 11:96832947-96832969 CTGCACAGTTGGAAGAAAAAAGG - Intergenic
1087350515 11:97026071-97026093 CTGCTGAGAATGTGGAGAAAAGG + Intergenic
1088069887 11:105769382-105769404 CAGATGATGTGGAGGAAAAAGGG + Intronic
1088105871 11:106206105-106206127 TTTCTGAGATGGGGGAGAAAAGG + Intergenic
1088726083 11:112636468-112636490 CTGCTTTTATGAAGGAAAAAAGG + Intergenic
1089729551 11:120511792-120511814 CTGCTGCGGAAGAGGAAAAACGG + Exonic
1089876761 11:121729635-121729657 TTGCTGATAGGGAGGTAAAATGG - Intergenic
1090585668 11:128209395-128209417 CTGGTGACATGGCTGAAAAAAGG + Intergenic
1091107195 11:132933956-132933978 CTCCTGTGATGGAGAAAAAAAGG - Intronic
1091554191 12:1559886-1559908 CTGGGGAGAAGGAGTAAAAATGG - Intronic
1092334176 12:7614434-7614456 CTGGTGAGGTTGAGGCAAAAAGG + Intergenic
1092519036 12:9247478-9247500 CTGTTTAGATGGAGAAACAATGG - Intergenic
1093246580 12:16745588-16745610 CTGGTGAGGATGAGGAAAAAAGG + Intergenic
1093327349 12:17794300-17794322 CTGCTGAGAAGGAAGAAAAGGGG + Intergenic
1094038585 12:26098207-26098229 CTTTTAAGATGGTGGAAAAACGG + Intergenic
1094070926 12:26412242-26412264 CAGCTGAGATGGGGTAGAAATGG + Intronic
1094316864 12:29145251-29145273 CTCCTGACATGGTGGAGAAAAGG + Intergenic
1094359396 12:29613666-29613688 TTGATGAAATGGAAGAAAAAAGG + Intronic
1094435908 12:30420395-30420417 CACCTGAGATGGAGGATGAAGGG - Intergenic
1094650506 12:32371396-32371418 CTGCCAAGAAGGAGTAAAAAGGG - Intronic
1094674800 12:32609336-32609358 CAGGTGAGATGGATGGAAAATGG - Intronic
1095053723 12:37576864-37576886 CTGAAGAGGTGGAGGTAAAAGGG - Intergenic
1095852961 12:46831015-46831037 CTGCTGACTTGGAGGAAAAGGGG - Intronic
1096146795 12:49284093-49284115 ATGATGAGAAGGAGGAAAACTGG - Intergenic
1097229453 12:57500637-57500659 TTGCTGAGATGGGGCAGAAAGGG - Intronic
1097284732 12:57868755-57868777 AAGCTGAGATGGAGGGAAAGGGG - Intergenic
1097379940 12:58882735-58882757 CTGCTGAGGTAGAGGAAAATGGG - Intronic
1098177790 12:67810963-67810985 CTGCTTTCATGGAGGAAAACAGG + Intergenic
1098198399 12:68027233-68027255 GTGCAGTGTTGGAGGAAAAATGG + Intergenic
1098398119 12:70043766-70043788 ATGCTGAGATGGCAGAAGAAGGG + Intergenic
1098920261 12:76296252-76296274 CTGATGAGAGGGAGAAAAACTGG - Intergenic
1100086565 12:90917949-90917971 ATACTGATATGGAGGAGAAAGGG - Intronic
1101769129 12:107732403-107732425 CTACTGAGATAAAGGAAGAAAGG + Intergenic
1101778866 12:107817739-107817761 CTGCTGAGATTTGGGAAACAAGG - Intergenic
1101820949 12:108184002-108184024 CTCCTGAGAAAGAAGAAAAATGG - Intronic
1102383793 12:112489720-112489742 ATGCTGAGATGAAGGAAATGAGG + Intronic
1102726080 12:115066297-115066319 CTTTCGAGATGGAGGAAAATGGG - Intergenic
1102975931 12:117207299-117207321 CAGCTGTGCTGGAGGAAAAGGGG + Intergenic
1104474599 12:129061178-129061200 CTGCTGATATGCAGGTAAACAGG - Intergenic
1105036291 12:132924780-132924802 CTGCTGTGATGGAATAACAAGGG - Exonic
1105247669 13:18667267-18667289 CTGCTGAGACGGGGGAAATCAGG + Intergenic
1105615986 13:22012866-22012888 CTGGTGACATGGAAGAGAAATGG + Intergenic
1105850686 13:24332893-24332915 CTGGTGAGAAGGTGGAGAAAAGG - Intergenic
1106168097 13:27266738-27266760 CTGCTGAGTTGAAGTAAAATAGG + Intergenic
1106552513 13:30784506-30784528 GTGATGAGATGGAGCAGAAAAGG + Intergenic
1106740674 13:32637793-32637815 CTGCTGAGATGAATAAAATAAGG + Intronic
1107108175 13:36669006-36669028 AAGCTGAGATGAAGGAATAAAGG + Intergenic
1107585652 13:41845328-41845350 CTGGCGAGATTGTGGAAAAAAGG + Intronic
1108588634 13:51892806-51892828 CTGCTAGGACGGAGGAACAAAGG - Intergenic
1110069377 13:71154121-71154143 CTGGTGAGGTAGAGGAGAAAGGG - Intergenic
1110441986 13:75536540-75536562 CTTATAAGAGGGAGGAAAAAGGG + Intronic
1110494886 13:76156297-76156319 TTCCTGAGTTGGAGGAAAAAAGG - Intergenic
1111121355 13:83855114-83855136 CTTCTCAGATGGAAGGAAAAGGG - Intergenic
1111704130 13:91726800-91726822 CTGTGCAGATGGAGGAAAAAGGG - Intronic
1113239334 13:108318872-108318894 CTGGTGAGATTGAGGAGAAAAGG - Intergenic
1113849300 13:113408948-113408970 TTGCAGAGAGGGAGGAAAGAGGG + Intergenic
1115021095 14:28682712-28682734 TTGCTGAGATTGTGGAGAAAAGG - Intergenic
1115257054 14:31414561-31414583 CTGATGTGCTGGAGGAATAATGG - Intronic
1115496368 14:34008559-34008581 CTGATGAGATGAAGAAAATATGG - Intronic
1115632354 14:35257810-35257832 CTGCAGAGGAGGAGGTAAAAAGG + Intronic
1115659529 14:35478616-35478638 AAGCTTAGATGGGGGAAAAAAGG + Intergenic
1115803601 14:37024843-37024865 CTTCAGAAATGGAGAAAAAAAGG + Intronic
1115890982 14:38028656-38028678 CTGGTGAGATTGTGGAGAAAAGG + Intronic
1116102996 14:40465439-40465461 CTGCTGACAGGGTGGAGAAAAGG - Intergenic
1116586243 14:46708393-46708415 TTGAAGAAATGGAGGAAAAATGG - Intergenic
1117025567 14:51616547-51616569 CTGCTGCTGAGGAGGAAAAAAGG - Intronic
1117403221 14:55376811-55376833 CTGCTAAGAGCAAGGAAAAAAGG + Intronic
1117533734 14:56684693-56684715 CTCTTAGGATGGAGGAAAAATGG - Intronic
1117630417 14:57684836-57684858 CTCCTGAGAGAGAGGACAAAAGG - Intronic
