ID: 929533206

View in Genome Browser
Species Human (GRCh38)
Location 2:42764905-42764927
Sequence CGGAATAGGGAGTGGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 568
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 543}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929533189_929533206 27 Left 929533189 2:42764855-42764877 CCCCATGGCTCCTTGTCCACTCC 0: 1
1: 0
2: 2
3: 22
4: 242
Right 929533206 2:42764905-42764927 CGGAATAGGGAGTGGGAGGCTGG 0: 1
1: 0
2: 3
3: 21
4: 543
929533193_929533206 11 Left 929533193 2:42764871-42764893 CCACTCCACTCCTTGCCCCCATT 0: 1
1: 0
2: 3
3: 50
4: 573
Right 929533206 2:42764905-42764927 CGGAATAGGGAGTGGGAGGCTGG 0: 1
1: 0
2: 3
3: 21
4: 543
929533199_929533206 -6 Left 929533199 2:42764888-42764910 CCCATTAGCATTCACTGCGGAAT 0: 1
1: 0
2: 1
3: 7
4: 98
Right 929533206 2:42764905-42764927 CGGAATAGGGAGTGGGAGGCTGG 0: 1
1: 0
2: 3
3: 21
4: 543
929533192_929533206 17 Left 929533192 2:42764865-42764887 CCTTGTCCACTCCACTCCTTGCC 0: 1
1: 0
2: 5
3: 46
4: 539
Right 929533206 2:42764905-42764927 CGGAATAGGGAGTGGGAGGCTGG 0: 1
1: 0
2: 3
3: 21
4: 543
929533200_929533206 -7 Left 929533200 2:42764889-42764911 CCATTAGCATTCACTGCGGAATA 0: 1
1: 0
2: 1
3: 4
4: 92
Right 929533206 2:42764905-42764927 CGGAATAGGGAGTGGGAGGCTGG 0: 1
1: 0
2: 3
3: 21
4: 543
929533197_929533206 -4 Left 929533197 2:42764886-42764908 CCCCCATTAGCATTCACTGCGGA 0: 1
1: 0
2: 0
3: 4
4: 72
Right 929533206 2:42764905-42764927 CGGAATAGGGAGTGGGAGGCTGG 0: 1
1: 0
2: 3
3: 21
4: 543
929533191_929533206 25 Left 929533191 2:42764857-42764879 CCATGGCTCCTTGTCCACTCCAC 0: 1
1: 1
2: 3
3: 27
4: 271
Right 929533206 2:42764905-42764927 CGGAATAGGGAGTGGGAGGCTGG 0: 1
1: 0
2: 3
3: 21
4: 543
929533194_929533206 6 Left 929533194 2:42764876-42764898 CCACTCCTTGCCCCCATTAGCAT 0: 1
1: 0
2: 0
3: 20
4: 271
Right 929533206 2:42764905-42764927 CGGAATAGGGAGTGGGAGGCTGG 0: 1
1: 0
2: 3
3: 21
4: 543
929533198_929533206 -5 Left 929533198 2:42764887-42764909 CCCCATTAGCATTCACTGCGGAA 0: 1
1: 0
2: 0
3: 4
4: 78
Right 929533206 2:42764905-42764927 CGGAATAGGGAGTGGGAGGCTGG 0: 1
1: 0
2: 3
3: 21
4: 543
929533195_929533206 1 Left 929533195 2:42764881-42764903 CCTTGCCCCCATTAGCATTCACT 0: 1
1: 0
2: 6
3: 106
4: 535
Right 929533206 2:42764905-42764927 CGGAATAGGGAGTGGGAGGCTGG 0: 1
1: 0
2: 3
3: 21
4: 543
929533190_929533206 26 Left 929533190 2:42764856-42764878 CCCATGGCTCCTTGTCCACTCCA 0: 1
1: 0
2: 1
3: 32
4: 238
Right 929533206 2:42764905-42764927 CGGAATAGGGAGTGGGAGGCTGG 0: 1
1: 0
2: 3
3: 21
4: 543

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929533206 Original CRISPR CGGAATAGGGAGTGGGAGGC TGG Intergenic
900408821 1:2503857-2503879 CAGAAGAGAGAGAGGGAGGCAGG - Intronic
900653870 1:3745398-3745420 CTGAGTCGGGAGAGGGAGGCTGG - Intergenic
901232127 1:7647158-7647180 CGGAACAGAGGGAGGGAGGCTGG - Intronic
901653069 1:10754197-10754219 TAGAATAGGGAGTGAGAGGCAGG - Intronic
902018442 1:13327509-13327531 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
902018448 1:13327528-13327550 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
902018454 1:13327547-13327569 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
902018460 1:13327566-13327588 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
902018466 1:13327585-13327607 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
902018472 1:13327604-13327626 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
902018478 1:13327623-13327645 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
902018484 1:13327642-13327664 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
902535808 1:17118858-17118880 CTGAACTGGGAGTGGGAAGCAGG + Intronic
902598635 1:17526076-17526098 AGGAATAGGGGGTGGGAGATGGG - Intergenic
902793914 1:18787950-18787972 AGGAAAAGAGAGAGGGAGGCAGG + Intergenic
903059773 1:20661670-20661692 CAGACTAGGGGGCGGGAGGCCGG - Intergenic
903638152 1:24834812-24834834 CGGGAGAGGGAGAGGGAGACGGG + Intronic
903638158 1:24834831-24834853 CGGGAGAGGGAGAGGGAGACGGG + Intronic
903638164 1:24834850-24834872 CGGGAGAGGGAGAGGGAGACGGG + Intronic
903638174 1:24834882-24834904 CGGGAGAGGGAGAGGGAGACGGG + Intronic
903638192 1:24834939-24834961 CGGGAGAGGGAGAGGGAGACGGG + Intronic
903638202 1:24834971-24834993 CGGGAGAGGGAGAGGGAGACGGG + Intronic
903921806 1:26804866-26804888 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
903921812 1:26804885-26804907 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
904754387 1:32760172-32760194 AGGAGTAGGGAGTTGGGGGCTGG + Intronic
905684140 1:39896745-39896767 CAGCATTGGGAGTGGGAGGAAGG + Exonic
909001842 1:70226788-70226810 GGGAAGCTGGAGTGGGAGGCTGG + Intronic
910180916 1:84481565-84481587 GAGAATGGGGAGTGGGAGGACGG + Intronic
910514917 1:88049557-88049579 CTGAATTGGGAGTGCGGGGCTGG - Intergenic
911358200 1:96846644-96846666 TGGAATAGGGATGGGGAGGGAGG + Intergenic
912253284 1:108032876-108032898 GACAATAGGGAGTGAGAGGCAGG - Intergenic
912451326 1:109769354-109769376 GAGAAGAGGGATTGGGAGGCAGG + Intronic
912487332 1:110039534-110039556 CTGAGTAGGGAAGGGGAGGCTGG + Intronic
912504497 1:110146882-110146904 TGGAATAGGCAGTTGGGGGCGGG + Intergenic
912560998 1:110551487-110551509 GGGAAGAGGGAGTGGGAGGGAGG + Intergenic
914908607 1:151766985-151767007 CAGAATAGGGGGTGGAAAGCTGG + Intronic
915545926 1:156597795-156597817 AGCAATAGGGCGTGGGAGGTAGG - Intronic
915558936 1:156675471-156675493 GGGAATAGGGTAGGGGAGGCGGG - Intronic
916606012 1:166343137-166343159 CGGCATGGGGAGTGGGGAGCAGG + Intergenic
918244451 1:182646616-182646638 TGGCATTGGGGGTGGGAGGCTGG - Intronic
