ID: 929532443

View in Genome Browser
Species Human (GRCh38)
Location 2:42761564-42761586
Sequence GAGCTGCCCTGAGCCCAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 393
Summary {0: 1, 1: 0, 2: 2, 3: 54, 4: 336}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929532436_929532443 10 Left 929532436 2:42761531-42761553 CCAGGGAAGAGGAGATTGAGGAA 0: 1
1: 0
2: 5
3: 49
4: 593
Right 929532443 2:42761564-42761586 GAGCTGCCCTGAGCCCAGGTGGG 0: 1
1: 0
2: 2
3: 54
4: 336

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929532443 Original CRISPR GAGCTGCCCTGAGCCCAGGT GGG Intergenic
900415029 1:2530887-2530909 GAGCTGCCCGGAGCCCAGCCAGG - Intergenic
900506106 1:3030451-3030473 AAGCTGCCGTGGGCCGAGGTCGG + Intergenic
900808254 1:4781926-4781948 CACCTGACCTGTGCCCAGGTGGG + Intronic
902725624 1:18334204-18334226 GAGCTTATCTGAGCTCAGGTTGG - Intronic
903025075 1:20422511-20422533 GATCTGCTCTGACCCCAGGAGGG - Intergenic
903376402 1:22869136-22869158 CAGCTGCTCAGAGCCCAGCTGGG + Intronic
904145889 1:28391006-28391028 GATCTCACCTGAGCCCAGGGAGG + Intronic
904772021 1:32886102-32886124 GTGCGGCTCAGAGCCCAGGTGGG + Intronic
905349844 1:37337884-37337906 GAGCAGCCCTTAGCCAAGTTGGG + Intergenic
905452423 1:38065200-38065222 GAGCTGAGCTGAGTCCAGGCTGG - Intergenic
905807982 1:40890664-40890686 GACCTGCCCAGAGGACAGGTGGG + Intergenic
906276891 1:44523392-44523414 GAGCTGGCCTGAACCCTAGTTGG + Intronic
906694711 1:47816230-47816252 GAGCAGCCCTGACCTGAGGTAGG + Intronic
906705685 1:47893513-47893535 TACCTGCCCTTAGCCCAGGCTGG + Intronic
907335023 1:53694146-53694168 GACCTGCCCTGACCCCAGATTGG - Intronic
907372092 1:54010277-54010299 CAGATGAACTGAGCCCAGGTAGG - Exonic
907397193 1:54199537-54199559 GCGCTGCGCTGAGCCCCGGTTGG - Intronic
907745881 1:57213064-57213086 GTGCTGCCCAGGGCCCAGCTGGG + Intronic
909349792 1:74637819-74637841 GAGGTCACCTGAGCCCAGGCAGG + Intronic
910232244 1:84998230-84998252 GAGTTGCCCTGCGCCCGCGTCGG + Intergenic
910812462 1:91252247-91252269 TTGCTGCCTTGAGCCTAGGTAGG - Intergenic
912546841 1:110457186-110457208 GATCAGCCCTGAGAGCAGGTTGG + Exonic
913195896 1:116455525-116455547 AAGCTTCCCTGAGCCCAACTGGG + Intergenic
914691992 1:150037956-150037978 GAGGTGCCCTGAGCCTGGGGAGG - Intergenic
916261169 1:162844052-162844074 GAGCCTCCCTTAGCTCAGGTAGG + Intronic
919921837 1:202170732-202170754 GAGCTGACCTGAACCTGGGTTGG + Intergenic
920765549 1:208829812-208829834 GAACTGCCCTGTCCCCAGCTTGG - Intergenic
921427477 1:215021423-215021445 GATCTGCCCTTACCCAAGGTGGG + Intronic
922486182 1:225974930-225974952 GAGCTGCTCTTAGACCAGGCAGG - Intergenic
922573430 1:226646844-226646866 GAGCTGCCCTTGGTTCAGGTGGG - Intronic
923506193 1:234608808-234608830 GGGCTGCGCGGAGCCCAGGCTGG + Exonic
1063141104 10:3257315-3257337 GAGCTCCCCTCAGCCCTGGGGGG - Intergenic
1063959729 10:11297345-11297367 GGGCTGCCCTAAGCCCGGGGAGG + Intronic
1064727638 10:18297652-18297674 GAGCAGCCCTGGGCTCAGGTTGG - Intronic
1065342209 10:24718085-24718107 CAGCTGACCTGAACTCAGGTGGG + Intronic
1067277808 10:44850378-44850400 GAGCTCCCCAGAGCCCAGCAAGG - Intergenic
1067806116 10:49394900-49394922 GAGCTGCCCAGAATCCAGGGCGG + Intronic
1069513332 10:69058057-69058079 GATCAGCCCTGAGTCCAGGCTGG - Intergenic
1069903165 10:71717384-71717406 GAGCTGCTCTGGGAACAGGTGGG + Intronic
1070648338 10:78217269-78217291 GCGCTGTCCTGAGCACAGTTTGG - Intergenic
1072861172 10:99006942-99006964 GAGCTGGCCTGGGGCTAGGTGGG + Intronic
1073544615 10:104337961-104337983 GAGCTGCCCGCAGCCCTGGCTGG + Intronic