1117902212 14:60546599-60546621 CTGGTGAGAATGAGGAGAAAAGG - Intergenic
1119195193 14:72712503-72712525 CTGCAGAGATAGAGCAAAAAGGG + Intronic
1120606775 14:86588505-86588527 TTGCTGAGAGGGATGTAAAATGG + Intergenic
1120987535 14:90347294-90347316 CTGCTCAGCTGGAGGAACCAGGG - Intergenic
1121684861 14:95828161-95828183 ATGCTGGGGTGGAGGAAAGAAGG + Intergenic
1122674173 14:103396787-103396809 TGGGTGAGATGAAGGAAAAAAGG - Intronic
1124859140 15:33421137-33421159 CTGGTGAATTGGAGGAGAAACGG + Intronic
1125398526 15:39275387-39275409 CTGAAGAGATGGAAGAAACAAGG - Intergenic
1125844559 15:42839582-42839604 CTGGTGAGATGGTGGTGAAAAGG - Intronic
1125876256 15:43148735-43148757 TTTCTGAGATGGGAGAAAAATGG - Exonic
1126464886 15:48952774-48952796 CTGGTGAGATTGTGGAGAAAAGG + Intronic
1126732071 15:51694013-51694035 GGGTTGAGAGGGAGGAAAAATGG - Intronic
1126884392 15:53134095-53134117 AGGCTGAGCTGGAGGAAGAAAGG + Intergenic
1126975305 15:54171610-54171632 CTGGTGAGAATGTGGAAAAAAGG + Intronic
1128219683 15:65959455-65959477 CTGTTTTGATGGAGGAAAAGTGG - Intronic
1129691225 15:77714708-77714730 CTGCTGAGAGGGAGGAGAGCAGG - Intronic
1129979645 15:79856151-79856173 CTGGTGAGATTGTGGAGAAAAGG - Intronic
1130304860 15:82706589-82706611 CTGATGAGAAGGAGAAAAACTGG - Intronic
1130424499 15:83781926-83781948 CTGGTGAGATTGTGGAGAAAAGG + Intronic
1130868081 15:87949137-87949159 CTGCAAAGAGGGAGGAAGAAGGG + Intronic
1132754761 16:1477768-1477790 CTTCTGAGAGGGAGGGAAAATGG + Intergenic
1132934311 16:2473245-2473267 CTGCAGAGAGGGAGGGAGAATGG - Intronic
1133407370 16:5535866-5535888 CTGCTGAGATGGCTGAAGAGGGG + Intergenic
1134333584 16:13272766-13272788 TTCCCGAGATGGAGGAAAAGGGG - Intergenic
1136059833 16:27718889-27718911 CAGCTGCGGTGGAGGACAAAGGG - Intronic
1136238557 16:28930343-28930365 CAGCAGAGATCCAGGAAAAAGGG + Intronic
1137330666 16:47492408-47492430 CTGCTGATCTGGTGGAGAAAAGG + Intronic
1137719221 16:50618168-50618190 CTGCTCATTTGGAAGAAAAAAGG - Intronic
1139590550 16:67930690-67930712 CTGCAGACACGGAGGAAAAGTGG - Intronic
1139998950 16:71007657-71007679 CTGGTGAGGCAGAGGAAAAAAGG + Intronic
1140067089 16:71620801-71620823 CTGCAGGGAGGGAGGAAGAAAGG - Intergenic
1141447591 16:84072013-84072035 CAGCTTAGATGGGGGTAAAACGG - Intronic
1143032259 17:3974297-3974319 CTGTAGAGATGGAGGCAAGAGGG - Intergenic
1143578758 17:7811449-7811471 CAGCTGAGATGGAGCAGAACAGG - Intronic
1143627391 17:8118323-8118345 ATGCTGAGATGGAGAAAAGGAGG + Intronic
1143710489 17:8731262-8731284 CTGCTGAGGTTGTGGAGAAAAGG + Intronic
1144075263 17:11713536-11713558 CTGGTGAGGTTGAGGAGAAAAGG - Intronic
1144261031 17:13521065-13521087 CTGCTGCCATGTAGAAAAAAGGG - Intronic
1144513732 17:15900392-15900414 CTGGTGAGGTTGAGGAGAAAAGG - Intergenic
1144543147 17:16165757-16165779 CTGCTGATTTGGAGGCACAATGG - Intronic
1145374255 17:22332896-22332918 CTGAAGAGGTGGAGGTAAAAGGG - Intergenic
1145891972 17:28423449-28423471 CTACTGAGGTGGTGGAATAAGGG - Intergenic
1145916330 17:28576174-28576196 CTGCAGTGATGTAGGAAAGAGGG + Intronic
1145980657 17:29009438-29009460 CTGCTGGGAAGTAGGAGAAAGGG + Intronic
1146055411 17:29578364-29578386 TTGCTGAGCTGGAGGAAGAGAGG + Exonic
1146694266 17:34896870-34896892 CTGCTGAATTAGAGGAAGAAAGG - Intergenic
1147597321 17:41725323-41725345 CTGGTGGGAGGGAGGAAGAATGG + Intronic
1148044449 17:44734174-44734196 CTGCTGAACTGAAGGACAAATGG + Intronic
1149063870 17:52457352-52457374 CTGCTGAGGTTGTGGGAAAATGG + Intergenic
1149160228 17:53685013-53685035 CTGGTGAGATTGTGGAGAAAAGG + Intergenic
1149232602 17:54553190-54553212 ATGCTGATAAGGAGGAAAGAGGG - Intergenic
1150078990 17:62219727-62219749 TTTGTGAGATGGAGGGAAAATGG - Intergenic
1150206017 17:63408237-63408259 CTGATTAGATGTAGGAAATAAGG + Intronic
1150649523 17:67000794-67000816 CTGCTGACTTGGAGCAGAAAGGG - Intronic
1151027845 17:70700051-70700073 CAGATGTGATGGAGGGAAAATGG - Intergenic
1151397266 17:73831767-73831789 CTGCTGAGATGAAGGCAATTTGG + Intergenic
1151928925 17:77218582-77218604 CTGCAGAGATGGAGTATTAAAGG - Intergenic
1153881338 18:9424179-9424201 CTGATGAGAAGGAGAAAAACTGG + Intergenic
1155073770 18:22338026-22338048 CAGCTGATATGGAGCAAAAGAGG + Intergenic
1155084922 18:22448739-22448761 CTGATGAGGTTGAGGAGAAAAGG + Intergenic
1155367789 18:25066153-25066175 CTGTTGGGCTGGAGCAAAAAAGG - Intronic
1156451698 18:37270122-37270144 CGGCTAAGTTTGAGGAAAAAAGG + Intronic
1157073647 18:44439805-44439827 CTGGTGAGGTGGAAGAGAAAAGG - Intergenic
1157332724 18:46715178-46715200 CTGCAGAAAAGGAGGGAAAAAGG - Intronic
1158409718 18:57194647-57194669 CTTCTGAGCGGGAGAAAAAAGGG + Intergenic
1158576485 18:58642996-58643018 CTGATGAGAAGGAGAAAAACTGG + Intergenic
1158963319 18:62603966-62603988 CTGCTGAGAAGGTGGATCAATGG + Intergenic
1159395029 18:67845948-67845970 CTGGAGAGATGGAGGCAAGATGG + Intergenic
1159598886 18:70410002-70410024 CTGCTTACATGGAGGGAATATGG - Intergenic
1159929480 18:74296406-74296428 CTGATGAGAAGGAGAAAAACTGG - Intergenic