918420491 1:184359858-184359880 GGGAAGGAGGAGTGGGAGGCGGG - Intergenic
919771204 1:201160102-201160124 CGCAGTAGTGAGTAGGAGGCAGG + Intronic
919830619 1:201538402-201538424 GGGACTTGGGAGTGGGAGGAGGG - Intergenic
919884181 1:201920730-201920752 TAGAATAGGGGGTGGGAGGCTGG + Intronic
919886988 1:201941885-201941907 GGGAGAAGGGAGGGGGAGGCAGG + Intronic
920365719 1:205447470-205447492 TGGAACAGGGAGTAGGAGGCGGG + Intronic
923010360 1:230083374-230083396 CGGAGCAGGGAGTGGGATGATGG + Intronic
923151979 1:231241508-231241530 AGGAATAGGGACTGGGAGAAAGG - Intronic
923300492 1:232635719-232635741 ATGAATAGGGAGTGGGTGGATGG + Intergenic
923536656 1:234857782-234857804 GGGAGTAGGGAGAGGGTGGCTGG + Intergenic
923774417 1:236965878-236965900 AGGAAGGGGGAGTGGGAGGGAGG - Intergenic
924328298 1:242917778-242917800 GAGAATAGGGAGTGGGAGAAGGG - Intergenic
924837816 1:247672152-247672174 CAGAATAGGGAGATGCAGGCAGG - Exonic
1063096221 10:2911368-2911390 CCAAGTAGGGAGCGGGAGGCAGG + Intergenic
1063731172 10:8698880-8698902 GAGAGTAGGGAGTGGGAGGAGGG - Intergenic
1064161448 10:12950088-12950110 CAGGAAAGGGAATGGGAGGCTGG - Intronic
1065728754 10:28691662-28691684 GGGAAGAGGGAGAGGGAGGGAGG - Intergenic
1065840140 10:29695785-29695807 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1065840150 10:29695817-29695839 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1065840164 10:29695861-29695883 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1065840170 10:29695880-29695902 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1065840176 10:29695899-29695921 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1065894000 10:30145414-30145436 GGGAAGAGGCAGTGGGAGGCAGG + Intergenic
1066085114 10:31968974-31968996 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1066085120 10:31968993-31969015 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1066085126 10:31969012-31969034 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1066085132 10:31969031-31969053 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1066085138 10:31969050-31969072 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1066085144 10:31969069-31969091 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1066085150 10:31969088-31969110 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1067097874 10:43314410-43314432 GGGACGAGGGTGTGGGAGGCAGG - Intergenic
1067699160 10:48556171-48556193 AGGTATAGGGACGGGGAGGCTGG + Intronic
1067699833 10:48562628-48562650 GGGCAAAGGGAGTGGGAGGAGGG + Intronic
1067781694 10:49212412-49212434 GGGAGTAGGGAGAGGGAGGCAGG - Intergenic
1067925531 10:50504595-50504617 GGTAATAGGGAGGGAGAGGCAGG + Intronic
1068543178 10:58319110-58319132 TGGAATAGGGAGTGGGGAGAGGG - Intergenic
1068832148 10:61507589-61507611 CAGAAGAGGTAGTGGGAGGCAGG + Intergenic
1069145293 10:64885471-64885493 GGTAGTAGGGAGTGGGAGTCAGG - Intergenic
1069749144 10:70734575-70734597 CGGAATTGGGAGTGTGCTGCTGG - Intronic
1069773928 10:70916009-70916031 CGGGTCAGGGAGAGGGAGGCTGG + Intergenic
1070248397 10:74752690-74752712 CAGGATGGGCAGTGGGAGGCTGG - Intergenic
1070835735 10:79445793-79445815 CGGGGCAGGGAGTGGGCGGCGGG - Intergenic
1072999472 10:100276385-100276407 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1072999478 10:100276404-100276426 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1072999484 10:100276423-100276445 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1072999490 10:100276442-100276464 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1072999496 10:100276461-100276483 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1073063765 10:100746617-100746639 CTGACTAGGGAGAGGGTGGCTGG - Intronic
1073486701 10:103823786-103823808 GAGCCTAGGGAGTGGGAGGCAGG + Intronic
1073928560 10:108546186-108546208 AGGAGTAGGGAGTGGGAGGCTGG + Intergenic
1075341265 10:121648440-121648462 CAGACTAGGTAGTAGGAGGCAGG - Intergenic
1075949640 10:126465982-126466004 AGGAATTGGGAGTGGAAGACAGG + Intronic
1076612722 10:131736748-131736770 CGGACTTGAGGGTGGGAGGCTGG - Intergenic
1076912603 10:133399243-133399265 CAGAGCTGGGAGTGGGAGGCGGG + Intronic
1077133672 11:987802-987824 TGCGTTAGGGAGTGGGAGGCGGG + Intronic
1077364375 11:2155612-2155634 CGGAGGAGCGCGTGGGAGGCCGG + Intronic
1081910356 11:46696253-46696275 AGGAATAGGGACAGGGAGCCTGG - Intronic
1082000160 11:47389771-47389793 GGGACAAGGGTGTGGGAGGCTGG - Intergenic
1082769066 11:57191738-57191760 AGGGATAGGGAGAGGGAGGGAGG + Intergenic
1083865269 11:65450348-65450370 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1083865275 11:65450367-65450389 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1084149780 11:67282693-67282715 AGGAATGGGGAAAGGGAGGCAGG - Intronic
1085116908 11:73937715-73937737 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1085458330 11:76678320-76678342 CCGAAGAGGGAGTGAGAGCCGGG - Intergenic
1085754223 11:79190845-79190867 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1085754229 11:79190864-79190886 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1085754235 11:79190883-79190905 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1085754241 11:79190902-79190924 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1085754247 11:79190921-79190943 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1085754253 11:79190940-79190962 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1085754261 11:79190966-79190988 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1085754267 11:79190985-79191007 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1085754273 11:79191004-79191026 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1085754279 11:79191023-79191045 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1085754285 11:79191042-79191064 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1085754291 11:79191061-79191083 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1087313739 11:96581297-96581319 CAGAAAAGGGAGTGAGAGCCAGG + Intergenic
