ID: 929533612

View in Genome Browser
Species Human (GRCh38)
Location 2:42767257-42767279
Sequence CAGCCCAGATGCCATGCCCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 1, 1: 0, 2: 5, 3: 21, 4: 306}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929533612_929533624 23 Left 929533612 2:42767257-42767279 CCAGGGGCATGGCATCTGGGCTG 0: 1
1: 0
2: 5
3: 21
4: 306
Right 929533624 2:42767303-42767325 AACAATGTGCAGGTCTGTGGGGG 0: 1
1: 0
2: 0
3: 16
4: 194
929533612_929533621 20 Left 929533612 2:42767257-42767279 CCAGGGGCATGGCATCTGGGCTG 0: 1
1: 0
2: 5
3: 21
4: 306
Right 929533621 2:42767300-42767322 GACAACAATGTGCAGGTCTGTGG 0: 1
1: 0
2: 2
3: 20
4: 414
929533612_929533623 22 Left 929533612 2:42767257-42767279 CCAGGGGCATGGCATCTGGGCTG 0: 1
1: 0
2: 5
3: 21
4: 306
Right 929533623 2:42767302-42767324 CAACAATGTGCAGGTCTGTGGGG 0: 1
1: 0
2: 3
3: 20
4: 215
929533612_929533619 -4 Left 929533612 2:42767257-42767279 CCAGGGGCATGGCATCTGGGCTG 0: 1
1: 0
2: 5
3: 21
4: 306
Right 929533619 2:42767276-42767298 GCTGAGAAGGGCAGGAGGGTGGG 0: 1
1: 2
2: 19
3: 115
4: 921
929533612_929533617 -8 Left 929533612 2:42767257-42767279 CCAGGGGCATGGCATCTGGGCTG 0: 1
1: 0
2: 5
3: 21
4: 306
Right 929533617 2:42767272-42767294 CTGGGCTGAGAAGGGCAGGAGGG 0: 1
1: 0
2: 5
3: 104
4: 835
929533612_929533618 -5 Left 929533612 2:42767257-42767279 CCAGGGGCATGGCATCTGGGCTG 0: 1
1: 0
2: 5
3: 21
4: 306
Right 929533618 2:42767275-42767297 GGCTGAGAAGGGCAGGAGGGTGG 0: 1
1: 3
2: 38
3: 245
4: 1709
929533612_929533622 21 Left 929533612 2:42767257-42767279 CCAGGGGCATGGCATCTGGGCTG 0: 1
1: 0
2: 5
3: 21
4: 306
Right 929533622 2:42767301-42767323 ACAACAATGTGCAGGTCTGTGGG 0: 1
1: 0
2: 0
3: 45
4: 188
929533612_929533620 13 Left 929533612 2:42767257-42767279 CCAGGGGCATGGCATCTGGGCTG 0: 1
1: 0
2: 5
3: 21
4: 306
Right 929533620 2:42767293-42767315 GGTGGGTGACAACAATGTGCAGG 0: 1
1: 0
2: 0
3: 5
4: 121
929533612_929533616 -9 Left 929533612 2:42767257-42767279 CCAGGGGCATGGCATCTGGGCTG 0: 1
1: 0
2: 5
3: 21
4: 306
Right 929533616 2:42767271-42767293 TCTGGGCTGAGAAGGGCAGGAGG 0: 1
1: 1
2: 6
3: 75
4: 635

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929533612 Original CRISPR CAGCCCAGATGCCATGCCCC TGG (reversed) Exonic
900123579 1:1059651-1059673 TCGCCCCGATGCCACGCCCCGGG - Intergenic
900583818 1:3422930-3422952 AAGCCCACAGGCCAGGCCCCTGG + Intronic
901059519 1:6465662-6465684 CAGCCCACTTCCCAGGCCCCGGG + Intronic
902205733 1:14866860-14866882 CAGCACAGATTCCATGCCTGGGG - Intronic
902254525 1:15179081-15179103 ATGTCCAGATGCCAAGCCCCTGG - Intronic