1161531784 19:4793903-4793925 CTGCTGAGATGGGGGAAATCCGG + Exonic
1162245085 19:9393314-9393336 CTGCTGAAAAGGAAGAGAAAGGG - Intergenic
1162262606 19:9545040-9545062 CTGATGAGAAGGAGAAAAACTGG - Intergenic
1162605005 19:11699884-11699906 CTGCTGAAACAGAGGAAAAAGGG - Intergenic
1162823189 19:13235731-13235753 CTGGGGAGATGGAGGAAGAGGGG + Intronic
1162948085 19:14055426-14055448 CTGCAGAGATGGCGGAGACAAGG + Intronic
1162972288 19:14187923-14187945 CTGGTTAGAGGGAGTAAAAATGG + Intronic
1163071179 19:14843188-14843210 CTGCTGAGGTTGTGGAGAAAAGG + Intergenic
1163140298 19:15343354-15343376 ATGCTGAGATTGGGGAAAATGGG - Intergenic
1164420177 19:28084131-28084153 CTGGTGAGAATGTGGAAAAAAGG - Intergenic
1164568445 19:29349203-29349225 CTGCTGATATCCAGGAAAACAGG + Intergenic
1165446597 19:35860203-35860225 CTCCTGGGATGGAGGAACCAGGG + Intronic
1165759500 19:38312492-38312514 CTACTGAGATGGAGAAAATAGGG + Intronic
1166097659 19:40551115-40551137 AGGCTGAGATGGAGGCAAAGGGG + Intronic
1166266940 19:41690382-41690404 GTGCTGTGATGGAGGAACACAGG - Intronic
1166500105 19:43333679-43333701 GTGCTGTGATGGAGGAACACAGG - Intergenic
1166905411 19:46104970-46104992 CTGATGAGAAGGAGAAAAACTGG + Intergenic
1168057756 19:53872960-53872982 CTCTTGAGAAGGAGGAAAATAGG + Intronic
1168211805 19:54896115-54896137 CTGATGAGAAGGAGAAAAACTGG + Intergenic
1168481023 19:56719693-56719715 CTGCTGGGATGGAGGAAAGATGG + Intergenic
926509597 2:13758209-13758231 CTGTTGAGATGGACTAAAGAGGG - Intergenic
926898541 2:17722793-17722815 TTGCTGAGATAGGGGAAAAGTGG - Intronic
927067054 2:19482566-19482588 CTGGTGAGAATGTGGAAAAAGGG - Intergenic
927134463 2:20086645-20086667 CTGATGAGAAGGAGAAAAACTGG - Intergenic
927394688 2:22636327-22636349 CTACTGAGATGAAGAAAAATGGG - Intergenic
927757013 2:25716844-25716866 CTCCTGACATGGAGGAAAGAAGG - Intergenic
928287769 2:30008471-30008493 TTACAGAGTTGGAGGAAAAAGGG - Intergenic
928311809 2:30217597-30217619 CTGCAGAGAAGTGGGAAAAAGGG - Intergenic
929033351 2:37669560-37669582 CTGCTCAGATTGAGGGAAAGAGG + Intronic
929267622 2:39936958-39936980 CTGGTGAGATTGTGGAGAAAAGG + Intergenic
929532056 2:42759220-42759242 CTGCTGAGATGGAGGAAAAATGG - Intergenic
930066863 2:47334380-47334402 CTGTGCAGATGTAGGAAAAAGGG - Intergenic
930068423 2:47345489-47345511 ATGCTAAGATGGAGGCAGAAAGG - Intronic
930244645 2:48970781-48970803 TTGCTGAGATGGAAAAAACAAGG - Intronic
930942952 2:57035689-57035711 CTGCTGTGCTGGAGGAACCAAGG + Intergenic
931541813 2:63337640-63337662 CTGGTGAGATTGTGGATAAAGGG - Intronic
932297221 2:70636336-70636358 CTTCTGAGAGGGTGGGAAAAGGG - Intronic
932589216 2:73053836-73053858 CTGCTTAGCTGGAGGAAATTTGG - Intronic
933085490 2:78049508-78049530 CTGGTGAGGTTGAGGAGAAAAGG - Intergenic
933634939 2:84698563-84698585 CTGATGTGATGGAGGACACATGG - Intronic
933737590 2:85507699-85507721 CTGGGGAGATGGACCAAAAAGGG + Intergenic
933885739 2:86718655-86718677 CTGCCAAGAGGGAAGAAAAATGG + Intronic
933924439 2:87078050-87078072 CTGCCAAGAGGGAAGAAAAATGG - Intergenic
934331765 2:92074898-92074920 CCGCTGAGGTGAAGGCAAAAAGG - Intergenic
935170323 2:100606511-100606533 CTGCAGAGGTGGAGGAATCACGG + Intergenic
936155976 2:110047774-110047796 GGGCTGAGATGGAGAAAGAAGGG + Intergenic
936188712 2:110323654-110323676 GGGCTGAGATGGAGAAAGAAGGG - Intergenic
937160713 2:119759117-119759139 CAGCTGAAATGGAGGAAGAAGGG - Intergenic
938085907 2:128401996-128402018 CTGCTGAAAGGGAGGGAAATGGG + Intergenic
938718545 2:134043608-134043630 CTGCTGATACTGAGGCAAAAAGG + Intergenic
939692013 2:145275195-145275217 TTGCTGAGATGAAGGTAAACTGG - Intergenic
939756167 2:146115130-146115152 CTGCTGGGATGGAAGTAAAGAGG + Intergenic
939801316 2:146713586-146713608 CTGGTGAGGTTGTGGAAAAAAGG + Intergenic
940374269 2:152939896-152939918 CTGGTGAGATTGCGGAGAAAAGG + Intergenic
940701709 2:157052830-157052852 TTGCTGTGTTGGAGGAAATATGG - Intergenic
940754640 2:157668227-157668249 CTGAGGATATGGAGTAAAAAAGG - Intergenic
941174829 2:162184006-162184028 CTTCTGTGATGGAGCTAAAAAGG - Intronic
941536454 2:166728135-166728157 ATGCTGAGATTGTGGAGAAAAGG + Intergenic
941607200 2:167613088-167613110 TTCCTGAGAGAGAGGAAAAAGGG + Intergenic
941770917 2:169344803-169344825 GTGCTGAGATGAAGGAGCAAAGG + Intronic
942319353 2:174723046-174723068 CTGCTTAGACTTAGGAAAAATGG - Intergenic
943810945 2:192188778-192188800 AGGCAGAGAGGGAGGAAAAAAGG - Intronic
944315505 2:198281230-198281252 CTGGGGAGAGGGAGGAAATAGGG - Intronic
944342004 2:198612201-198612223 CTGCTGGGATGAAGGACTAAGGG - Intergenic
944400370 2:199319407-199319429 CTGCTGGGATAAAAGAAAAAGGG - Intronic
944874574 2:203949171-203949193 AAGCTGAGATGGAGGAGAAGTGG + Intronic
944876974 2:203972200-203972222 GTGCTGGGGTGGAGGAAAACAGG + Intergenic
945399163 2:209358215-209358237 ATACTGAGATGGGGGAAAGATGG - Intergenic
945502602 2:210595432-210595454 CTGCTAAAATGGGGGAAATAAGG - Intronic
945515947 2:210763292-210763314 ATGCTTAGATGCAGGAACAAAGG - Intergenic