1073566942 10:104543129-104543151 AAGCTGCCCAGGGGCCAGGTAGG + Intergenic
1075021629 10:118956557-118956579 GAGCAGCCCTCAACCCAGGATGG - Intergenic
1076451084 10:130557466-130557488 GAGCTCCCGTGAGCTCAGGATGG + Intergenic
1076635652 10:131880430-131880452 GAAATGCCCTGAGCCCAGGCAGG - Intergenic
1076756881 10:132577195-132577217 GTGGTGCCCTGAGTGCAGGTGGG + Intronic
1077057834 11:604159-604181 GGGGTGCCCTGAGCCTGGGTTGG + Intronic
1077504519 11:2923926-2923948 GCTGGGCCCTGAGCCCAGGTGGG + Intronic
1077877295 11:6319475-6319497 CAGCTGCTCTGGGCCCAGCTCGG + Exonic
1078093807 11:8284078-8284100 CAGCTGCCCTGTTCCCAGGATGG - Intergenic
1078697625 11:13650357-13650379 GTCTTGCCCTGAGCCCAGGCTGG + Intergenic
1079339633 11:19601395-19601417 GGGCTGCTCTGAGTCCAGGAGGG - Intronic
1080645669 11:34186031-34186053 GAAATGCTCTGAGCCCTGGTGGG + Intronic
1081302492 11:41469296-41469318 GAGATCACCTGAGCTCAGGTAGG + Intergenic
1083310627 11:61781800-61781822 GACTGGCCCTGGGCCCAGGTGGG - Exonic
1083651842 11:64208656-64208678 GGGCTGCCCCGAGCCCAGGATGG + Intronic
1083666001 11:64275112-64275134 GAGCTGCCCCCAGGTCAGGTGGG + Intronic
1084399087 11:68933284-68933306 GCGCAGCCCTGCGCCCAGGAGGG - Exonic
1084494619 11:69496831-69496853 GATCTGTCCTCAGCCCAGGTGGG - Intergenic
1084661343 11:70548351-70548373 GGACTGCCCTGATCCCAGGTGGG + Intronic
1084887707 11:72221802-72221824 GAGCTGAGCTGAGCCCAGCCTGG - Exonic
1085083896 11:73654245-73654267 GAGCCGCCCAAAGCCCAGCTTGG + Intronic
1085562864 11:77487836-77487858 GAGTTCCCCTGACTCCAGGTGGG - Intergenic
1086554347 11:88091269-88091291 TAGGTTCCCTCAGCCCAGGTGGG + Intergenic
1088821907 11:113463827-113463849 GAGAGGCCCTTGGCCCAGGTAGG + Intronic
1089195714 11:116693010-116693032 GAGGTGCCCTCAGACCAGCTGGG - Intergenic
1089543904 11:119207088-119207110 GAGCTGTCCTGACCCCAGCCAGG - Intronic
1089572004 11:119417270-119417292 GAGCTGTCCTTGTCCCAGGTTGG - Intergenic
1089621775 11:119726783-119726805 GAGCTTCCCAGAGCTCTGGTTGG - Intronic
1089786861 11:120913775-120913797 GAGCTTCCCAGAGGCCTGGTGGG + Intronic
1090006784 11:123009409-123009431 GAGATCACCTGAGCCCAGGAAGG + Intergenic
1091208367 11:133835819-133835841 GTGCTGCCATTAGCTCAGGTAGG - Intergenic
1091294850 11:134466500-134466522 GAGCTGCCGTGATTCCAGGGCGG - Intergenic
1093756962 12:22863299-22863321 GAGCTACCCTGTGGCCAGGGAGG + Intergenic
1094190782 12:27696089-27696111 GAGATCACCTGAGCCCAGGGAGG + Intergenic
1094636008 12:32227559-32227581 GAGGTTCCATGAGCCCAGATAGG + Intronic
1097226322 12:57478688-57478710 GAGCTAGCCTGAGCCCTGCTTGG + Exonic
1098736635 12:74113095-74113117 GAGCTGCCCGGAGCTCTGGGAGG - Intergenic
1101693332 12:107101449-107101471 GCGTTTCCCTGAGCTCAGGTGGG - Intergenic
1102293091 12:111716790-111716812 AAGCTGCACTGAGCCGAGGTGGG + Intronic
1102520811 12:113476643-113476665 GAGCGGCCCGGAGCCCAGGCGGG + Intergenic
1102787288 12:115614968-115614990 GACCTGCCCAGAGCCCTGATGGG + Intergenic
1103480043 12:121244960-121244982 GAGGTGGGCTGAGCCCAGGTTGG + Intronic
1104085522 12:125471032-125471054 GAGCTGGCCGGCGCCCATGTGGG + Intronic
1104618312 12:130289688-130289710 GAGATGGCCTGTGCCCATGTGGG + Intergenic
1104763624 12:131312980-131313002 CCCCTGCCCTGAGCCCAGGTTGG + Intergenic
1104864522 12:131944954-131944976 GGGCTGCCAGGAGCCCAGGGAGG + Exonic
1104910309 12:132237073-132237095 GGGCTGCCCTGACCCCAGTGTGG + Intronic
1104939864 12:132390013-132390035 TGGCTGGACTGAGCCCAGGTGGG - Intergenic
1108627488 13:52245344-52245366 GGGATTCCCTGAGCCCAGGGAGG + Intergenic
1108658577 13:52561116-52561138 GGGATTCCCTGAGCCCAGGGAGG - Intergenic