903330311 1:22593718-22593740 CAGCCCAGGTGCCAGGACCCTGG + Intronic
903336303 1:22626896-22626918 CAGCCCACAAGCCCTGCCCTAGG - Intergenic
903694331 1:25196108-25196130 CAGCCCAGAGGACAGGCCTCAGG + Intergenic
903953433 1:27009740-27009762 TAGGCCAGATGCCAAGCCCTGGG - Intronic
904257531 1:29265001-29265023 CAGCCCAGATGTCATTCAACAGG - Intronic
904657857 1:32062741-32062763 CAGCTCTGCTGCCAGGCCCCAGG - Intergenic
904880987 1:33696725-33696747 CTGCCCACCTGCCAGGCCCCAGG - Intronic
905862586 1:41361329-41361351 CAGCCCAGGTGCCCCGCCCGCGG - Intergenic
905970863 1:42141339-42141361 CAGCCCAGACCCCATTCCACTGG - Intergenic
906051816 1:42880749-42880771 CAGCCGAGTTCCCATGCTCCAGG + Intergenic
906616932 1:47239861-47239883 CAGTCCAGAACCCATGCCACAGG + Intergenic
906694706 1:47816194-47816216 CAGCCCAGACCCCGGGCCCCAGG - Intronic
906743697 1:48207116-48207138 CAGCCCAGCTGCTATGTACCTGG - Intergenic
907251491 1:53142506-53142528 CAGCCCAGACCCTGTGCCCCCGG - Exonic
907334193 1:53689737-53689759 CATCACAGATGCCATGCTCCTGG - Intronic
907419122 1:54334998-54335020 CAGCACAGAGGCACTGCCCCGGG + Intronic
907519210 1:55012133-55012155 GAGCCCAGGTTCCCTGCCCCTGG - Intergenic
910494740 1:87814236-87814258 CTTCCTAGATGCCATGCACCTGG + Intergenic
911359804 1:96862625-96862647 GAGCACAGAGGCCATGCTCCTGG + Intergenic
911772877 1:101769519-101769541 CAGCTGAGTTGCCATGCCCAGGG - Intergenic
912722815 1:112034371-112034393 CAACCCAAATGCCTGGCCCCTGG - Intergenic
914343094 1:146776756-146776778 CAGAGCAGAAGCCATTCCCCCGG + Intergenic
915572002 1:156749889-156749911 TGGCCCAGATGCCAAGGCCCTGG - Intronic
919787772 1:201270792-201270814 CAGGCCAGATCCCAAGCCACTGG - Intergenic
919886964 1:201941823-201941845 CAGCTCAGCTGCCCTGACCCTGG + Intronic
922808603 1:228403358-228403380 CAGCCCAGCTGCCTGGCTCCAGG + Intronic
923079435 1:230639943-230639965 CTGCCCAGAGGACATGGCCCTGG - Intergenic
923772341 1:236948585-236948607 CAGCCAAGAAGTCAGGCCCCTGG - Intergenic
923921306 1:238566812-238566834 CAGTGGTGATGCCATGCCCCTGG + Intergenic
924038112 1:239956391-239956413 CAGCTCAAATGCCATCCCCCTGG + Intergenic
1064084316 10:12333813-12333835 CAACCCAGTTACCAAGCCCCTGG - Intergenic
1067972766 10:50991555-50991577 CGGCCGAGATGCCCTGCGCCCGG - Intronic
1068157708 10:53222904-53222926 CAGCCCAGTTCCCAGGCCTCAGG + Intergenic
1069642226 10:69963359-69963381 CAGCTCAGATCCCATGGCCCTGG + Intronic
1069792203 10:71030003-71030025 CAGCCCTGCTGCCATCCCCATGG + Intergenic
1070824674 10:79384293-79384315 CAGCACAGCTGGCAGGCCCCAGG + Exonic
1071939489 10:90573271-90573293 CAGCCCAGAGGCCCTGATCCTGG - Intergenic