945593343 2:211762092-211762114 GTGTTGCGATGGAAGAAAAAGGG - Intronic
946491857 2:220156341-220156363 TTGTTGGGTTGGAGGAAAAAAGG - Intergenic
946707454 2:222472615-222472637 CTGCTAAGATGTAGGCATAAAGG - Intronic
946713137 2:222526434-222526456 CTCCTGAGATGGAGGGAAGGAGG + Intronic
947598772 2:231431546-231431568 CTGATGAGAAGGAGAAAAACTGG + Intergenic
947983502 2:234429269-234429291 CTGCTGACTTGGAGGAGAAAGGG - Intergenic
948278348 2:236727354-236727376 ATGGTGAGATGGAGCAGAAACGG + Intergenic
948534329 2:238634904-238634926 CTGCCGCGATGGAGGAGGAATGG - Intergenic
948769310 2:240240240-240240262 CTGCTGAGGTAGGGGAAAGAGGG + Intergenic
948933311 2:241146467-241146489 CGGGAGAGAGGGAGGAAAAAAGG + Intronic
949048932 2:241886736-241886758 CTGCAGAGAATGAGGAAAAATGG + Intergenic
1168753075 20:297568-297590 ATGCTGGGAAGGAGGTAAAATGG + Exonic
1168871870 20:1135874-1135896 CTGCTCAGAGGGAGGAGACAAGG + Intronic
1168895333 20:1319988-1320010 GTGCTGGGATGGAGGAGGAAGGG + Intronic
1169619797 20:7492476-7492498 GTGATGAGATGCAGGCAAAATGG + Intergenic
1169740299 20:8886240-8886262 CTGATGAGAATGAGGAGAAAAGG - Intronic
1170531270 20:17294833-17294855 CAGAGGAGATGGAGGAAAACAGG - Intronic
1171895144 20:30751752-30751774 GTGCTGAGTTTGTGGAAAAAAGG + Intergenic
1173046876 20:39521184-39521206 CTCCAGAGATGCTGGAAAAAGGG + Intergenic
1173242775 20:41312581-41312603 GTGCTGAGATAGAGGACAATGGG + Intronic
1174291180 20:49509840-49509862 CTGCAGGGATTGAGGGAAAAGGG - Intronic
1176317108 21:5256826-5256848 CTGCTGATATGCAGGCAAACAGG - Intergenic
1176454884 21:6899323-6899345 CTGCTGAGACGGGGGAAATCAGG + Intergenic
1176833057 21:13764371-13764393 CTGCTGAGACGGGGGAAATCAGG + Intergenic
1176921890 21:14697665-14697687 ATCCTGACATGGAGGAAATAGGG - Intergenic
1177127900 21:17218556-17218578 CTGCATAAATGAAGGAAAAATGG + Intergenic
1178090307 21:29155753-29155775 AGGCGGAGATGGAGGAAAAGTGG + Intronic
1178671492 21:34595294-34595316 GTGCTGAGATGCTGGAAAAGAGG + Intronic
1178850714 21:36209959-36209981 CTGATGACAAGGTGGAAAAATGG + Intronic
1179286910 21:39985347-39985369 ATGCAGGGATGGAGGAAGAAGGG - Intergenic
1179460297 21:41530069-41530091 CTGCTGAGCTGTAGGACCAAAGG - Intronic
1181446782 22:22982779-22982801 GTGCTGAGATTGAGGAACACTGG - Intergenic
1181978909 22:26752378-26752400 CTGCTGAGATGCAGGAAGGTGGG + Intergenic
1182004445 22:26948071-26948093 CTGCTGCAATGGAAGAAAATGGG - Intergenic
1182147843 22:28007884-28007906 CTGATTAGGAGGAGGAAAAATGG - Intronic
1182407858 22:30153069-30153091 GTGCTGAGATGGGGGGAAACTGG - Intronic
1183635284 22:39058383-39058405 CTGATGAGAAGGAGAAAAACCGG + Intronic
1185036223 22:48478563-48478585 ATGCTGAGAAGCAGAAAAAAAGG + Intergenic
1185258599 22:49849555-49849577 CTGCGGAGAGGGAGGAAGGAAGG + Intergenic
949242380 3:1888393-1888415 CTGGTGAGAATGTGGAAAAAAGG + Intergenic
951338049 3:21448411-21448433 CTGCAAAGAAGGAAGAAAAATGG + Intronic
951612854 3:24511184-24511206 CTGCTGAGAAGGTGGACAATGGG - Intergenic
951660855 3:25064249-25064271 CAACTGAAATGGAGAAAAAATGG - Intergenic
951983349 3:28589857-28589879 CTGCTGAAATGGAGGAGAGAAGG - Intergenic
952220749 3:31321736-31321758 ATGTTGAGAAAGAGGAAAAAAGG - Intergenic
952297249 3:32072380-32072402 CTGATGAGAAGGAGAAAAACTGG - Intronic
952544223 3:34401187-34401209 CTGGTGAGATTGTGGAGAAAAGG + Intergenic
952916882 3:38253129-38253151 CTTCTCAGATGGAGGAAGACAGG - Exonic
953146551 3:40281371-40281393 CTGCTGTTTTGGAGGAACAAAGG - Intergenic
953152013 3:40333375-40333397 CTACTGCCAGGGAGGAAAAAAGG + Intergenic
953184192 3:40622947-40622969 CTGGTGAGGTGGTGGAGAAAAGG - Intergenic
953656183 3:44856593-44856615 CTGATGAGACGGAGAAAAACTGG + Intronic
953834120 3:46328400-46328422 CTGATGAGAAGGAGAAAAACTGG + Intergenic
955623588 3:60892583-60892605 CTCCTGAGAAGGTGGGAAAAAGG + Intronic
955974359 3:64466201-64466223 CAGCTGACATGAAGGAAATATGG + Intergenic
956233205 3:67040066-67040088 CTGATGAGAAGGAGAAAAACTGG + Intergenic
956554471 3:70503302-70503324 CTGATGAGGTTGAGGAGAAAAGG + Intergenic
956557985 3:70542629-70542651 CTCCTGACATGGGGGAAAACAGG + Intergenic
956985886 3:74700082-74700104 TTGCTTTGAAGGAGGAAAAATGG - Intergenic
957451762 3:80389291-80389313 CTGATGAGAAGGAGAAAAATTGG - Intergenic
957533804 3:81475147-81475169 TTCCTGAGAGGGAGGTAAAAGGG - Intergenic
957655550 3:83069546-83069568 CTGGTGAGATTGTGGAGAAAAGG - Intergenic
957887891 3:86314182-86314204 GGGCTGAGCTGCAGGAAAAATGG - Intergenic
958589486 3:96136293-96136315 CTGGTGAGATTGTGGAGAAAAGG - Intergenic
958675200 3:97260781-97260803 CAGCTGAGATCAATGAAAAACGG - Intronic
958743914 3:98110178-98110200 CTGCTGACAGGGTGGAAAAAGGG - Intergenic
958956039 3:100466784-100466806 CTGCTGACAGGGTGGAGAAAAGG - Intergenic
958985705 3:100777283-100777305 CTGGAGAGAGGGAGGAAAGATGG + Intronic
959251573 3:103954535-103954557 CTGCTGAGGTTGAGGAAACCTGG + Intergenic
960183116 3:114606525-114606547 CTGCTAAAATGGAAGAGAAAAGG + Intronic