1112959526 13:105106566-105106588 GAGCTGCCATGAGGTCAGGAAGG + Intergenic
1113668661 13:112159998-112160020 GAGCTGCTCTGTGGCCAGGGTGG - Intergenic
1113756168 13:112812522-112812544 GAGGTTCACTGAGCCCAGGCTGG - Intronic
1113831534 13:113299292-113299314 GAGTTGCTCTGTGCCCAGGCTGG + Intronic
1113947816 13:114054425-114054447 TTGCTGCCCGGAGCCCAGGTGGG + Intronic
1113947826 13:114054447-114054469 GAGGGGCCCAGAGTCCAGGTGGG + Intronic
1113947835 13:114054469-114054491 GAGGGGCCCAGAGTCCAGGTGGG + Intronic
1113950110 13:114066952-114066974 GGCCTGTCCTCAGCCCAGGTGGG - Intronic
1114009088 14:18348279-18348301 GATCTGCCCTGAGCCCTGTGAGG - Intergenic
1114284395 14:21226631-21226653 GAGATCCCTTGAGCCCAGGCGGG + Intronic
1114556112 14:23563345-23563367 GGGCAGCCCTGGGCCTAGGTAGG + Intronic
1115879515 14:37899437-37899459 GAGCTGACCAGAGCCCATCTGGG + Intronic
1116404354 14:44550275-44550297 GAGATGCCCTGAGTACATGTAGG - Intergenic
1117080912 14:52150974-52150996 GCTCTGCCCTGAGCCCAGACAGG + Intergenic
1118260729 14:64244441-64244463 GATCTGCCCTTAGCCAATGTTGG + Intronic
1118401798 14:65386412-65386434 GAGCATCTCTGAGCCCAGGGAGG + Intergenic
1119061441 14:71479084-71479106 TAGCTGCCTTGAGTCCAGGCTGG + Intronic
1119258481 14:73220828-73220850 GAGGTGCCCTGAGCCCACACAGG - Exonic
1119601388 14:75979386-75979408 GAGCTGCCCACCTCCCAGGTGGG + Intronic
1121282526 14:92709619-92709641 GTGCTGTCCCCAGCCCAGGTGGG - Intronic
1121574665 14:94973976-94973998 GGGCTGCAGTGAGCCAAGGTAGG + Intergenic
1121848668 14:97198413-97198435 GGGCTGGCCTGAACCGAGGTGGG - Intergenic
1122178606 14:99938643-99938665 CTGCATCCCTGAGCCCAGGTGGG - Intronic
1122205478 14:100145977-100145999 GAGCGTCCCTGAGCCCAGAGAGG - Exonic
1122408589 14:101514495-101514517 GGGCTGCCTATAGCCCAGGTAGG - Intergenic
1122778491 14:104133692-104133714 GCCCTGCCCTGAGCCGGGGTCGG + Intergenic
1123392285 15:19888882-19888904 GATCTGCCCTGAGCCCTGTGAGG - Intergenic
1124154039 15:27209612-27209634 GTGCTGGGCTGTGCCCAGGTGGG + Intronic
1124423272 15:29540471-29540493 GAGTTTCACTGAGCCCTGGTGGG - Intronic
1124721020 15:32110835-32110857 GAGCCACCCTGGTCCCAGGTTGG + Intronic
1125009294 15:34853099-34853121 GAGCTGTACTGAGCCAAGGATGG - Exonic
1125718064 15:41830873-41830895 GAGCTGCCCTCAGCCCCTCTTGG - Intronic
1125750029 15:42021660-42021682 AAGCTGTCCTGAGACCAGGCAGG - Intronic
1125992434 15:44122658-44122680 GATCTGCCCTCAGCCTGGGTTGG - Intronic
1127477051 15:59344591-59344613 GGACAGCCCTGGGCCCAGGTAGG + Intronic
1127961117 15:63891696-63891718 AAGCTCCCATGAGCCCAGCTAGG - Intergenic
1128326124 15:66725359-66725381 GAGCTGCTCTGGCCCCAGGGAGG + Intronic
1128543268 15:68551363-68551385 GAGCTACCCTCATGCCAGGTTGG - Intergenic
1130868030 15:87948794-87948816 TTGCTGCCCTGGGACCAGGTTGG + Intronic
1131299575 15:91185159-91185181 GGGCTCCACTGAGCCCAGGGAGG - Intronic
1132252655 15:100345836-100345858 GAGGAGCCCAGAGCCCAGGGTGG - Intergenic
1132871296 16:2116861-2116883 GTGCGGCGCTGAGCACAGGTCGG + Exonic
1133038939 16:3049706-3049728 CAGCTTCCCTGGGCCCTGGTGGG - Intronic
1134521230 16:14920033-14920055 GTGCGGCGCTGAGCACAGGTCGG - Intronic
1134708907 16:16318684-16318706 GTGCGGCGCTGAGCACAGGTCGG - Intergenic
1134716118 16:16358718-16358740 GTGCAGCGCTGAGCACAGGTCGG - Intergenic
1134818608 16:17227361-17227383 GAACTCCCCTGAGCTCAGGACGG + Intronic
1134950698 16:18349961-18349983 GTGCGGCGCTGAGCACAGGTCGG + Intergenic
1134958636 16:18393441-18393463 GTGCGGCGCTGAGCACAGGTCGG + Intergenic