1087872515 11:103314160-103314182 CAGAATAGAAAGTGGGTGGCAGG - Intronic
1088531893 11:110819479-110819501 GGGAGTAGGGATTGGGAGGAGGG + Intergenic
1089375107 11:117988513-117988535 GGGAAGAGGGAGGGGGAGGGAGG + Intronic
1090764145 11:129862573-129862595 CGGAGGAGGGTCTGGGAGGCTGG - Intergenic
1091077491 11:132633889-132633911 AGAAATCGGGGGTGGGAGGCTGG + Intronic
1091145424 11:133275110-133275132 CAGCAAAGGGGGTGGGAGGCTGG + Intronic
1091254556 11:134172409-134172431 CGGAATGGGGTGAGGGAGTCAGG - Intronic
1091378387 12:41224-41246 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1091378393 12:41243-41265 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1091378399 12:41262-41284 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1091666791 12:2424695-2424717 TGGAATTGGGAGAGGGAGGCAGG - Intronic
1092233836 12:6793209-6793231 CAGAACAGGGAGCTGGAGGCAGG + Intronic
1092810227 12:12266248-12266270 CGGGGTGGGGAGTGGGTGGCGGG + Intronic
1093210495 12:16302442-16302464 AGAAGTAGAGAGTGGGAGGCTGG + Intergenic
1093380568 12:18486738-18486760 CGGAATAGGGAGTGGATCGATGG - Intronic
1093516329 12:19990808-19990830 CTTAAGAGGGAGAGGGAGGCAGG + Intergenic
1093736542 12:22625871-22625893 TGGACTGGGGAGTGGGAGGAGGG - Intronic
1095889620 12:47223383-47223405 CGGAGGAGTGAGTGGGAGGTGGG + Intronic
1096105462 12:48994919-48994941 CGGAATGGGGGGTGGGGGGAGGG + Intergenic
1096389107 12:51215691-51215713 CAGAAGAGAGAGTGGGATGCAGG - Intronic
1096524229 12:52201059-52201081 AGGGATAGGAAGCGGGAGGCTGG - Intergenic
1096616348 12:52835343-52835365 GTGAATAGGAAGTGGGCGGCGGG - Intergenic
1096713381 12:53475021-53475043 CGGAAGAGGGTTGGGGAGGCTGG - Intronic
1097142188 12:56911294-56911316 AGGAATGGGGAAAGGGAGGCAGG - Intergenic
1098247183 12:68532131-68532153 CAGATTGGGGAGAGGGAGGCAGG + Intergenic
1100398181 12:94203022-94203044 AGGAACAGGAAGTGGGAAGCGGG + Intronic
1100471370 12:94896328-94896350 CAGAATAGGGAAGGGGTGGCAGG + Intergenic
1100570930 12:95842367-95842389 CGGGAAAGGGAGAGGGAGACGGG + Intergenic
1100570936 12:95842386-95842408 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1100570942 12:95842405-95842427 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1100570948 12:95842424-95842446 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1100570954 12:95842443-95842465 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1100570960 12:95842462-95842484 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1100570966 12:95842481-95842503 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1100570972 12:95842500-95842522 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1100570978 12:95842519-95842541 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1101575315 12:105991842-105991864 CTGAACAGGGAGTGGGAAGATGG - Intergenic
1102596141 12:113993906-113993928 CTGAGTAGGGGGTGGGAGGGAGG - Intergenic
1102887569 12:116533492-116533514 CGGGATAGGGAGGCGGGGGCTGG + Intergenic
1102908447 12:116694873-116694895 AGGAAGAGGGAGGAGGAGGCAGG + Intergenic
1104281438 12:127381474-127381496 TGGGATAAGGGGTGGGAGGCAGG + Intergenic
1104608436 12:130206743-130206765 CGTAATAGAGAGAGGAAGGCAGG + Intergenic
1105249483 13:18685074-18685096 AGGAATAGGGAGAAAGAGGCAGG - Intergenic
1105847759 13:24308110-24308132 CGGAATGGGGAGCGCGTGGCCGG + Intronic
1106293396 13:28387644-28387666 TGGAACAGGGGGTGTGAGGCTGG - Intronic
1106994943 13:35470739-35470761 CGGAGGAGGGCGCGGGAGGCAGG + Intronic
1107562514 13:41571306-41571328 CGGGAGAGGGAGAGGGAGGAGGG - Intronic
1107562521 13:41571325-41571347 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1107744813 13:43493150-43493172 CAGGAGAGGGAGTGGGAGGGGGG - Intronic
1107789904 13:43991302-43991324 AGGAATAGGGAGTGGGTGGGAGG + Intergenic
1108217112 13:48196279-48196301 GGGAATAGGGAGTGATAGGTAGG - Intergenic
1112505354 13:99971470-99971492 CGGAGTTGGGAGTGGGCGGGCGG + Exonic
1113346390 13:109482526-109482548 GGGAAGAGGGAGAGGGAAGCAGG + Intergenic
1114206747 14:20579168-20579190 AGGAATATGAGGTGGGAGGCAGG - Intergenic
1114458577 14:22872610-22872632 CGGAAGAGGGAGTGGGGGGCGGG - Intronic
1115525582 14:34277258-34277280 CTTTTTAGGGAGTGGGAGGCAGG - Intronic
1118341424 14:64896672-64896694 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1118341430 14:64896691-64896713 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1118341436 14:64896710-64896732 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1118341442 14:64896729-64896751 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1118341448 14:64896748-64896770 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1118341454 14:64896767-64896789 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1118341460 14:64896786-64896808 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1118430360 14:65713046-65713068 TGGAAAAGGTAGTGGGAGGTGGG - Intronic
1119266211 14:73264528-73264550 AGGAAAAGGGAGTGGAAGGAAGG - Intronic
1121272967 14:92650277-92650299 CGGATTGGGGAGTGAGACGCTGG - Intronic
1121637184 14:95461822-95461844 CAGAGCAGGGACTGGGAGGCTGG + Intronic
1122280768 14:100620984-100621006 GGGGATAGGGAGGTGGAGGCTGG - Intergenic
1123129274 14:105972436-105972458 GGGAAAAGGGAGAGGGAAGCAGG + Intergenic