960431408 3:117573211-117573233 GGGCTGAGATGGAAGAAAAAAGG + Intergenic
962073940 3:132060691-132060713 CTGCTGAGGTTGTGGAAAAAAGG - Intronic
962241719 3:133755831-133755853 CTGCTGAGATTGAGGGAAGAGGG - Intronic
962418132 3:135202311-135202333 CTACTGAGATGGAGGGACTAGGG - Intronic
963015958 3:140824013-140824035 CTGAGTAGATGGAGGAGAAAGGG - Intergenic
966019189 3:175186780-175186802 CTACTGAGATGGAAGAGAGATGG - Intronic
966354706 3:179067711-179067733 CTGCTTAGGTGGAGGAAGCACGG + Exonic
966640881 3:182188165-182188187 CTGATGAGATGGAAAACAAATGG - Intergenic
966769623 3:183492229-183492251 CTGAGGAGAGGGAGGAAACACGG + Intronic
967957022 3:194885158-194885180 CCGCTGTGATGGAGGAAGAGTGG + Intergenic
968126958 3:196167113-196167135 CTGCTGAGATGTAGGCATAAAGG - Intergenic
968787891 4:2637621-2637643 CTGCTGAGCTAGAGGCAGAAAGG - Intronic
968969575 4:3786608-3786630 CTGCAGGGATGGTGCAAAAAAGG - Intergenic
969061124 4:4436041-4436063 TTACTGAGATTGAGGAAAAAAGG - Intronic
969348069 4:6581613-6581635 AAGGTGAGATGGAGGATAAAGGG - Intronic
969646982 4:8436481-8436503 CTGTTAAGATCTAGGAAAAAGGG + Intronic
969887756 4:10231335-10231357 CTTCTGAGATGCAAGAGAAATGG + Intergenic
970359473 4:15294048-15294070 TTGCTCAGATGGGGGCAAAAGGG + Intergenic
971868847 4:32209253-32209275 CTGCTGAGATTGTGGAGAAAAGG - Intergenic
971871326 4:32243087-32243109 CTGCTGAAATGTAATAAAAAGGG + Intergenic
972651828 4:41025363-41025385 CTGGTGAGATTGCGGAGAAAAGG + Intronic
973553458 4:52058318-52058340 TGGATGAGATGGAGAAAAAATGG + Intronic
973785937 4:54332792-54332814 CTGCAGAGGGGGTGGAAAAAGGG - Intergenic
974173109 4:58292610-58292632 CTGATGAGAAGGAGAAAAATTGG + Intergenic
975829964 4:78358889-78358911 CTGATGATATTGAGTAAAAAAGG + Intronic
975853166 4:78594483-78594505 CTGCTGATATGAAAGCAAAATGG - Intronic
975971169 4:80039641-80039663 CTGGTGAGGTTGTGGAAAAAAGG + Intronic
976397692 4:84573957-84573979 CTGCTGATGTGGAGGAAGAGTGG - Intergenic
976739584 4:88344667-88344689 CTGATGAGAAGGAGAAAAACTGG + Intergenic
977094485 4:92722431-92722453 CTCCTGAGAATGAGGAAAAGGGG + Intronic
977367596 4:96090675-96090697 CTGCTGAGGTTGTGGAGAAAGGG + Intergenic
977529868 4:98188361-98188383 CTGCAAAGATGAAGGTAAAATGG - Intergenic
978735528 4:112080029-112080051 CTGCTGAGAAGGAGGAGATTAGG - Intergenic
978826529 4:113030920-113030942 ATATTGAGATGGAAGAAAAATGG + Intronic
979303459 4:119114680-119114702 CTGGGGAAATGGAGGAAAAGGGG - Intergenic
979856426 4:125638921-125638943 CTGCTGAGCTGCAGGCAACAAGG + Intergenic
981630697 4:146815245-146815267 TTGCAGAGATAGAGGGAAAAGGG + Intronic
982524140 4:156456365-156456387 CTGGTGAGGTTGAGGAAAAAAGG + Intergenic
983854796 4:172630688-172630710 ATGTTGAGTTGGAGGAATAAAGG - Intronic
984897795 4:184557278-184557300 CTGGTGAGGCGGAGGAGAAAGGG + Intergenic
985124799 4:186682777-186682799 CTGATGACATGGAGAAAAGAAGG - Intronic
985800684 5:2003862-2003884 CAGCTGAGGCGGAGGAAAGAGGG + Intergenic
986040003 5:3984181-3984203 CTCTTGAGGTGGAGGAAAATTGG + Intergenic
986238735 5:5937710-5937732 CTGCTGAGGTGGAGAATAGAGGG + Intergenic
986296668 5:6445076-6445098 CTTCTGAGATGGAAGAAGGAGGG + Intergenic
986532325 5:8751389-8751411 CTGATGAGATTGTGGATAAAAGG + Intergenic
986884565 5:12217180-12217202 AAGCTGTGAGGGAGGAAAAAAGG + Intergenic
987093260 5:14525901-14525923 CTGCTGAGGTGGAAGAATCATGG + Intronic
987100671 5:14588783-14588805 CAGCTAATAGGGAGGAAAAAGGG + Intronic
987354471 5:17050734-17050756 CTGCTGAGATTGTGGAGACAAGG + Intergenic
987450123 5:18072782-18072804 CTGCTGAGAGGAATGAAAACTGG + Intergenic
987874652 5:23665583-23665605 TTGCTGAAATGGAAAAAAAACGG + Intergenic
988598676 5:32619404-32619426 CTGCTGACATGGATGTAAAATGG - Intergenic
988651434 5:33156183-33156205 CTGGTGAGGTTGAGGAATAAAGG - Intergenic
988658333 5:33237103-33237125 CTGGCAAAATGGAGGAAAAATGG + Intergenic
988771938 5:34440966-34440988 CTGCTCAGGTGGAGGACAAAGGG + Intergenic
988877723 5:35466625-35466647 ATGCTGAGATAGAGGAAAAATGG - Intergenic
989358579 5:40573203-40573225 CTGCTGATGTGGAGGAGAGAAGG - Intergenic
990377408 5:55185687-55185709 TTACTGAGAAGGAGGAAAACTGG - Intergenic
990875298 5:60477521-60477543 CTGTTAAGATGGAGGAAAAAAGG + Intronic
990889026 5:60628903-60628925 CTGCTGAAATGGTGGGAGAAAGG + Intronic
990907695 5:60821423-60821445 TTGCTGAGTTGGAGGATAGAGGG - Intronic
991155110 5:63424993-63425015 ATGCTGATAAGGAGGAAAAGAGG - Intergenic
991362605 5:65836551-65836573 CTGTTAGGAAGGAGGAAAAAGGG - Intronic
991453159 5:66774173-66774195 GTGCTCAGATCAAGGAAAAAGGG + Intronic
991974284 5:72171131-72171153 CTGCTCAGAATAAGGAAAAAGGG + Intronic
993631281 5:90288503-90288525 CTGCTGAGACTGTGGAGAAAAGG - Intergenic
993726918 5:91380063-91380085 CTGCTGAGCTGGCACAAAAAGGG - Intronic
993923563 5:93837644-93837666 CTGGTGAGATTGGGGAGAAAAGG - Intronic
994474321 5:100248379-100248401 CTGCTGAGAGGGTTGACAAAGGG - Intergenic
994696772 5:103081238-103081260 CTGCAGATATGGAGAAACAATGG + Intergenic