1135822989 16:25701263-25701285 GAGATGCCTTGGGCCCAGGTTGG + Intronic
1135990499 16:27216045-27216067 CAGCCGCACTGAGCCCAGGAGGG - Intronic
1136088195 16:27900467-27900489 GAGGTGCTCTGAGGCCAGCTGGG - Intronic
1136117600 16:28104754-28104776 TTGCTGCCCTGGGCCCAGGCCGG - Intronic
1137262608 16:46843821-46843843 CTGCAGCCCTGTGCCCAGGTTGG + Intergenic
1137694691 16:50453729-50453751 GAGCCTCCATGACCCCAGGTGGG - Intergenic
1138341678 16:56293734-56293756 GAGCTGTCCTGATATCAGGTTGG + Intronic
1141143609 16:81513891-81513913 GCGCTTCCCTCAGCCTAGGTGGG + Intronic
1141999872 16:87658140-87658162 TACCTGCCCTGCACCCAGGTTGG - Intronic
1142972611 17:3623084-3623106 CAGCCGCCCAGACCCCAGGTGGG - Intronic
1143594216 17:7904769-7904791 GAACTACCCAGAGGCCAGGTGGG + Intronic
1143621930 17:8085830-8085852 CTGCTGCCCTGAGCTCAGCTTGG - Intronic
1143781253 17:9230763-9230785 AAGCTGCCCAGATCCCAGGGAGG - Intronic
1144787946 17:17842226-17842248 GAGCTCCCTGGAGCCCAGGGAGG + Intergenic
1144788344 17:17844158-17844180 GGGCTGGCCTGGCCCCAGGTGGG + Intronic
1144839085 17:18174666-18174688 GTCCTGCCCTGACCCCAGGGGGG - Intronic
1145385724 17:22410365-22410387 GAGGAGGCCAGAGCCCAGGTAGG - Intergenic
1145732252 17:27199674-27199696 GAGCAGCCAGGAGGCCAGGTTGG + Intergenic
1145995043 17:29100181-29100203 GAGGGGCCTGGAGCCCAGGTTGG - Intronic
1147160967 17:38569255-38569277 GAGCTGCCCTGGGGCCGGGTTGG + Intronic
1147477162 17:40723257-40723279 GAGCTGCCATTAACCCAGATGGG - Intergenic
1147535147 17:41315945-41315967 CAGCTGTCATTAGCCCAGGTTGG + Intergenic
1147747039 17:42701085-42701107 GAGCTGCCCTGTGTCCATGGTGG - Exonic
1147758390 17:42782538-42782560 GGGCTGCCCCAGGCCCAGGTTGG + Intronic
1148103927 17:45109317-45109339 GGGCTGCTCTGTGCCCAGCTAGG - Exonic
1148185662 17:45641695-45641717 GAGGTGCCCAGGGCCCAGGAAGG + Intergenic
1149343148 17:55707426-55707448 GAGCTGAGCTGATCCCAGATGGG - Intergenic
1151355350 17:73554959-73554981 GAGGTGCTCTGAGCTCAGGCAGG + Intronic
1151384245 17:73745468-73745490 GGGCTTCTCTCAGCCCAGGTAGG - Intergenic
1151406239 17:73888575-73888597 GAGCTGCCCTGCCCATAGGTAGG + Intergenic
1152725016 17:81940927-81940949 CAGCTGCCCCGAGCACAGTTGGG + Exonic
1152927747 17:83095348-83095370 GAGCTGGTCTGAACCCAGGTTGG + Intergenic
1153422710 18:4926267-4926289 GGGCTGTCCTGTGCGCAGGTTGG - Intergenic
1153583364 18:6597651-6597673 GAGCTGCCCCAAGCCCTGCTGGG - Intergenic
1153714962 18:7838758-7838780 GAGCTCCCCTAGGCCCAGGTAGG + Intronic
1155394940 18:25377166-25377188 GAGATTCCCAGAGCCCAAGTGGG - Intergenic
1155510160 18:26568323-26568345 GAGATCACCTGAGCCCAGGGAGG - Intronic
1156292074 18:35756015-35756037 GGGGTGCCTTGAGCCCAGGCAGG - Intergenic
1156313362 18:35945518-35945540 GAGCTGCCCTTGCCCCAGGGAGG + Intergenic
1157545210 18:48541417-48541439 GAGCCGCCCAGAGCGCAGGGAGG + Intronic
1157618846 18:49003627-49003649 AAGCTGCCATGAGCCCAACTGGG - Intergenic
1158200714 18:54936588-54936610 GAGCCCCCATGAGCACAGGTGGG - Intronic
1158440083 18:57467794-57467816 GAGCTGCCCGGAGTCCGGGAAGG - Intronic
1160262499 18:77307892-77307914 AGCCGGCCCTGAGCCCAGGTCGG - Intergenic
1160456542 18:79006147-79006169 GAGCTGCCCTCCGCCCTGGCCGG - Intergenic
1160657467 19:280957-280979 GAGCTGCGCTGAGCCCAGCAGGG + Intergenic
1162098365 19:8324458-8324480 GGGCTGGCCCGAGCTCAGGTGGG + Exonic
1162524219 19:11197867-11197889 GAGCTGGCCGGGGCCCAGCTCGG + Intergenic
1163442489 19:17328847-17328869 GAGCTGGCCCGAGCCCTGCTTGG - Exonic
1163785310 19:19272112-19272134 GGGCAGCCCTCAACCCAGGTGGG + Intronic
1165137766 19:33681186-33681208 GAACTCCACTGAGCCCAGCTGGG - Intronic