1073456125 10:103637778-103637800 CAGCGCTGGTGCCATGCGCCTGG - Intronic
1073592363 10:104769326-104769348 CATCCCAGATGCTGTGCCCACGG + Intronic
1075341427 10:121649504-121649526 AAGCCCAGAAGCCAAGCCCATGG + Intergenic
1075906113 10:126083392-126083414 CTGCCCAGAGGCCCTGCCCTGGG - Intronic
1076276541 10:129204313-129204335 CAGGGAAGAAGCCATGCCCCAGG + Intergenic
1076368222 10:129935805-129935827 CAGCCCACATTCTATGCCCTTGG - Intronic
1076657914 10:132036767-132036789 CAGCGCAGAGGCCCGGCCCCCGG - Intergenic
1076826973 10:132974029-132974051 CAGGCCAGAGGCCAGGCCACAGG + Intergenic
1077098784 11:811894-811916 TAGCCCTGAGGCCATTCCCCAGG + Intronic
1077106935 11:846234-846256 CAGCCTGGGTGCCATGCCCGTGG - Intronic
1077135766 11:997508-997530 GAGGCCAGATGCAAGGCCCCAGG - Intronic
1077266977 11:1655721-1655743 CAGCCCAGATCTCAGCCCCCCGG + Intergenic
1079005643 11:16789661-16789683 CACCCCAGAGGCCATCCCCAGGG + Intronic
1079005955 11:16791136-16791158 CAGCCCAGAGGACCAGCCCCCGG - Exonic
1080302632 11:30801052-30801074 CATACCAGATGCCAGGCACCAGG - Intergenic
1080317578 11:30967572-30967594 CTGGCCAGATCCCAGGCCCCAGG - Intronic
1082693514 11:56332337-56332359 CAGGCCAAACCCCATGCCCCTGG - Intergenic
1083330876 11:61897829-61897851 CACCCCAGCTGCCAAGCCCTGGG - Exonic
1083652590 11:64211805-64211827 CATCCCAGAGCCCATACCCCAGG - Intronic
1084176184 11:67423596-67423618 CTCCCCAGCTGCCATGCGCCTGG + Exonic
1084273723 11:68041579-68041601 CAGACCAGACCCCATGCCCCAGG - Intronic
1084667263 11:70583099-70583121 CAGCCCAGTGCCCCTGCCCCAGG - Intronic
1085200509 11:74699072-74699094 CAGCCCAGATGCCAAGGACCAGG + Intronic
1085241386 11:75059145-75059167 CAGCCCAGCTGCTTTGTCCCTGG - Intergenic
1085435182 11:76493438-76493460 CAGCCCAGACCCCATGCTTCAGG - Intronic
1089951769 11:122534727-122534749 CAGTCCAGAGGCCCTGGCCCTGG + Intergenic
1092134413 12:6136667-6136689 CAGCCCAGGTGGAAGGCCCCAGG + Intergenic
1094832033 12:34304708-34304730 CAGCCCCTGTGCCAGGCCCCGGG + Intergenic
1094833140 12:34309562-34309584 CAGCCCCTTCGCCATGCCCCGGG + Intergenic
1094833423 12:34311197-34311219 CAGCCCCTGCGCCATGCCCCAGG - Intergenic
1097188430 12:57208229-57208251 CAGCCCAGAGGCCTCCCCCCAGG - Intronic
1097237045 12:57547242-57547264 CAGCCCTGCTGCCACACCCCTGG + Intronic
1102238779 12:111310722-111310744 CAGCCCTGATGCCCTGGACCTGG - Intronic
1102575020 12:113850693-113850715 CTGCCCAGAAGCCGTGGCCCTGG - Intronic
1103926882 12:124428101-124428123 CAGCCCAGGTGCCACACCCTTGG + Intronic
1108089325 13:46830355-46830377 CATCCCATATGCCATTCCCTTGG - Intergenic
1108848191 13:54699954-54699976 CGGGCCAGATCCCATGCCCAAGG + Intergenic