994717173 5:103335660-103335682 CCACTGAGATGGGGGAAAGAAGG + Intergenic
995134741 5:108668954-108668976 CTGGGGAGATGGAGAAAATATGG - Intergenic
995355982 5:111238200-111238222 CTGGAGAGATGAAGGAAACAGGG - Intronic
995448774 5:112277216-112277238 CTGCTGAGATGGTGCACAAAGGG + Intronic
995639561 5:114238852-114238874 GTGCTGAGATGAAGGAGAACAGG + Intergenic
995963141 5:117869931-117869953 TTGCTGATAAGGATGAAAAATGG + Intergenic
996026558 5:118652912-118652934 CTTTTGTGATGGGGGAAAAATGG + Intergenic
996028750 5:118681802-118681824 CTGCAGAAAAGGAGGACAAATGG + Intergenic
996329990 5:122317842-122317864 CTGATTAGGTGGAGGAAGAAAGG - Intronic
996625017 5:125560376-125560398 TTGCTGAAATGGAGGAGGAAGGG + Intergenic
997022278 5:130015594-130015616 CTGGTGAGATTGTGGAGAAAGGG + Intronic
997612346 5:135224015-135224037 TTGCTGAGATGGAGGAGAAGAGG + Intronic
997768330 5:136527282-136527304 CTATTGAAAAGGAGGAAAAAGGG - Intergenic
998052533 5:139047827-139047849 ATGCTGAGAAGGAAGAAGAAAGG + Intronic
998487127 5:142512579-142512601 CTGCTGAGAAAGAGAGAAAATGG + Intergenic
999498594 5:152124729-152124751 CTGCTGAGATGGGAGAAGGAGGG - Intergenic
1000475576 5:161702683-161702705 CTGGTGAGAGGTAGGAGAAATGG + Intergenic
1001276565 5:170355548-170355570 GTGCTGAGATGGGGGAATCATGG + Intronic
1001307162 5:170583724-170583746 CTGCTGAGCTGATGGAAAAAGGG + Intronic
1001353932 5:171002300-171002322 CTGATGAGAAGGAGGAAAACTGG + Intronic
1001822700 5:174722243-174722265 CTGCTGAGGTGGAGACAAATCGG - Intergenic
1001988869 5:176099437-176099459 CAGCTGTGGTGGAGGATAAATGG - Intronic
1002227996 5:177738699-177738721 CAGCTGTGGTGGAGGATAAATGG + Intronic
1002347163 5:178556032-178556054 GTGCTGTGATGGAGGGAAGAAGG - Intronic
1002649904 5:180683761-180683783 CAGCTGAGGTGGAGGATGAATGG - Intergenic
1002777078 6:337482-337504 CTGCTGACATGGAGGGACAGGGG + Intronic
1003291194 6:4779658-4779680 CTGCTAGGATTGAGGAAAAACGG + Intronic
1003427518 6:6007487-6007509 CTGCTGGGTTGGAGAAAAAGAGG - Intronic
1004061430 6:12201921-12201943 TTGCTGAGTTGGAGGATAAAAGG + Intergenic
1004612529 6:17257175-17257197 CTGCTAAAATGTAGGAAGAAAGG - Intergenic
1005528174 6:26673198-26673220 CTGCAAAGAAGGAGGAAAAAAGG - Intergenic
1005529341 6:26687096-26687118 CTGCAAAGAAGGAGGAGAAAAGG - Intergenic
1005530936 6:26705213-26705235 CTGCAAAGAAGGAGGAGAAAGGG - Intergenic
1005539860 6:26796423-26796445 CTGCAAAGAAGGAGGAGAAAGGG + Intergenic
1005541455 6:26814550-26814572 CTGCAAAGAAGGAGGAGAAAAGG + Intergenic
1005542621 6:26828441-26828463 CTGCAAAGAAGGAGGAAAAAAGG + Intergenic
1005777563 6:29152543-29152565 CTGGTGAGGTGGTGGAGAAAAGG - Intergenic
1005852129 6:29829681-29829703 ATGCTGAGATGGAGTAAGGAGGG + Exonic
1006012980 6:31057752-31057774 CTGCCGACAGGGAGGGAAAAGGG + Intergenic
1006239856 6:32668230-32668252 CTGCTGTGATGGACGCATAAAGG + Intronic
1006263525 6:32896144-32896166 CTGCTGGGATGCATGAAACATGG - Intergenic
1006525823 6:34604004-34604026 CTGCTTAGATTAAGAAAAAAAGG + Intronic
1006847687 6:37074205-37074227 CTGCTGAAATGGAGGAGGGATGG + Intergenic
1007024897 6:38561217-38561239 CTGGTGAGATTGTGGAGAAAAGG - Intronic
1007935925 6:45731863-45731885 ATGCAGAGATGAAGGATAAATGG + Intergenic
1007977291 6:46114450-46114472 ATGCTGATAAGGAGGAAAGAGGG - Intergenic
1008189134 6:48432860-48432882 CTGTTTAGAAAGAGGAAAAATGG - Intergenic
1008660431 6:53662207-53662229 CTGCTGTCATTTAGGAAAAATGG - Intronic
1009010677 6:57838564-57838586 CTGCAAAGAAGGAGGAGAAAGGG + Intergenic
1009012261 6:57856612-57856634 CTGCAAAGAAGGAGGAGAAAAGG + Intergenic
1009013436 6:57870558-57870580 CTGCAAAGAAGGAGGAAAAAAGG + Intergenic
1009036083 6:58118324-58118346 TTGCTGAGAGGGAGGAAGAGCGG - Intergenic
1009247303 6:61254810-61254832 CTATAGAGATGAAGGAAAAAGGG - Intergenic
1009305113 6:62079748-62079770 CTGCTAAGAGGGAGGATGAAAGG + Intronic
1009546810 6:65030648-65030670 CTGCTGTGTTGGAGGAATCAAGG - Intronic
1010097996 6:72069160-72069182 CTACTGAGTTGGGGGAGAAATGG + Intronic
1010652858 6:78475678-78475700 ATGCAGAGATGGAGAAAAATAGG + Intergenic
1010867407 6:80996069-80996091 CTGGTGAGATGTAGAGAAAAGGG - Intergenic
1011466363 6:87661457-87661479 CTCTTGAGATGGGGGAGAAAAGG + Intronic
1011524159 6:88245184-88245206 CTGCTGATATGCCTGAAAAATGG + Intergenic
1011723311 6:90182010-90182032 CTCCTGAGATTGACGAATAATGG - Intronic
1012134171 6:95535332-95535354 CTGCTGGGGTGGAGGAGAAAAGG - Intergenic
1012656586 6:101830724-101830746 CTGGTGAGGTGGGGGAAAAAAGG + Intronic
1012892791 6:104915983-104916005 CTGCTGAGGATGAGGAGAAAAGG + Intergenic
1013478451 6:110531030-110531052 CTGCTAAGATGTAGGCATAAAGG - Intergenic
1013794084 6:113865659-113865681 GGATTGAGATGGAGGAAAAAGGG - Intergenic
1013807731 6:114013400-114013422 CTGATGAGAAGGAGAAAAACTGG + Intergenic
1014756117 6:125303177-125303199 CTGCTGAGATACAGGAAATAAGG - Intergenic
1015225852 6:130856035-130856057 CAGATGAGATGGGGGAAAGAAGG + Intronic
1015873466 6:137799948-137799970 CAGCTGAGATGTAGAGAAAAGGG - Intergenic