1165309307 19:35021059-35021081 GAGCTGCCCTTGACCCAGATGGG + Intronic
1166405743 19:42520744-42520766 GCTCTGCCCTGACCCCATGTGGG - Intronic
1166873032 19:45882420-45882442 GCCCTGCCCTGAGCCCAGGCTGG + Intergenic
1167363906 19:49044747-49044769 GAGCTGCCCGGGGCCCGGGCAGG + Intronic
1167365877 19:49054816-49054838 GAGCTGCCCGGGGCCCGGGCAGG - Intronic
1168102108 19:54146780-54146802 GTGCTGCCCTGAGGGCAGGTGGG + Intronic
1168339592 19:55615509-55615531 CAGCTGCCCTGCGCCCTGGCCGG + Exonic
1168643799 19:58047084-58047106 GTGCTGCCCTGTGCCCAGGGAGG + Intronic
925221639 2:2146489-2146511 CAGCAGCACTGAGCCCAGGAAGG - Intronic
925449595 2:3957229-3957251 GCCCTGCCCTGAGGGCAGGTGGG - Intergenic
926044268 2:9698324-9698346 GAGCAGCACAGACCCCAGGTAGG + Intergenic
927709694 2:25316751-25316773 GTGCAGCCCTTGGCCCAGGTGGG - Intronic
928323549 2:30302415-30302437 GATCTTCCTTCAGCCCAGGTCGG - Intronic
929532443 2:42761564-42761586 GAGCTGCCCTGAGCCCAGGTGGG + Intergenic
930730521 2:54723977-54723999 GTCCTGCCCTGAGCCCAGCGTGG - Intronic
931682185 2:64760245-64760267 GAGCTTGCCTGAGCTCAGGTAGG + Intergenic
933700797 2:85254084-85254106 CAGCTGCCCCGTGCCCAGCTGGG - Intronic
934553531 2:95276138-95276160 GCGCTGCCCAGGGCCCGGGTAGG + Intronic
935203981 2:100881945-100881967 GCCCTGCCCGGAGCCCAGGCTGG + Intronic
936254857 2:110902946-110902968 AAGGTGGCCTGAGCCCAGGAAGG + Intronic
938070801 2:128307191-128307213 GCACAGCCCTGAGCCCAGGAAGG - Intronic
938140346 2:128789980-128790002 GAGCTGCCCTGAGCCTCAGTTGG - Intergenic
938289274 2:130140906-130140928 GTGCTGACCTGAGCCCACGAGGG - Intronic
938467253 2:131532032-131532054 GTGCTGACCTGAGCCCACGAGGG + Intronic
939623942 2:144453352-144453374 GACCTGCCCTGGGTCCAAGTGGG - Intronic
940795513 2:158072602-158072624 GAGCTGCCCAGAGCTGAGGTTGG - Intronic
942215206 2:173712692-173712714 AAGCTGTCCAGAGCCAAGGTAGG + Intergenic
942391678 2:175501991-175502013 GAGCTGCCTGGAGCTCAGGGTGG + Intergenic
945327263 2:208496763-208496785 GAGCTCCACTGTGGCCAGGTGGG + Intronic
947165719 2:227259843-227259865 GAGCTCCTCTGGGCCCTGGTGGG - Exonic
947893246 2:233644691-233644713 GAGAATCCCTGAGCCCTGGTGGG - Intronic
948142744 2:235685841-235685863 GAGGTGGCCTGAGCACAGCTTGG + Intronic
1168794760 20:604143-604165 GGGCTGCCCTGAGCCCTGGAAGG - Exonic
1169045297 20:2530197-2530219 CAGCAGCCCGGTGCCCAGGTAGG + Intergenic
1170065972 20:12311095-12311117 GTGTTGCCCTGAGGCCAAGTGGG - Intergenic
1170702242 20:18713918-18713940 GAGCTGCCCAGAGCCCAGCACGG + Intronic
1171445125 20:25197253-25197275 GAGCTACCCTGTCCCCTGGTTGG - Intronic
1171462192 20:25304397-25304419 GGGCTTTCCTGAGCTCAGGTGGG - Intronic
1172307723 20:33893234-33893256 GAGATCACCTGAGCCCAGGGAGG + Intergenic
1172573285 20:35986969-35986991 GAGCTGCCCAAAGCAAAGGTAGG + Intronic
1173136970 20:40447250-40447272 GAGAGGCTCTGAGCCCAGGTTGG + Intergenic
1173791829 20:45833052-45833074 GGGATGACCTGAGCCCAGGGAGG + Intronic
1174197607 20:48784758-48784780 GAGCTGCTGTGGGCTCAGGTGGG - Intronic
1174277672 20:49415557-49415579 GAGTTGCCCGGAGCCAAGGAAGG - Intronic
1174330453 20:49813104-49813126 GGGCGGGCCTGGGCCCAGGTGGG + Intronic
1174385921 20:50188774-50188796 GAGCTGCCTTGGGCAGAGGTGGG + Intergenic
1175265257 20:57699234-57699256 GAGCTGGGCGGAGCTCAGGTTGG - Intronic
1175492706 20:59389913-59389935 AAGCAGCCCTGAGCCAAGGATGG - Intergenic
1175825242 20:61933374-61933396 GTGCTGCCCTGTGCCCTGGAGGG + Intronic
1175899794 20:62355463-62355485 CAGCTGCCCAGACTCCAGGTAGG + Intronic