1123409789 15:20048603-20048625 GGGAAAAGGGAGAGGGAAGCAGG + Intergenic
1123519121 15:21055311-21055333 GGGAAAAGGGAGAGGGAAGCAGG + Intergenic
1125604202 15:40930764-40930786 CGGGCTTGGGGGTGGGAGGCAGG + Intronic
1127845712 15:62868763-62868785 CCAAATAAGGAGTTGGAGGCCGG - Intergenic
1128317420 15:66669940-66669962 CTGAATATGGAGTGGGCGGTGGG + Intronic
1130721060 15:86386166-86386188 AGGAAGAGGGAGGGGGAGGAGGG - Intronic
1131401811 15:92131334-92131356 AGGAATAGGGAGGTTGAGGCTGG - Intronic
1132265854 15:100470181-100470203 GGGAATAGGGAGTGGGAGTCTGG + Intronic
1132664723 16:1076199-1076221 GGGGAGAGGGAGGGGGAGGCGGG - Intergenic
1133702154 16:8318743-8318765 CAGAATAGAGGGTGGGAGGAGGG - Intergenic
1134113494 16:11530992-11531014 AGGAAGAGGAGGTGGGAGGCTGG - Intergenic
1135784270 16:25334580-25334602 AGGAATGGGGAGTGGGGGACGGG + Intergenic
1135993727 16:27232803-27232825 GTGAACGGGGAGTGGGAGGCAGG + Intronic
1136339603 16:29633433-29633455 CTGAAAAGGCAGTGGGTGGCGGG + Intergenic
1136392396 16:29973886-29973908 AGGAAGAGGGAGAGGGAGACCGG + Exonic
1136515551 16:30766144-30766166 CAAACTAAGGAGTGGGAGGCAGG - Exonic
1136865127 16:33743179-33743201 GGGAAGAGGGATTGTGAGGCAGG - Intergenic
1136871018 16:33808432-33808454 GGGAAAAGGGAGAGGGAAGCAGG - Intergenic
1138133962 16:54505309-54505331 AGGAGAAGGGAGTGGGAGGCAGG + Intergenic
1138351878 16:56350374-56350396 CTGCACAGGGAGTGGGAGGAAGG - Intronic
1139341217 16:66269433-66269455 AGGAAGAGGAACTGGGAGGCTGG + Intergenic
1140195039 16:72848637-72848659 TGGCATAGGGGGTGGGAGGGGGG - Intronic
1140818227 16:78639928-78639950 CTGTGGAGGGAGTGGGAGGCAGG + Intronic
1141713771 16:85715423-85715445 CTGAACAGCTAGTGGGAGGCAGG + Intronic
1142059649 16:88021099-88021121 CGGAGAGGGGAGTGGGAGCCTGG + Intronic
1203101154 16_KI270728v1_random:1307626-1307648 GGGAAAAGGGAGAGGGAAGCAGG + Intergenic
1203126496 16_KI270728v1_random:1589447-1589469 GGGAAGAGGGATTGTGAGGCAGG - Intergenic
1142696727 17:1638140-1638162 TGGAACAGGGAGTGTGGGGCCGG - Intronic
1143026237 17:3943537-3943559 GGGGATAGGGAGTGAGGGGCAGG + Intronic
1144058665 17:11562251-11562273 AGGAATATGAAGTTGGAGGCTGG - Exonic
1144453881 17:15403422-15403444 GAGAATAGGGAGAGGGTGGCTGG - Intergenic
1145733431 17:27211256-27211278 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1145733448 17:27211313-27211335 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1145733462 17:27211357-27211379 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1145733468 17:27211376-27211398 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1145733474 17:27211395-27211417 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1146288031 17:31587635-31587657 TGGCATGGGGACTGGGAGGCAGG - Intergenic
1147316270 17:39621904-39621926 TGGTGGAGGGAGTGGGAGGCGGG + Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148760322 17:49996612-49996634 CAAAATGGGGTGTGGGAGGCAGG - Intergenic
1150150648 17:62806568-62806590 AGGAGGAGGGAGTTGGAGGCAGG + Intronic
1150455469 17:65303689-65303711 AGGAGTAGGGGGTGGGAGGGAGG + Intergenic
1150479640 17:65499396-65499418 CGGGTTAGGGAGCAGGAGGCTGG - Intergenic
1150621031 17:66807811-66807833 CTGAGAAGGGAGAGGGAGGCGGG + Exonic
1151482676 17:74379619-74379641 CGGGCCAGGGAGTGGGAGGGCGG + Intergenic
1151490771 17:74431318-74431340 CGGAACAGGGAGTGGGGGGTGGG + Exonic
1152120040 17:78412941-78412963 GGGAAGAGGGGGTGGGAGGGGGG + Intronic
1152817802 17:82418544-82418566 CGTAACAGGGAGCGCGAGGCAGG + Exonic
1152859082 17:82685211-82685233 AGGAATGGGGAGGGGGAGGGAGG + Intronic
1154132941 18:11751816-11751838 CGGGGAAGGGAGAGGGAGGCTGG - Intronic
1154439350 18:14373827-14373849 AGGAATAGGGAGAAAGAGGCAGG + Intergenic
1154477623 18:14779067-14779089 AGGAAGAGGGATTGTGAGGCAGG + Intronic
1156675989 18:39528092-39528114 CAGAAGGGGGTGTGGGAGGCAGG - Intergenic
1157865876 18:51184197-51184219 TTGAGTAGGGAGTGGGAGGTGGG - Intronic
1158427260 18:57351844-57351866 CGGAAAGGGGAGAGGAAGGCAGG + Exonic
1158620731 18:59030492-59030514 CAGCATAGGTAGTGAGAGGCCGG + Intergenic
1159810119 18:73008478-73008500 GGGTATAGGGAGTGGGAGTTAGG - Intergenic
1160011519 18:75110061-75110083 GGGAGGAGGGAGAGGGAGGCTGG + Intergenic
1160529237 18:79553879-79553901 CGGGAACGGGAGCGGGAGGCCGG - Intergenic
1161251769 19:3284628-3284650 CGGGATAGGGAGAGGGAGATGGG + Intronic
1162133554 19:8542154-8542176 CAGAATAGGGGATGGGGGGCGGG + Intronic
1163029915 19:14537262-14537284 GGGACCAGGGAGGGGGAGGCGGG + Intronic
1163029925 19:14537282-14537304 GGGACCAGGGAGGGGGAGGCGGG + Intronic
1163103155 19:15109469-15109491 GGGAGGAGGGAGTGTGAGGCTGG - Intronic
1163316283 19:16542530-16542552 CGGAAGTGAGAGCGGGAGGCAGG + Exonic
1163478241 19:17539472-17539494 CGGGATAGGGGGCGGGATGCGGG + Intronic
1163776992 19:19224674-19224696 GGGGATAGGGACAGGGAGGCAGG - Intronic
1164066236 19:21720258-21720280 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1164066242 19:21720277-21720299 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1164066248 19:21720296-21720318 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1164066254 19:21720315-21720337 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1164066260 19:21720334-21720356 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1164066266 19:21720353-21720375 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1164713654 19:30376413-30376435 TGGTATAAGTAGTGGGAGGCAGG - Intronic
1165418697 19:35711619-35711641 GGAAAGAGAGAGTGGGAGGCTGG + Intronic
1165433554 19:35785100-35785122 CGGAAAGGTGAGTGGGATGCTGG + Exonic
1167250513 19:48396387-48396409 CTCAGTAGGGAGTGGGACGCGGG + Intronic
1167327985 19:48836840-48836862 GGGAGGAGGGACTGGGAGGCTGG - Intergenic