1017270163 6:152494902-152494924 CTGATGAGAAGGAGAAAAACTGG - Intronic
1017897384 6:158692473-158692495 CTGCTGGGAGGGAGGGATAAAGG - Intronic
1017953972 6:159162711-159162733 CAGAGGAGATGGAGGAACAAAGG + Intergenic
1018217059 6:161538639-161538661 AAGCGGAGAAGGAGGAAAAATGG + Intronic
1018395417 6:163374612-163374634 CTGCTGGGAAGGAGGAACACAGG - Intergenic
1019280290 7:196315-196337 CTGCTGAATTGGACAAAAAAGGG + Intronic
1020032780 7:4944500-4944522 GTGCTGAGAGGGTTGAAAAACGG - Intronic
1020034050 7:4953135-4953157 CTGTAGGGATGGAGGAAACAGGG - Intronic
1020417359 7:7961199-7961221 TTGCTGAAATGGGGAAAAAATGG + Intronic
1020577493 7:9952098-9952120 GTGGTGAGGTGGTGGAAAAATGG - Intergenic
1020847674 7:13307484-13307506 CTTCTGAAATAAAGGAAAAAAGG + Intergenic
1021089880 7:16471176-16471198 TTGGTGAGATGGAGCAAAGATGG + Intronic
1021189502 7:17603290-17603312 CTGCTCAGCTGCAGGAGAAAGGG - Intergenic
1021629338 7:22629116-22629138 CTTCTAAGAAGGAGGTAAAAGGG + Intronic
1022043768 7:26606501-26606523 CTGCTGAGGGGAATGAAAAATGG + Intergenic
1022519662 7:30998083-30998105 CTGCTGAGAAGGGGGCAAGAAGG - Intergenic
1022749537 7:33209576-33209598 CTGCTGAGAAAGTGGAGAAAAGG - Intronic
1023513419 7:40977210-40977232 CTGCTGGGAGGGAGAGAAAAGGG + Intergenic
1024738905 7:52334772-52334794 CTGATGAGAAGGAGAAAAACTGG + Intergenic
1026159137 7:67853265-67853287 CTGCTTAGATGGAGGAGGTATGG + Intergenic
1027209684 7:76135537-76135559 CTCCTGGGTTGGAGGCAAAAGGG - Intergenic
1027767366 7:82362548-82362570 CTGCAGTAATGGAGGAAAAAAGG + Intronic
1027881559 7:83845230-83845252 TTGCTTAGATGAAGGAAGAAAGG - Intergenic
1027969914 7:85066311-85066333 ATGGTGAGAAGGAGGAAGAAGGG + Intronic
1028216268 7:88137569-88137591 CTGGTTAGATAGAGAAAAAAGGG - Intronic
1028646128 7:93098679-93098701 CTGCTGGCATTGAGGAAATAAGG + Intergenic
1029203652 7:98855508-98855530 CTGCTCAGAGGGAGGAAAGTAGG + Intronic
1029317538 7:99728067-99728089 CTGATGAGAAGGAGAAAAACTGG - Intronic
1029736730 7:102469392-102469414 CAGGTTAGATGGAGGAAACAGGG + Intronic
1029902869 7:104060494-104060516 ATGTTGAAATGAAGGAAAAAAGG + Intergenic
1030015518 7:105216377-105216399 CTGGTGAGATGAAGGAAAGGAGG + Intronic
1030408898 7:109149243-109149265 CTGGTGAGAATGAGGAAAAAGGG - Intergenic
1030445550 7:109643915-109643937 CTGATGAGAAGGAGAAAAACTGG + Intergenic
1030455850 7:109772912-109772934 CTGCTCCGATGGAGGTAGAAGGG - Intergenic
1030699742 7:112624938-112624960 CTGGTGATAGGGAGGAAAATTGG + Intergenic
1030727822 7:112946864-112946886 ATGGGGAGATGGAGGTAAAAGGG - Intergenic
1031048046 7:116915432-116915454 CTCCTAAGATAGAGTAAAAATGG - Intronic
1031125462 7:117768685-117768707 TTGTTGAGATGGAGTACAAAAGG - Intronic
1032510130 7:132465819-132465841 CTGCAGAGCTGGAGGAGAGAGGG + Intronic
1033024657 7:137760627-137760649 CTCCAGAAATGGAGGAGAAAGGG + Intronic
1034380097 7:150684456-150684478 CTGTTGAGATGAAGATAAAATGG - Intergenic
1034514411 7:151563356-151563378 CTGCTGAGGTGCAGGAAACTGGG + Intronic
1034748464 7:153545159-153545181 CTGGTGACATGAAGGAACAAAGG + Intergenic
1036957320 8:13202501-13202523 CTGCAGAGATGGTAGAAAGACGG - Intronic
1036993352 8:13626070-13626092 CAGCTGACATGGGGGAAGAAAGG - Intergenic
1037277064 8:17191939-17191961 CTGGTGAGATGGTGGAGAAAAGG - Intronic
1037406498 8:18548004-18548026 CTAATCAGATGGGGGAAAAAAGG - Intronic
1037617579 8:20533511-20533533 CTGCTGTGATGGGGGAAGAAGGG - Intergenic
1037755199 8:21705875-21705897 CTGCTGAGATGGGGGCAGCAAGG + Intronic
1038395129 8:27241015-27241037 ATGCTGAGAGGGAGGAAAGAAGG + Intronic
1039410669 8:37352600-37352622 CTGTCAAGAAGGAGGAAAAATGG + Intergenic
1039742086 8:40392231-40392253 CTTCTGAGTTGGAGGACAGAAGG - Intergenic
1040871438 8:52103737-52103759 ATGCTGTGTTGGAGGAAATAGGG - Intergenic
1041392799 8:57361749-57361771 CTGCCAATATGAAGGAAAAAAGG - Intergenic
1041442895 8:57917435-57917457 CTGTTGAGAAGGAGGTAAAGTGG - Intergenic
1041561422 8:59223725-59223747 CTTCAGAAAGGGAGGAAAAAGGG - Intergenic
1041651498 8:60307568-60307590 CTGATGAGAAGGAGAAAAATTGG + Intergenic
1041913380 8:63113844-63113866 CTTCAGAGATGAAGGAAAGAAGG + Intergenic
1042163754 8:65924562-65924584 CAGCTGTGATGGAGGCACAAGGG - Intergenic
1043189128 8:77194928-77194950 CTGGTGAGGTTGTGGAAAAAAGG + Intergenic
1043597141 8:81899848-81899870 CTGATGAGAAGGAGAAAAACTGG + Intergenic
1044727665 8:95206632-95206654 CTGTTGGGAAGGAGGAAAGAGGG - Intergenic
1044896608 8:96899131-96899153 GTGCTGAGATGGAAAAAGAAAGG + Intronic
1044911381 8:97063115-97063137 CTGGTGAGGTTGAGGAGAAAAGG - Intronic
1045716655 8:105054912-105054934 GAGCTGAGAGGGAGTAAAAAAGG + Intronic
1046145013 8:110147194-110147216 CTGATGACATGAAGGGAAAAAGG + Intergenic
1046408992 8:113814225-113814247 CTGGTGACATGGTGGAGAAAAGG - Intergenic
1046736425 8:117780959-117780981 CTGGTGAGGTTGTGGAAAAAAGG + Intergenic
1047058612 8:121196551-121196573 CTGCTGAGTTGGAGGAGATGAGG + Intergenic