1176083576 20:63285798-63285820 GTGCAGCCCTCAGCCCAGCTTGG + Intronic
1177389020 21:20442968-20442990 GACCCGCCCTCAACCCAGGTGGG + Intergenic
1178845304 21:36169583-36169605 AAGCTGGACTGAGCCCAGGAGGG - Intronic
1179456701 21:41505607-41505629 GAGCAGCACGGAGCCCAGGTAGG + Intronic
1179615759 21:42582256-42582278 GGGCTGCCCTGAGCCCCTGCCGG + Intergenic
1180221766 21:46363849-46363871 GAGCCGCCCACAGCCCAGGACGG + Exonic
1180228263 21:46411393-46411415 GAGCTGCTCTGCTCCCAGGCCGG + Exonic
1180433587 22:15279089-15279111 GATCTGCCCTGAGCCCTGTGAGG - Intergenic
1180825360 22:18857556-18857578 GAGCTGCTCAAAGCCCAGGAGGG - Intronic
1180899558 22:19360532-19360554 ACACTGCTCTGAGCCCAGGTTGG - Intronic
1181035209 22:20166681-20166703 GAGCTACCAGGAGCCCAGGTTGG + Intergenic
1181187371 22:21116991-21117013 GAGCTGCTCAAAGCCCAGGAGGG + Intergenic
1181211827 22:21293502-21293524 GAGCTGCTCAAAGCCCAGGAGGG - Intergenic
1181275825 22:21686981-21687003 GAGCTGCACTGCGACCTGGTGGG + Exonic
1181397673 22:22633384-22633406 GAGCTGCTCAAAGCCCAGGAGGG + Intergenic
1181500421 22:23312754-23312776 GAGCTGCTCAAAGCCCAGGAGGG + Intronic
1181508596 22:23378665-23378687 GAGCTGCCAGGAGCCCAAGTAGG - Intergenic
1181705643 22:24648065-24648087 GAGCTGCTCAAAGCCCAGGAGGG + Intergenic
1183653506 22:39172093-39172115 GGGCTGCCCAGGGCCCAGCTGGG - Intergenic
1184037652 22:41926302-41926324 CAGCAGCCCTGCGCCCAGGACGG - Exonic
1184130545 22:42514388-42514410 GAACTGCCCTGAGCCCCCGCAGG + Intronic
1184140724 22:42576218-42576240 GAACTGCCCTGAGCCCCCGCAGG + Intergenic
1184267345 22:43356119-43356141 GAGCTGCTTGCAGCCCAGGTGGG - Intergenic
1184285150 22:43466370-43466392 GAGCTGCTGTGTGCCCAGGTAGG + Intronic
1184687905 22:46104695-46104717 GAGGTGCCGGGAGCCCAGGTGGG - Intronic
1184948144 22:47818725-47818747 GAGCTGCACTGCGGCCAGGTGGG + Intergenic
1185291017 22:50027804-50027826 GAGCTGGCCTGAGCCCAGCCAGG + Intronic
1185347580 22:50317150-50317172 GAGCTGGACACAGCCCAGGTGGG + Intronic
1203215126 22_KI270731v1_random:1930-1952 GAGCTGCTCAAAGCCCAGGAGGG + Intergenic
1203275507 22_KI270734v1_random:83459-83481 GAGCTGCTCAAAGCCCAGGAGGG - Intergenic
950487009 3:13279864-13279886 GGGCTGCCCAGAGGCTAGGTGGG - Intergenic
952743377 3:36756178-36756200 CAGCAGAACTGAGCCCAGGTTGG - Intergenic
952776503 3:37051764-37051786 GAGGTTCCATGAGCCCAGGTGGG + Intergenic
952942832 3:38456267-38456289 GAGCTGCCCCAGGCCCAGTTTGG + Intronic
953919562 3:46942698-46942720 GAGCTGCCCTGAGTTGGGGTGGG - Intronic
954266074 3:49470872-49470894 GAGCTGCTCAGAGCCTTGGTGGG + Intronic
954446546 3:50549900-50549922 TAGATGCACTGAGCCCAGATAGG + Intergenic
954671688 3:52294422-52294444 AGGCTGCCCAGAGCCCAGGTGGG - Intergenic
955118890 3:56035707-56035729 GAGCTGCCCTCAGCAGAGGCAGG + Intronic
957193303 3:77038855-77038877 GAGCTTCCATGAGCTCAGCTGGG + Intronic
959755175 3:109888720-109888742 GAGCTGCACTGAGACCTGGTGGG - Intergenic
960137644 3:114122009-114122031 GAGCTGGGCTGAACCCAGGGTGG - Intergenic
961358272 3:126352296-126352318 GAGGTGCCCAGGGCCCAGGTGGG - Exonic
961475776 3:127145445-127145467 GGGCTGCCCAGAGCCCAGTGAGG - Intergenic
961476436 3:127149744-127149766 CAGCTGCCCTGTGCCCAGCCTGG - Intergenic
961580988 3:127882135-127882157 GAGCTGCCTTGAGCCAAGGGAGG - Intergenic
961623100 3:128240062-128240084 ATGCTGCCCTGTGCCCAGGTGGG + Intronic
967007863 3:185401412-185401434 GGGCAGCCCTGAGCCCAGACAGG - Intronic
968425919 4:523232-523254 GAGACGCCCTCAGCCCAGGCAGG - Intronic
968463890 4:740240-740262 GGCCTGCCCGGAGTCCAGGTGGG - Intronic