1168414659 19:56160509-56160531 TGGAGGAGGGAGAGGGAGGCTGG - Exonic
925163265 2:1701607-1701629 CGGAATGGGGTGGGGGACGCAGG + Intronic
926418151 2:12671144-12671166 CTGAATCAGGAGTGGGAGGATGG - Intergenic
927023502 2:19041905-19041927 CAGAATTGGGAGTGGGAGTTAGG - Intergenic
927134811 2:20089025-20089047 AGGAAGAGGGAGTTGGAGACAGG - Intergenic
927149264 2:20186353-20186375 GGGGATGGGGAGTGGGAGCCAGG - Intergenic
927790158 2:26003331-26003353 GGTAATTGGGAGTGAGAGGCCGG - Intergenic
927857174 2:26535054-26535076 CTGAACAGGGAATGGGAGGGTGG + Intronic
928611029 2:32992872-32992894 GGGAGTAGGGAGTGGGAAACAGG + Intronic
929533206 2:42764905-42764927 CGGAATAGGGAGTGGGAGGCTGG + Intergenic
930105915 2:47639312-47639334 AGAACTAGGGAGTGGGAGGGGGG + Intergenic
930209010 2:48615484-48615506 CGGGAGAGGGAGAGGGAGACGGG + Intronic
930209016 2:48615503-48615525 CGGGAGAGGGAGAGGGAGACGGG + Intronic
930209022 2:48615522-48615544 CGGGAGAGGGAGAGGGAGACGGG + Intronic
930277963 2:49335757-49335779 AGGAACAGGGAGGGGGACGCTGG + Intergenic
931751864 2:65338174-65338196 CGGGAGAGGGAGAGGGAGACGGG - Intronic
931751870 2:65338193-65338215 CGGGAGAGGGAGAGGGAGACGGG - Intronic
931751876 2:65338212-65338234 CGGGAGAGGGAGAGGGAGACGGG - Intronic
931751886 2:65338244-65338266 CGGGAGAGGGAGAGGGAGACGGG - Intronic
931751892 2:65338263-65338285 CGGGAGAGGGAGAGGGAGACGGG - Intronic
931751898 2:65338282-65338304 CGGGAGAGGGAGAGGGAGACGGG - Intronic
931765367 2:65451400-65451422 GGGAAGTGGGAGTGGGAGCCAGG + Intergenic
932397889 2:71460653-71460675 CAGACTAGGAAGTTGGAGGCTGG + Intronic
932625102 2:73291293-73291315 CTGAATAGGGCGTGTGCGGCGGG + Exonic
933586740 2:84187334-84187356 TGGAATAGTGAGTGAGAGGAAGG - Intergenic
934115212 2:88783380-88783402 AGGAAGAGGGATTGTGAGGCAGG + Intergenic
934628367 2:95885574-95885596 AGGAAGAGGGATTGTGAGGCAGG - Intronic
934628494 2:95887450-95887472 AGGAAGAGGGATTGTGAGGCAGG - Intronic
934628619 2:95889325-95889347 AGGAATAGGGATTGTGAGTCAGG - Intronic
934631066 2:95923021-95923043 AGGAAGAGGGATTGTGAGGCAGG - Intronic
934633516 2:95958114-95958136 GGGAAGAGGGATTGTGAGGCAGG - Intronic
934633642 2:95959996-95960018 GGGAAGAGGGATTGTGAGGCAGG - Intronic
934768811 2:96895112-96895134 CGGGAAGGGGAGTGGAAGGCAGG - Intronic
934802593 2:97180388-97180410 AGGAAGAGGGATTGTGAGGCAGG + Intronic
934804913 2:97212193-97212215 AGGAATAGGGATTGTGAGTCAGG + Intronic
934805033 2:97214067-97214089 AGGAAGAGGGATTGTGAGGCAGG + Intronic
934805157 2:97215949-97215971 AGGAAGAGGGATTGTGAGGCAGG + Intronic
934832326 2:97541437-97541459 AGGAAGAGGGATTGTGAGGCAGG - Intronic
934832450 2:97543313-97543335 AGGAAGAGGGATTGTGAGGCAGG - Intronic
934832568 2:97545192-97545214 AGGAATAGGGATTGTGAGTCAGG - Intronic
934833603 2:97560188-97560210 AGGAAGAGGGATTGTGAGGCAGG - Intronic
934955498 2:98614330-98614352 AGGAAGAGGGAGTGGGTGGGAGG + Intronic
935496221 2:103784480-103784502 CTGACTAGGAGGTGGGAGGCGGG + Intergenic
938115913 2:128602836-128602858 CGGAACAGGGAGAGGGACGTTGG + Intergenic
938953339 2:136277211-136277233 GGGGATAGGGGGTGGGAGGAGGG + Intergenic
939103605 2:137924544-137924566 AGGAATAGGGAGAAAGAGGCAGG - Intergenic
941568304 2:167137170-167137192 TGTAATTTGGAGTGGGAGGCAGG + Intronic
941911817 2:170771210-170771232 CGGGCTAGGGAGAGGGAGACCGG - Intergenic
942749782 2:179274734-179274756 GGGAAAAGGGAATGGGAGGAGGG + Intergenic
943180943 2:184540340-184540362 AGGAAGAGAGAGTGGGAGGGAGG + Intergenic
943773168 2:191741099-191741121 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
943773174 2:191741118-191741140 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
943773195 2:191741182-191741204 CGGGAGAGGGAGAGGGAGACAGG - Intergenic
943773200 2:191741201-191741223 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
943931406 2:193858275-193858297 TGCTATAGGGAGAGGGAGGCTGG - Intergenic
945058107 2:205885689-205885711 CGGCAGAGGGTGTGGGAGGGAGG - Intergenic
945090548 2:206172610-206172632 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945090554 2:206172629-206172651 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945090560 2:206172648-206172670 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945090566 2:206172667-206172689 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945090572 2:206172686-206172708 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945090578 2:206172705-206172727 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945090616 2:206172823-206172845 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945090662 2:206172967-206172989 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945090668 2:206172986-206173008 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945090678 2:206173018-206173040 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945090688 2:206173050-206173072 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945090694 2:206173069-206173091 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945090700 2:206173088-206173110 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945090706 2:206173107-206173129 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945196895 2:207245333-207245355 CTGAAGAGGGAGTGGGAGTTAGG - Intergenic