1111520020 13:89388983-89389005 CAGCACAGTTGCCATGCTTCAGG + Intergenic
1113099411 13:106701190-106701212 CAGGCCTGATGGCATGCACCTGG - Intergenic
1113706417 13:112436194-112436216 CAGCCCTGACACCGTGCCCCAGG + Intergenic
1115598182 14:34929228-34929250 CAGTCCAAATGCCATGTCTCAGG - Intergenic
1117285487 14:54282586-54282608 CAGCCCAGATCCCAGGCTTCAGG + Intergenic
1119747618 14:77055502-77055524 CAGGCAAGGTGCCAGGCCCCAGG + Intergenic
1122816967 14:104318742-104318764 CAGCCCAGCTCCTCTGCCCCGGG - Intergenic
1122858741 14:104572589-104572611 CAGGCCAGCTGCCATGGCCCAGG + Intronic
1122943679 14:104995077-104995099 CAGCCCAGAAGCCATGCCCAGGG - Exonic
1123772208 15:23540063-23540085 CATCCCAGATGACATCACCCTGG + Intergenic
1124992590 15:34690749-34690771 CAGCTCAGATGCCAAGTCTCTGG - Intergenic
1127350041 15:58142100-58142122 GAGCCCAGTTGCCCTGCCCTGGG + Intronic
1127362048 15:58252786-58252808 CAGCCCAGAAGCCCAGCCCAGGG + Intronic
1127842097 15:62840617-62840639 GAGCCCAGATGGCGAGCCCCAGG + Exonic
1129189635 15:73929875-73929897 GTGCCCAGATGCCAAGTCCCAGG - Intronic
1129652707 15:77502826-77502848 CAGGCGTGATGGCATGCCCCTGG + Intergenic
1129719845 15:77872063-77872085 GCGCCCAGAGGCCAGGCCCCAGG + Intergenic
1130299038 15:82666290-82666312 CAGTCCAAATCCCAGGCCCCAGG - Intronic
1130937824 15:88485208-88485230 CAAGCCAGATTCTATGCCCCAGG + Intergenic
1131148998 15:90035204-90035226 CAGCCCCCACACCATGCCCCAGG - Intronic
1131441666 15:92464286-92464308 CAGCCCGCATACCATGCCCTTGG + Exonic
1132373855 15:101315758-101315780 TAATCCACATGCCATGCCCCAGG + Intronic
1132401218 15:101506617-101506639 CAGACCACAGGCCATGTCCCAGG - Intronic
1132466445 16:79537-79559 CAGCCCAGGCACCTTGCCCCAGG + Exonic
1132766825 16:1538557-1538579 CAGCTCAGATTCCCTGCCCAGGG - Intronic
1133621066 16:7526909-7526931 AAGCCCAGAAGGCATCCCCCAGG + Intronic
1136485579 16:30569999-30570021 CAGCCCGGATCCCAGGCCTCCGG + Exonic
1136580838 16:31149943-31149965 CCCCCCAGATGCCAGGACCCAGG + Intronic
1137346461 16:47666461-47666483 CTCCCCAGATCCCCTGCCCCAGG + Intronic
1137555519 16:49468032-49468054 CAGCCCAGATGCTAGGCTCTAGG - Intergenic
1137623658 16:49893741-49893763 CAGCCCAGATCCAAGGGCCCTGG + Intergenic
1138491674 16:57380774-57380796 CAGCCCTGAGGCCTTTCCCCAGG + Intronic
1139971105 16:70775722-70775744 CAGCCAGGACTCCATGCCCCTGG + Intronic
1139990897 16:70938572-70938594 CAGAGCAGAAGCCATTCCCCCGG - Intronic
1140032157 16:71347452-71347474 CAGCCCACATCCCATGCATCAGG + Intergenic
1140973361 16:80035358-80035380 CAGACCAAATGCAATACCCCGGG - Intergenic
1141595591 16:85095061-85095083 AAGCCCAGATGCGACGCCCCAGG - Intergenic