969299719 4:6290824-6290846 GAGCTGTCTTGAACCCAGGGTGG - Intronic
969333770 4:6494904-6494926 AGGCTGCCCTGAGACCAGGATGG + Intronic
969517724 4:7656868-7656890 GAGCTGCCCTCAGCACAAATGGG + Intronic
972629691 4:40832635-40832657 GAGATGGCCTGAGCACAGGCAGG - Intronic
974365203 4:60938718-60938740 GAGCTGAGCTGAGCTCAGCTAGG + Intergenic
974410789 4:61539054-61539076 GCTCTGCCCTGAGCCCATTTTGG - Intronic
975584404 4:75936539-75936561 GAGGTGTCCTGAGCCCAGGATGG - Intronic
978446265 4:108783054-108783076 GAGCCGCCCTGAGCAGAGCTAGG - Intergenic
979158581 4:117429599-117429621 GAGTTGCCCTGAGCCCAGGCGGG + Intergenic
980730113 4:136812754-136812776 GCACTGCCCTGGGCCCAGCTCGG + Intergenic
984193609 4:176633262-176633284 CAGCTGCTCTGAGACCAGTTGGG + Intergenic
984285702 4:177725345-177725367 GAGCAGTCCTGAGCACAGGGAGG + Intergenic
985494228 5:195674-195696 CAGATGCGCTGAGGCCAGGTCGG - Intergenic
985834316 5:2259631-2259653 GAGCAGCCCTCAGCCCAGGGAGG - Intergenic
986944237 5:12995315-12995337 GAGCTGCCCTGACAACAGGTGGG + Intergenic
989090510 5:37725313-37725335 GAGTTCCCCTGAGGCCAGCTAGG - Intronic
989657613 5:43761439-43761461 GAGCTGCCCTGAGCTGGAGTAGG + Intergenic
995399321 5:111722350-111722372 GTGCAGCCCTGAGCTCAGCTGGG + Intronic
997657885 5:135568790-135568812 GTGCTGCTCTGAGGCCAGGCAGG + Intergenic
997870895 5:137504348-137504370 GATCTGGCCTGAGCCAAGGAAGG + Intronic
1000804657 5:165775271-165775293 AAGCTGCTCTGAGTGCAGGTGGG - Intergenic
1001639776 5:173236167-173236189 GGGCTCCTCTGAGCCCAGCTAGG + Intergenic
1002212236 5:177605868-177605890 GAGCTGCTCTGTGCCATGGTGGG - Intronic
1002346416 5:178550817-178550839 GAGCTGTCTTGACCCCAGCTTGG - Intronic
1002520688 5:179792022-179792044 GAGCTGGCTTGAGCCCAGGCAGG + Intronic
1002797683 6:488084-488106 CAGCTGCCATGTGCCCACGTGGG + Intronic
1003995531 6:11537276-11537298 GGGCAGCCCTGACCCAAGGTGGG - Intergenic
1006152998 6:31999203-31999225 GAGCTGCCCTGGGCCAGGGGAGG + Intronic
1006156022 6:32013192-32013214 GACCTGGCCTGTGCCCAGGAAGG - Intergenic
1006159306 6:32031940-32031962 GAGCTGCCCTGGGCCAGGGGAGG + Intronic
1007406511 6:41638808-41638830 GCGCAGCCCCGGGCCCAGGTAGG + Exonic
1007686673 6:43671256-43671278 GAGCTGCAGGGAGCCAAGGTGGG - Exonic
1009909824 6:69912559-69912581 GAGCAGCCATGAGCAGAGGTTGG - Intronic
1012145214 6:95671564-95671586 GAGTTTTCCTGAGCACAGGTGGG - Intergenic
1015175002 6:130296748-130296770 GGTCTGCCCTGAGCCCATATTGG + Intronic
1015787116 6:136929673-136929695 GAGATGCCCTTTCCCCAGGTGGG + Intergenic
1018997357 6:168720064-168720086 GACATCCCCTGACCCCAGGTGGG + Intergenic
1019013286 6:168860628-168860650 GAGCCGCCCTGAGCCTATGCTGG + Intergenic
1019128027 6:169854217-169854239 GGGCTGCCCTGGGCCCATGTTGG + Intergenic
1019177496 6:170167658-170167680 GAGGTGCCCTGAGGTCAGGTGGG + Intergenic
1020088439 7:5323988-5324010 GAGCGGCCCTGGGACCAGGGAGG - Intronic
1020887768 7:13840899-13840921 GAGCTGGCCAGAGCACAGGCTGG + Intergenic
1022384823 7:29890890-29890912 GGCCTGCCCTGTGCTCAGGTGGG + Intronic
1022966741 7:35481302-35481324 GGGATGGCCTGAGCTCAGGTTGG - Intergenic
1023085219 7:36563388-36563410 GGGCTGCCTTGAGTCCAGGTTGG + Intronic
1023970373 7:44986520-44986542 GACCATTCCTGAGCCCAGGTAGG - Intergenic
1024474760 7:49798647-49798669 GAGCTGGCCTGAATCCAGCTGGG + Intronic
1025718308 7:63984032-63984054 GAGCTGCCCAGAGCTGGGGTAGG - Intergenic
1025997357 7:66536451-66536473 GAGCTTTCCTGAACCCAGGCTGG - Intergenic
1026524390 7:71141622-71141644 GAGCAGCCCTGGGCCATGGTAGG + Intronic
1026541428 7:71282986-71283008 GATCTGCTCAGAGCCAAGGTGGG + Intronic