945970615 2:216227547-216227569 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945970621 2:216227566-216227588 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945970627 2:216227585-216227607 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945970633 2:216227604-216227626 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945970643 2:216227636-216227658 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945970649 2:216227655-216227677 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945970655 2:216227674-216227696 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945970661 2:216227693-216227715 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945970667 2:216227712-216227734 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945970673 2:216227731-216227753 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945970679 2:216227750-216227772 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
946338870 2:219056000-219056022 CTGCATAGGAAGTGGGGGGCAGG - Intronic
948124999 2:235558077-235558099 CGGGATGGCGAGTAGGAGGCTGG + Intronic
948350459 2:237335954-237335976 CAGGATGGGGAGTGGGAGGCTGG + Intronic
948563170 2:238867238-238867260 AGAAAGAGGGAGAGGGAGGCAGG + Intronic
1169085318 20:2822528-2822550 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085340 20:2822598-2822620 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085346 20:2822617-2822639 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085352 20:2822636-2822658 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085358 20:2822655-2822677 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085364 20:2822674-2822696 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085370 20:2822693-2822715 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085376 20:2822712-2822734 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085382 20:2822731-2822753 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085388 20:2822750-2822772 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085394 20:2822769-2822791 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085400 20:2822788-2822810 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085406 20:2822807-2822829 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085412 20:2822826-2822848 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085418 20:2822845-2822867 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085424 20:2822864-2822886 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085430 20:2822883-2822905 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085436 20:2822902-2822924 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085442 20:2822921-2822943 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085448 20:2822940-2822962 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085454 20:2822959-2822981 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085460 20:2822978-2823000 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169300856 20:4440891-4440913 TGGAATAGGGATGGGTAGGCTGG + Intergenic
1171488422 20:25500060-25500082 GGGAATAGGGAGAGGGGGGCAGG + Intronic
1173615422 20:44400328-44400350 CGAAACAGGGAGAGGGAGGAGGG + Intronic
1173872788 20:46352238-46352260 AGGGAGAGAGAGTGGGAGGCCGG + Intronic
1174803054 20:53581386-53581408 GGGAATAGAGAGGGGGAGACGGG + Intronic
1175442461 20:59001410-59001432 TGGAAGAGGGAGTGGAGGGCAGG + Intronic
1175822330 20:61917136-61917158 TGGAATTGGGAGTGTGGGGCAGG - Intronic
1175853256 20:62104908-62104930 GGGAAGAGGAGGTGGGAGGCAGG + Intergenic
1176282601 20:64322746-64322768 GGGAAGAGGGAGCTGGAGGCTGG + Intergenic
1176289869 21:5038099-5038121 CAGCATGGGGAGTGGGAGGGGGG - Intronic
1176456333 21:6915581-6915603 AGGAATAGGGAGAAAGAGGCAGG - Intergenic
1176834507 21:13780641-13780663 AGGAATAGGGAGAAAGAGGCAGG - Intergenic
1179073761 21:38098700-38098722 CAGGAAAGGGAGTAGGAGGCAGG - Intronic
1179195025 21:39156588-39156610 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1179867382 21:44225540-44225562 CAGCATGGGGAGTGGGAGGGGGG + Intronic
1180866760 22:19124220-19124242 CGTGATAGGAAGTGGGAGTCAGG - Intergenic
1180922515 22:19528346-19528368 CGGGTGAGGGAGTGGGGGGCAGG + Intergenic
1180960429 22:19759905-19759927 CGGAAGAGGGCGAGTGAGGCTGG + Intronic
1180975402 22:19845288-19845310 GGGCAGAGCGAGTGGGAGGCTGG - Intronic
1181179355 22:21055986-21056008 TGGAAAAGGGAGGGGCAGGCAGG - Intronic
1182550587 22:31098879-31098901 CGTGATAGGCAGTGGGGGGCGGG + Intronic
1182905282 22:33930779-33930801 CGGAGTGGGGGGTGGGAGGAAGG - Intergenic
1183346249 22:37309959-37309981 CGGAAGTGTGTGTGGGAGGCAGG - Intronic
1183380781 22:37489531-37489553 TGGAGTAGGGGGTGGGGGGCAGG - Intergenic
1183641749 22:39097048-39097070 GGGAATTGGGGGTGGGAGGATGG + Intergenic
1183871898 22:40746386-40746408 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1183871904 22:40746405-40746427 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1183871910 22:40746424-40746446 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1183871924 22:40746468-40746490 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1183871930 22:40746487-40746509 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1183871936 22:40746506-40746528 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1183871942 22:40746525-40746547 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1183871948 22:40746544-40746566 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1183871954 22:40746563-40746585 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1183871964 22:40746595-40746617 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1184246968 22:43240748-43240770 CTGGATTGGGAGTGGGAGGCAGG - Intronic
1184246982 22:43240789-43240811 TGGATTCGGGCGTGGGAGGCAGG - Intronic
1184581414 22:45420382-45420404 CGGAATGTGGGGTGGGAGGAGGG - Intronic
1184766546 22:46575518-46575540 CAGAGTAGGGAGCGGTAGGCAGG + Intergenic