1047229483 8:122984229-122984251 TTGGTGAGATGGGGGAGAAAGGG - Intergenic
1048101336 8:131355357-131355379 CTGCTGAGGTTGTGGAGAAAAGG - Intergenic
1048461252 8:134623483-134623505 ATGCAGATTTGGAGGAAAAAGGG - Intronic
1049332166 8:142060335-142060357 CTGCGGTGGTGGAGGCAAAATGG + Intergenic
1049415522 8:142493174-142493196 CTGCTGCCCTGGAGGACAAAGGG - Intronic
1049543452 8:143218823-143218845 CTGCTGGGCTGGATGAGAAAGGG - Intergenic
1050553279 9:6766905-6766927 ATGCAAAGATGGAGGTAAAAAGG - Intronic
1051186264 9:14464504-14464526 CTGAAGTGTTGGAGGAAAAAGGG + Intergenic
1051681324 9:19610936-19610958 CTGCTCTGTTGGAGGAATAAGGG + Intronic
1052063091 9:23985105-23985127 CTGGTGAGAATGTGGAAAAAAGG - Intergenic
1053416918 9:37952630-37952652 CCGCAGAGATGGAGGAATAATGG + Intronic
1053796504 9:41731655-41731677 CTGAAGAGGTGGAGGTAAAAGGG + Intergenic
1054148675 9:61583165-61583187 CTGAAGAGGTGGAGGTAAAAGGG - Intergenic
1054184910 9:61943714-61943736 CTGAAGAGGTGGAGGTAAAAGGG + Intergenic
1054353507 9:64041015-64041037 GTGCTGAGTTTGTGGAAAAAAGG - Intergenic
1054468436 9:65514322-65514344 CTGAAGAGGTGGAGGTAAAAGGG - Intergenic
1054653597 9:67644785-67644807 CTGAAGAGGTGGAGGTAAAAGGG - Intergenic
1055225747 9:73992539-73992561 CTGATGAGGTTGTGGAAAAAAGG + Intergenic
1056286246 9:85090661-85090683 CAGCTGTGAGGGAGGAAGAATGG + Intergenic
1056501770 9:87216602-87216624 CTGCTGAACTGTAGAAAAAATGG + Intergenic
1057455781 9:95208781-95208803 CTGCTGATGGGGATGAAAAATGG + Intronic
1057538526 9:95941724-95941746 ATTCTGAGATGGATGAAAAATGG - Intronic
1057970100 9:99546711-99546733 CTGCTGAGAATGTGGAGAAAAGG - Intergenic
1058088211 9:100774036-100774058 ATTCTGAGATGAAGGAGAAAGGG - Intergenic
1058252854 9:102723382-102723404 CTGCTGAGAATGTGGAGAAAGGG + Intergenic
1059029948 9:110681681-110681703 CTGCTGAGAGTGAAAAAAAATGG - Intronic
1059416817 9:114167669-114167691 CATCTGAGAGGGAGGGAAAAGGG - Exonic
1059450913 9:114370994-114371016 CAGCTGAGATGGAGGAACAGGGG + Intronic
1059562661 9:115350397-115350419 CTTCTGGGTGGGAGGAAAAAGGG + Intronic
1059866025 9:118514661-118514683 CTGATAAGATGGAGGGAATAGGG + Intergenic
1060771384 9:126334649-126334671 CTGTAGAGAAGGAGAAAAAAAGG - Intronic
1060944490 9:127561916-127561938 CTTCTGTGCTGGAGGAAGAAGGG - Intronic
1061093002 9:128437185-128437207 GTGCTGAGGTGGAGGTAGAAGGG - Exonic
1061927791 9:133814599-133814621 CTGATGACATGGATCAAAAACGG + Intronic
1061935450 9:133855041-133855063 CAGCCCAGATGGAAGAAAAAGGG + Intronic
1203415372 Un_KI270582v1:1874-1896 CTGCTGATATGCAGGCAAACAGG - Intergenic
1186371959 X:8955877-8955899 CTCATGAGATGGAGGAAAGAGGG - Intergenic
1186503219 X:10068703-10068725 CTGCAGAGATGGAGATAAGATGG - Intronic
1188450266 X:30301407-30301429 CAGCTGGGATGGAAGAGAAAGGG - Intergenic
1188489464 X:30722527-30722549 CTGGTGAGAGGGAGGACAATAGG - Intronic
1188775635 X:34215280-34215302 CTGGTGAGGTGGTGGAGAAAAGG + Intergenic
1188859216 X:35237266-35237288 TTGGTGAGATTGTGGAAAAAAGG + Intergenic
1189377833 X:40479640-40479662 CTGCAGAGAGGGAGGAAAGGAGG - Intergenic
1189431089 X:40948066-40948088 CTGTTGAGAATGAGGAACAACGG + Intergenic
1189958644 X:46304064-46304086 CTGCTGTGATGGAAGTAAAATGG + Intergenic
1190108920 X:47577494-47577516 CTGCTGAGCTGGTGGGGAAAAGG + Exonic
1190915201 X:54806916-54806938 CAGTTGTGATGAAGGAAAAATGG + Intergenic
1192494037 X:71602091-71602113 CTGGTGAGAATGAGGAGAAAAGG - Intronic
1192901401 X:75501590-75501612 CTGGTGAGATTGTGGAGAAAAGG - Intronic
1192931358 X:75810072-75810094 CTGCTGATACGCAGGAAAACAGG - Intergenic
1193165692 X:78277550-78277572 CTGCTGTGCTGGAGGAACCAAGG - Intronic
1193259194 X:79385576-79385598 CTGGTGAGATTGTAGAAAAAAGG + Intergenic
1193475561 X:81960616-81960638 CACCTGAGAGGCAGGAAAAATGG - Intergenic
1193566793 X:83086569-83086591 CTGGTGAGGTTGAGGAGAAAAGG - Intergenic
1194395870 X:93385452-93385474 CTGCTGAGAATGTGGAGAAAAGG - Intergenic
1194965277 X:100281267-100281289 CTGTTGAGAAGGTGGAGAAAAGG - Intergenic
1195469809 X:105219254-105219276 TGTCTGAGAAGGAGGAAAAAGGG + Exonic
1196075278 X:111569113-111569135 CTGCTGAGTAAGAGGAATAAAGG - Intergenic
1196199007 X:112864360-112864382 CTGCTGAGGTGGGGGACAAGGGG + Intergenic
1196664231 X:118299418-118299440 GTACTGAGATGGAGTAAGAATGG + Intergenic
1196750824 X:119115907-119115929 CTCCTGAAATGGAGGGAGAAAGG + Intronic
1197479625 X:126966275-126966297 CTGCTGACCTGGTGGAGAAAAGG - Intergenic
1197869339 X:131050650-131050672 CTCCTGGGATGGAGGAATACAGG + Intergenic
1198682064 X:139193576-139193598 CTGCTGGGAGGGCGGAAGAAAGG + Intronic
1198719454 X:139600158-139600180 CTGCTTAGATTGGGGAAAAAAGG + Intronic
1199078389 X:143549593-143549615 CTGCTGAGATGGAGGGAAAAAGG + Intergenic
1199634183 X:149800018-149800040 CAGATGAGAGGGAGGAAAAATGG - Intergenic
1200689614 Y:6294032-6294054 CTGCTGACACGCAGGAAAACAGG - Intergenic
1201045658 Y:9880688-9880710 CTGCTGACACGCAGGAAAACAGG + Intergenic
1201483284 Y:14464103-14464125 CTTCAGAGATGGATGCAAAAGGG + Intergenic