1141715356 16:85723901-85723923 CAGCCGCGATGCCCTGGCCCAGG + Intronic
1141860375 16:86712318-86712340 CAGCTCACCTGCCCTGCCCCTGG + Intergenic
1142002556 16:87671763-87671785 CAGCCCAGTCTCCATGCCTCAGG - Intronic
1142376352 16:89708888-89708910 CACCCCAGAGGCCACACCCCAGG - Exonic
1143514880 17:7414568-7414590 CAGCCCAGAAGCCATTCTGCTGG - Intronic
1146996864 17:37328596-37328618 AAGCCCCGATCCCAAGCCCCAGG + Intronic
1147363000 17:39943259-39943281 CAGTGCAGATGCCCTGTCCCTGG - Intronic
1148977475 17:51542182-51542204 CTGCCCAGAGCCCATGCTCCAGG - Intergenic
1151673334 17:75585060-75585082 CAGCACAGCTGCCTTGCCCCAGG + Intergenic
1151961103 17:77406023-77406045 CAGCACAGATGCCCTCCCGCAGG - Intronic
1152242287 17:79166956-79166978 CAGACCAGTGGCCATGCCTCCGG + Intronic
1152357084 17:79812696-79812718 CTGCCCTGAGCCCATGCCCCAGG + Intergenic
1152467631 17:80475026-80475048 CTTCCCGGCTGCCATGCCCCCGG - Intronic
1153322913 18:3791070-3791092 CAGCCCAAAAGCCATGTCCATGG - Intronic
1154329129 18:13415440-13415462 CAGCCCTGAGGCCAAGGCCCCGG + Intronic
1155253117 18:23970195-23970217 CAACCCAGAGCCCATACCCCGGG + Intergenic
1157521411 18:48347982-48348004 CAGCCCTGTTGGCCTGCCCCAGG + Intronic
1157548665 18:48565589-48565611 AAGCACAGAGGCCCTGCCCCTGG - Intronic
1159047425 18:63382706-63382728 CAGCCCTGATTCCACTCCCCAGG + Intergenic
1161668621 19:5591718-5591740 GAGCCCCGATGCCAAGCCCTGGG - Intronic
1162004215 19:7766836-7766858 TTGGCCAGAAGCCATGCCCCAGG - Intronic
1162501074 19:11054273-11054295 CAGCCCAGATGCCCGGCAGCGGG + Intronic
1164618883 19:29682119-29682141 CAGCCCAGATGACCAGCCCCAGG - Intergenic
1165050721 19:33139853-33139875 CTGCCCAGTTGTCATGCCCTTGG - Intronic
1165988695 19:39793111-39793133 CAGCCCAGATGCCTAACTCCAGG + Intergenic
1166482719 19:43187181-43187203 CAGCTCAGCTGCCAGACCCCAGG - Intronic
1166791686 19:45402594-45402616 CGGCCCAGCTCCCTTGCCCCGGG - Intronic
1167518641 19:49938804-49938826 CAGCCCAGATGGCCTTCCCTCGG + Intronic
925292524 2:2757065-2757087 CTGCGCGGATGCCAGGCCCCTGG - Intergenic
925360679 2:3278305-3278327 CTGCCCACATGCCCTGCCCTTGG + Intronic
926588518 2:14715428-14715450 CAGCCTCGATGGCATGCCCAAGG - Intergenic
927503683 2:23599170-23599192 CAGCCCAGAGTCCTTGCCGCAGG - Intronic
927701834 2:25274060-25274082 CAGCCCAGACTCCAGGCACCTGG + Intronic
928518051 2:32062635-32062657 CAGCCAAGATTCCAGGTCCCAGG + Intergenic
929533612 2:42767257-42767279 CAGCCCAGATGCCATGCCCCTGG - Exonic
929693057 2:44090555-44090577 CAGCCCAGAGGTGATCCCCCAGG - Intergenic
930692366 2:54377730-54377752 CAGCCCCGACGCCAAGCCCAAGG - Intronic