1184880786 22:47303120-47303142 CTGAGTAGAGGGTGGGAGGCTGG + Intergenic
1185098545 22:48825252-48825274 CAGAGAAGGGAGTGAGAGGCAGG + Intronic
1185371129 22:50461433-50461455 GAGAAAAGGGAGAGGGAGGCAGG + Intronic
950664043 3:14484124-14484146 TGGACTGGGGAGTGGGAGTCTGG + Intronic
950790892 3:15470915-15470937 CAGAACAGGCAGTGAGAGGCTGG + Intronic
953236820 3:41114155-41114177 TGGCATAGGGAGAAGGAGGCTGG + Intergenic
953391955 3:42539138-42539160 CCAAGTAGGGAGTGGGAGGAGGG - Intergenic
953738399 3:45515567-45515589 AAGAATAGGGTGTGGGTGGCTGG + Intronic
954115389 3:48464371-48464393 CAGAATAGGGGGCTGGAGGCAGG + Intronic
954632001 3:52052794-52052816 GGGAATAGAGAGAGGGAAGCAGG - Intronic
955424682 3:58776036-58776058 CAGAAAAGGGAGAGGAAGGCTGG - Intronic
956630286 3:71310607-71310629 CGGAACATGGAGAGGGAGGCAGG - Intronic
959614490 3:108331843-108331865 TAGAATGGGGAGGGGGAGGCAGG - Intronic
960357462 3:116671094-116671116 GGGAAGAGGGAGGAGGAGGCAGG + Intronic
960496371 3:118380352-118380374 AGGAAAAGGAAGGGGGAGGCAGG + Intergenic
961052889 3:123762113-123762135 TGGAAATGGGAGTGGGAGGGCGG - Intronic
961149125 3:124621446-124621468 TGGCATAGTAAGTGGGAGGCAGG + Intronic
961775205 3:129279231-129279253 CGGACTAGCGGGCGGGAGGCGGG + Intronic
961821062 3:129575861-129575883 GGAAACAGGGAGTGGGAGGCGGG + Intronic
963299279 3:143580912-143580934 AGGTATAGGAAGTGGGAGGCAGG + Intronic
963796476 3:149635603-149635625 CGGAAGAGGGAGGAGGAGGAAGG + Intronic
965620973 3:170642077-170642099 GGGAAGAGGGAATGGGAAGCAGG - Intronic
967512548 3:190328580-190328602 AGGAATAGAGTGTGGTAGGCTGG + Intronic
968222656 3:196949759-196949781 GGGAAGAGTGTGTGGGAGGCGGG + Intronic
969328766 4:6460912-6460934 CGGGATGGGAAGTGGGAGGCAGG - Intronic
971413152 4:26396646-26396668 CCTATTTGGGAGTGGGAGGCGGG + Intronic
972886903 4:43503612-43503634 GGGAATAGGGAGTGGGAAAGTGG - Intergenic
973806133 4:54527714-54527736 GGGGATAGGGGGTGGGAGGAGGG + Intergenic
974590738 4:63944687-63944709 GAGAGTAGGGAGTGGGAGGAGGG - Intergenic
974914431 4:68162304-68162326 TGGAATAGGGTGCTGGAGGCAGG - Intergenic
977152289 4:93527860-93527882 GGGAAGAGGGAATGGGAGGAGGG - Intronic
978416724 4:108484621-108484643 CGGAAGGGGCTGTGGGAGGCAGG + Intergenic
979857588 4:125652339-125652361 AGGAATAGGGAGATGGAGACAGG - Intergenic
982076897 4:151746800-151746822 GGGAACAGGGAGATGGAGGCAGG + Intronic
982806945 4:159777887-159777909 AGGAAGTGGGAGTGGGAGGGAGG - Intergenic
983924200 4:173379938-173379960 GGGAATAGGGAGAGGGAAGAAGG - Intergenic
986899698 5:12416297-12416319 AGGAATAGGAAGGAGGAGGCTGG + Intergenic
987064598 5:14276607-14276629 GGGAGTTGGGAGTGGGAGGTTGG + Intronic
987976588 5:25022484-25022506 AGAAATAGGGAGAGGAAGGCTGG + Intergenic
990911299 5:60855047-60855069 AGGAATGGGAAGTGGGAGGAGGG - Intergenic
991550604 5:67831806-67831828 AGGAATGGCGAGTGGGGGGCGGG + Intergenic
992350153 5:75920621-75920643 CTGCATAGGGAGTGGGTGGTGGG + Intergenic
992856312 5:80865192-80865214 AGGAATAGGGTGTGGGTGGAGGG + Intronic
993678142 5:90842470-90842492 CGGGATTGGGAGGCGGAGGCAGG + Intronic
996205866 5:120734284-120734306 GGGAAGAGGGAGCAGGAGGCTGG + Intergenic
996423315 5:123285762-123285784 GGGAAGAGGGAGAGGGAGTCGGG - Intergenic
997093682 5:130886386-130886408 CAGAAAAGGGAGGGGGAGGAGGG - Intergenic
997582948 5:135028625-135028647 CGGAGTGGGAAGTGGGAGGAGGG + Exonic
997989229 5:138530216-138530238 CTGAATAGGGAGAGTGAGGGTGG + Intronic
999429423 5:151512968-151512990 AGGAAGTGGGAGTGGGAGACAGG - Intronic
999441544 5:151604910-151604932 GGAGATTGGGAGTGGGAGGCAGG + Intergenic
1000071374 5:157743873-157743895 TGGGGTAGGGAATGGGAGGCAGG - Exonic
1001477670 5:172062222-172062244 AGGAATAGGGAGGCCGAGGCGGG - Intronic
1001534217 5:172487431-172487453 CGGGATGGGGAGTGTGGGGCAGG + Intergenic
1001877307 5:175212776-175212798 CGTAAGAAGGAGTTGGAGGCCGG + Intergenic
1002186537 5:177457314-177457336 CGGAATCCGGAGTGGGTGCCAGG + Exonic
1002421236 5:179150169-179150191 AGGCAGAGGGAATGGGAGGCAGG - Intronic
1003894234 6:10591652-10591674 AGGAGGAGGGAGTGGGTGGCAGG - Intronic
1005015403 6:21370728-21370750 CTGAAAAGGCAGTGGGAGACTGG - Intergenic
1005836967 6:29717718-29717740 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1005836973 6:29717737-29717759 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1005836979 6:29717756-29717778 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1005836985 6:29717775-29717797 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1005836991 6:29717794-29717816 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1005836997 6:29717813-29717835 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1005837014 6:29717864-29717886 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1005837020 6:29717883-29717905 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1005837026 6:29717902-29717924 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1006886979 6:37390104-37390126 AGGAATAGGCAGGGAGAGGCGGG - Intronic
1006934111 6:37705514-37705536 CGTAAAAGGGGGTGGGGGGCGGG + Intergenic
1006937968 6:37731742-37731764 GGGAATAGAGGCTGGGAGGCAGG - Intergenic
1007159182 6:39775099-39775121 CCCATAAGGGAGTGGGAGGCTGG + Intergenic
1007371717 6:41430495-41430517 GGGAATGGGGAGTGGGAGGAAGG + Intergenic
1007782725 6:44263663-44263685 GGGAAGAGGAAGTGGGAGGAGGG - Intronic
1008926791 6:56896008-56896030 CGGGAGAGGGAGAGGGAGACGGG + Intronic
1008926797 6:56896027-56896049 CGGGAGAGGGAGAGGGAGACGGG + Intronic
1008926803 6:56896046-56896068 CGGGAGAGGGAGAGGGAGACGGG + Intronic
1008926809 6:56896065-56896087 CGGGAGAGGGAGAGGGAGACGGG + Intronic
1008926815 6:56896084-56896106 CGGGAGAGGGAGAGGGAGACGGG + Intronic