1026990221 7:74580931-74580953 GAGCTCCCCTGAACCCAGGCTGG - Intronic
1027129677 7:75582044-75582066 CTCCTGCCCTGAGCCCAGGGAGG - Intronic
1028627131 7:92889637-92889659 GAGCTGCACAGAGCCAAGGGAGG - Intergenic
1029109117 7:98203230-98203252 GGGCTGACCTGAGTCCAGGCGGG + Intronic
1029220895 7:98989387-98989409 CAGCAGCCCTGAGCTCAGGGTGG + Intronic
1030981144 7:116186490-116186512 GAGCTGCCCTCAGCCCCTATTGG + Intergenic
1034540493 7:151755084-151755106 GAGCTGTCCTGAGCGGGGGTCGG + Intronic
1035302444 7:157906347-157906369 GATCAGCCCTGCGACCAGGTGGG - Intronic
1035319588 7:158020126-158020148 GTGATGGCCAGAGCCCAGGTGGG + Intronic
1035333000 7:158108329-158108351 GAGCAGCCCTGAGGCCACCTGGG - Intronic
1036587365 8:10136697-10136719 CAGCTGCCCTGAGGCAAGGCAGG + Intronic
1038485873 8:27934885-27934907 AAGCTGCCCAGGGCCCAGTTTGG + Intronic
1040289412 8:46116700-46116722 GAGCTGCCCCGAGCAGGGGTAGG - Intergenic
1044153376 8:88811539-88811561 GCTCTGCCCTGAGCCCAGTTAGG + Intergenic
1044944220 8:97375808-97375830 GAGCTGGCCAGAGCACAGCTGGG + Intergenic
1045754614 8:105528125-105528147 GAGAAGCCCTGAGCCCAGGTGGG + Intronic
1048001123 8:130380338-130380360 GAGCAGCCCTCAGCCAAGGAAGG - Intronic
1048084516 8:131162446-131162468 GAGCTCCACTGACCCCAGGAGGG - Intergenic
1049016007 8:139920546-139920568 GCCCTGCCCTGGGCCCACGTAGG - Intronic
1049216034 8:141408830-141408852 GCCCTGCCCTGAGCCCTGGGTGG - Intronic
1049260838 8:141638342-141638364 GTGTTGGCCTGAGCCCAGGCAGG - Intergenic
1049706968 8:144047510-144047532 GGGCTGCCCCATGCCCAGGTTGG - Intergenic
1050602887 9:7270410-7270432 GAACTGACCTGCGCCCAGCTCGG + Intergenic
1050986804 9:12092483-12092505 CAGCTCCCCTGGTCCCAGGTGGG + Intergenic
1051364874 9:16314806-16314828 GAGGTGCCCAGAGCTCGGGTTGG - Intergenic
1053249256 9:36560708-36560730 GAGCAGCCCTGAGGGCTGGTGGG + Intergenic
1056536967 9:87537049-87537071 GAGCTGCAGTGAGCCAAGATTGG - Intronic
1057260234 9:93578740-93578762 GAGCTGGCCTGAGAGCTGGTTGG + Intronic
1060847192 9:126846951-126846973 GAGCCACCAGGAGCCCAGGTAGG + Intergenic
1061076242 9:128343187-128343209 AAACTGCCCTGGACCCAGGTGGG + Exonic
1061166729 9:128927179-128927201 GAGCAGCTTCGAGCCCAGGTAGG + Exonic
1061383891 9:130276870-130276892 CAGCTGCAGTGACCCCAGGTAGG - Intergenic
1061502082 9:131009660-131009682 GAGCTGCTGTGCGCCCAGGTTGG + Intronic
1061897740 9:133657232-133657254 GCGCTGCCATGGGCCCGGGTGGG + Intronic
1061989919 9:134153307-134153329 GGGCGCCCCTGAGCCCAGGGTGG + Intronic
1062026383 9:134342603-134342625 GAGCTGCTGTGAGCCCAGGCAGG + Intronic
1062357280 9:136170850-136170872 GAGCTGCCCTGGGGCCAGTGTGG - Intergenic
1062389532 9:136328362-136328384 GGGCTGCCCTGGGCCCAGCCGGG + Intronic
1062681550 9:137784776-137784798 GAGAAGCGCTGAGCCGAGGTAGG + Intronic
1186636958 X:11416702-11416724 GTGCTGCCCAGAGCCCAGCTCGG + Intronic
1187788999 X:22927311-22927333 GAGCTTCACTGAGCCCAGTTTGG + Intergenic
1188770454 X:34147575-34147597 GAGGAGCCCTGAGCCCAGATGGG + Intergenic
1189665388 X:43349872-43349894 GCTCTGCCCTGAGCCCATTTTGG - Intergenic
1191615962 X:63169304-63169326 GCTCTGCCCTGAGCCCATTTTGG + Intergenic
1191620336 X:63209619-63209641 GCTCTGCCCTGAGCCCATTTTGG - Intergenic
1191860886 X:65666074-65666096 AGGCTGCACTGAGCCCAGATTGG - Intronic
1196629927 X:117926801-117926823 GTGATGCCCTAAGTCCAGGTCGG - Intronic
1198209434 X:134503183-134503205 CACCTGGCCTGAGCCCAGGGAGG - Intronic
1200138698 X:153886763-153886785 GCGCACCCCAGAGCCCAGGTGGG + Intronic
1200887028 Y:8280603-8280625 GGGGTGCCCTGAGGCCACGTAGG + Intergenic