931424634 2:62159514-62159536 CAGCCCAGATGTCCTTCCACAGG + Intergenic
931633874 2:64324940-64324962 CAGCCAAGGAGCCACGCCCCTGG + Intergenic
932508165 2:72256962-72256984 AGGCCCAAATTCCATGCCCCTGG - Intronic
932596872 2:73099481-73099503 CAGCCTGGATGCCATGCAGCGGG - Intronic
933807610 2:86011703-86011725 CTGCCCAGATGCCAGTGCCCTGG - Intergenic
933812945 2:86044435-86044457 CAGGCTAGATCCAATGCCCCGGG + Intronic
935031889 2:99330547-99330569 CTGCCCAGCTGCCATGCCTCAGG - Intronic
935357425 2:102215583-102215605 CAGCCCAGTAGCCCTGCACCTGG + Intronic
937239927 2:120453392-120453414 CACCCCACATGCCTGGCCCCAGG + Intergenic
937522071 2:122723836-122723858 TAGCCCTGCTGCCATGCCACTGG - Intergenic
939200773 2:139031307-139031329 CAGCCAAGATGCCATTCACTGGG + Intergenic
940911247 2:159211928-159211950 CAACCCAGTTGCCATGCCCGGGG + Intronic
941451357 2:165664610-165664632 GAGCCTAAAAGCCATGCCCCAGG - Intronic
942700810 2:178707723-178707745 CAGCTCAGCTGCCATGTCCAGGG - Exonic
942721368 2:178956850-178956872 CAGCCCAGATTCTTTCCCCCAGG - Intronic
944986532 2:205183611-205183633 TAGCACAGCTGACATGCCCCTGG - Intronic
946307218 2:218863040-218863062 GAGCCCAGATCCCCTTCCCCTGG + Intronic
948588898 2:239037221-239037243 CACCCCAGATGCAGAGCCCCTGG + Intergenic
948873780 2:240817069-240817091 CTGCCCAGGTGCCATGCCAAAGG + Intronic
1169191073 20:3659720-3659742 CAGCCTACATCCCTTGCCCCAGG + Intronic
1169555289 20:6743118-6743140 CTGCCCAGATGCCTTGCCTTTGG - Intergenic
1169690020 20:8320074-8320096 CAGCCAAAATGCCATGCCCCCGG - Intronic
1170801533 20:19594289-19594311 CAGACCAGATTTCATGCCCTAGG + Intronic
1171376245 20:24696009-24696031 CAACCCACATGCCAGGGCCCTGG - Intergenic
1171424440 20:25040820-25040842 CTGCCCAGATGCCCCACCCCAGG + Intronic
1172007776 20:31829303-31829325 CAGCCCACAGGCCATGTCCTGGG + Intronic
1173464710 20:43271711-43271733 CACCCCACATCCCATGCCACGGG - Intergenic
1173503856 20:43571960-43571982 AAGCCCAGATGCCACACCCCAGG - Intronic
1174127775 20:48319938-48319960 CTGCCCAGGTGACATGCCCAGGG - Intergenic
1175202350 20:57286717-57286739 CAGCCCAAATCTCATGCCTCAGG - Intergenic
1175388771 20:58613608-58613630 CAGATTAGATGCCAGGCCCCTGG + Intergenic
1175751160 20:61499030-61499052 CAGCCTGGAGGCCATGCTCCCGG - Intronic
1175939405 20:62531163-62531185 CAGCCAGGATGCCCGGCCCCAGG - Intergenic
1175985344 20:62761636-62761658 CAGCCCAGAGCCCATTTCCCTGG - Exonic
1176388503 21:6151519-6151541 CCGCCCAGCAGCCAGGCCCCGGG + Intergenic
1176512601 21:7759841-7759863 CAGCAGAGAGGCCAGGCCCCTGG - Intronic
1178638933 21:34330303-34330325 CAGCCCAGAAGGCTTGCCTCAGG + Intergenic