1008926821 6:56896103-56896125 CGGGAGAGGGAGAGGGAGACGGG + Intronic
1008926827 6:56896122-56896144 CGGGAGAGGGAGAGGGAGACGGG + Intronic
1008964309 6:57298884-57298906 GAGAATAGGGTGGGGGAGGCAGG - Intergenic
1010800481 6:80168725-80168747 AGGAAGAGGGGGAGGGAGGCAGG + Intronic
1011445250 6:87432461-87432483 AGGAATGGAGAGGGGGAGGCAGG - Intronic
1013207626 6:107958637-107958659 TAGAATAGGGGGTGGGAGGCCGG + Intergenic
1014764414 6:125390118-125390140 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1014764420 6:125390137-125390159 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1014764426 6:125390156-125390178 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1014764432 6:125390175-125390197 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1017711034 6:157168170-157168192 CGGAACAGCCAGTGAGAGGCTGG + Intronic
1018592468 6:165442513-165442535 CAGAAGAGGGAGTGCAAGGCGGG + Intronic
1019404821 7:877705-877727 GAGAACAGGGAGGGGGAGGCCGG - Intronic
1019508419 7:1404956-1404978 GGGAAGAGGGAGGGGGAGGAGGG + Intergenic
1019771765 7:2887828-2887850 TGGAAGAGGGGGTTGGAGGCCGG - Intergenic
1020830705 7:13091267-13091289 TGGAATGGGAAGTGGAAGGCAGG + Intergenic
1022009009 7:26292506-26292528 AGGAATTGGGAGGGGTAGGCAGG + Intronic
1023400795 7:39792223-39792245 CGAAAGAGGCACTGGGAGGCAGG - Intergenic
1023752352 7:43384762-43384784 CGTGAGAGGGAGTGGGTGGCTGG + Intronic
1023998773 7:45177755-45177777 CGGAATGGGGGGTAGGAAGCTGG - Intronic
1024571999 7:50730937-50730959 CTGAGTAGGAAGTGGCAGGCAGG + Intronic
1025198712 7:56949441-56949463 AGGAATAGGGAGAAGGAGGAGGG - Intergenic
1025673236 7:63627490-63627512 AGGAATAGGGAGAAGGAGGAGGG + Intergenic
1032084597 7:128877312-128877334 CTGCAGGGGGAGTGGGAGGCGGG + Intronic
1032094484 7:128931164-128931186 CGGGGTAGGGGGTGGCAGGCAGG + Intergenic
1032114049 7:129101950-129101972 GGGAATAGCGAGAGGAAGGCAGG + Intergenic
1034339446 7:150342121-150342143 TGGCTCAGGGAGTGGGAGGCAGG - Intergenic
1035861851 8:3037452-3037474 CGGTATAGGGAGGCCGAGGCGGG - Intronic
1037681549 8:21101861-21101883 CAGGGGAGGGAGTGGGAGGCAGG - Intergenic
1038349696 8:26764563-26764585 TGGAAAAAGGAGTCGGAGGCTGG + Intronic
1038533387 8:28336815-28336837 TGGTAGAGGGAGTGGGAGGAGGG + Intronic
1038611775 8:29065577-29065599 CTGAGAAGGGAGAGGGAGGCCGG - Intergenic
1040897905 8:52388380-52388402 TGGAAGTGGGAGTTGGAGGCGGG - Intronic
1041357859 8:57021180-57021202 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1041357865 8:57021199-57021221 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1042027845 8:64443106-64443128 CAGAATAAGGGGTGGGAGACAGG + Intergenic
1043697422 8:83237801-83237823 GGGAATGGGGAGTGGCAGGAGGG - Intergenic
1045347347 8:101305017-101305039 AGGAAGAGGGAGGGTGAGGCAGG + Intergenic
1046388830 8:113541008-113541030 AAGGATAGGGAGTGGGAGGTTGG - Intergenic
1048019810 8:130527862-130527884 GGGAATGGGGAGTGGGAGGGTGG + Intergenic
1048178441 8:132173406-132173428 TGGAAGAGGAAGTGGGTGGCAGG + Intronic
1048187836 8:132260578-132260600 AGGCATTGGGAGTGGGTGGCTGG + Intronic
1048777214 8:137960394-137960416 AGGAAGAGGGAGTGGGAGAGAGG - Intergenic
1049018705 8:139939491-139939513 GGGAATGGGGACTGGGAGGGTGG - Intronic
1049183474 8:141235635-141235657 CGGAAGAGGGAGAGAGGGGCAGG + Intronic
1049356738 8:142192850-142192872 ATGAAGAGGGAGTGGGAGGGAGG + Intergenic
1051504748 9:17814584-17814606 CTGAAAAGGAAGAGGGAGGCAGG + Intergenic
1052994524 9:34544124-34544146 CAGAAGAGGGAGAGGAAGGCAGG + Intergenic
1053004741 9:34596963-34596985 AGGGAGAGGGAGTGGGAGGTGGG + Intergenic
1053137058 9:35657872-35657894 CGGACTTTGGAGTGGGAAGCGGG + Intergenic
1053435325 9:38069868-38069890 CGGGATAGGCGGTGGGAGCCGGG + Intergenic
1056323285 9:85456722-85456744 CTGAATAGGGAGTGTGAGCTTGG + Intergenic
1056740986 9:89255274-89255296 GGGAATTGGAGGTGGGAGGCAGG - Intergenic
1056820730 9:89840168-89840190 AGGAAAAGGGACTAGGAGGCAGG + Intergenic
1057202667 9:93151102-93151124 GGGAGTAGGGAGAGGGAGGGAGG + Intergenic
1057392658 9:94652596-94652618 CTGAATATGGAGCGGGGGGCGGG - Intergenic
1057759418 9:97860575-97860597 CAGAAGAGGGAGTGTGGGGCTGG - Intergenic
1059738310 9:117124301-117124323 AGGAATGTGGAGTGGGAGGTGGG - Intronic
1060837411 9:126766841-126766863 AGGAATAGGGGGTGTGAGGGGGG + Intergenic
1060863768 9:126978495-126978517 CTGAATAGGGAGGCTGAGGCAGG + Intronic
1060942291 9:127549923-127549945 TGGGACAGAGAGTGGGAGGCTGG - Intronic
1061262986 9:129490162-129490184 GGGAGTAGGGAGGGAGAGGCAGG - Intergenic
1061402992 9:130378473-130378495 GGGAGCTGGGAGTGGGAGGCTGG + Intronic
1061632416 9:131881414-131881436 AGGAAGAGAGAGTGGGAGGAAGG + Intronic
1061763718 9:132868505-132868527 AGGGAGAAGGAGTGGGAGGCTGG - Intronic
1062131589 9:134897185-134897207 CTGGAGATGGAGTGGGAGGCAGG - Intergenic
1062601745 9:137321388-137321410 CAGAATTGGGCTTGGGAGGCTGG + Intronic
1203582581 Un_KI270746v1:25170-25192 AGGAAGAGGGATTGTGAGGCAGG + Intergenic
1186925474 X:14329039-14329061 AGGACTAGGAAGTGGGAGGGAGG - Intergenic
1187276179 X:17818196-17818218 TGGTTTAGGGGGTGGGAGGCTGG - Intronic
1188112577 X:26209452-26209474 AGGAAAGGGGAGTGGGAGGAAGG - Intergenic
1188976687 X:36683813-36683835 GGGAATGGGGAATGGTAGGCAGG + Intergenic
1189003788 X:36973853-36973875 CAGAATAGGGAGTTGGAGTGGGG + Intergenic
1189268666 X:39735496-39735518 GGGAAGAGGGAGGGGGAGGGGGG + Intergenic
1192106771 X:68325616-68325638 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1195444613 X:104937619-104937641 AGGCATGGGGAGTGGGTGGCAGG + Intronic
1197282011 X:124548292-124548314 GGGAACAGGGATTGTGAGGCAGG + Intronic
1202586861 Y:26439458-26439480 GGGAAGAGGGATTGTGAGGCAGG + Intergenic