1178646714 21:34390365-34390387 CAGCAGAGAGGCCAGGCCCCTGG - Intronic
1179307836 21:40170873-40170895 CACACCAAAGGCCATGCCCCAGG - Intronic
1179734969 21:43386729-43386751 CCGCCCAGCAGCCAGGCCCCGGG - Intergenic
1179837925 21:44049737-44049759 GGGCCCTGATGCCCTGCCCCTGG + Intronic
1179961039 21:44767093-44767115 CAGCCCAGGGTCCAGGCCCCAGG + Intergenic
1180082667 21:45493858-45493880 CACCCCACAGGCCAGGCCCCAGG - Intronic
1180850394 22:19016380-19016402 CAGCCCAGCTGCCAGGTCCAGGG - Intergenic
1181768720 22:25110859-25110881 CAGGGCAGATGCTGTGCCCCGGG + Intronic
1182005332 22:26955070-26955092 CAGCCCAGAGCTCATGCCTCTGG - Intergenic
1183422802 22:37722053-37722075 CAGCCCAGATGCACTGCTTCTGG - Intronic
1183641649 22:39096424-39096446 TAGACCAGATGCCACTCCCCTGG - Intergenic
1184409467 22:44318160-44318182 CAGGCCCGATGCCATGCACCAGG + Intergenic
1184734603 22:46390768-46390790 CAGCCACGATCCCATGCACCAGG + Intronic
1184774865 22:46618089-46618111 CAGCCCAGATGCCACGGCTGGGG - Intronic
1185326538 22:50228370-50228392 CAGCCCCTTTGCCATGCCCCTGG - Intronic
1185364974 22:50433288-50433310 CTGCCCAGCATCCATGCCCCCGG - Intronic
1185365079 22:50433598-50433620 CTGCCCAGCATCCATGCCCCCGG - Intronic
1185365100 22:50433660-50433682 CTGCCCAGCATCCATGCCCCCGG - Intronic
1185365143 22:50433784-50433806 CTGCCCAGCATCCATGCCCCCGG - Intronic
1185365166 22:50433846-50433868 CTGCCCAGCATCCATGCCCCCGG - Intronic
1185365207 22:50433970-50433992 CTGCCCAGCATCCATGCCCCCGG - Intronic
1185365251 22:50434094-50434116 CTGCCCAGCATCCATGCCCCCGG - Intronic
1185365313 22:50434280-50434302 CTGCCCAGCATCCATGCCCCCGG - Intronic
1185365334 22:50434342-50434364 CTGCCCAGCATCCATGCCCCCGG - Intronic
1185365424 22:50434589-50434611 CTGCCCAGCATCCATGCCCCCGG - Intronic
1185365442 22:50434639-50434661 CTGCCCAGCATCCATGCCCCCGG - Intronic
1185365486 22:50434763-50434785 CTGCCCAGCATCCATGCCCCCGG - Intronic
950403393 3:12788472-12788494 CATCCCCGAGGCCAGGCCCCTGG + Intergenic
952265031 3:31777186-31777208 CACATCAGATGACATGCCCCTGG + Intronic
952324911 3:32312487-32312509 CTGCCCACATGCCTTGCCCTGGG - Intronic
954352208 3:50054087-50054109 CAGCCCAAATGCCTTTGCCCTGG - Intronic
954440853 3:50521255-50521277 CAGCCAAGATGACATGCCTTGGG - Intergenic
954784695 3:53084282-53084304 CACCCCTTATGCCATTCCCCTGG + Intronic
954807256 3:53227762-53227784 CAGCCCAGCTGGCAGGCTCCAGG + Intronic
955548056 3:60052699-60052721 CATCCTAGATGGGATGCCCCTGG - Intronic
956192443 3:66620692-66620714 CAGCCCAACTGCCAGGCCCTGGG - Intergenic
960019527 3:112933052-112933074 CAGCACAGCAGGCATGCCCCTGG + Intronic
961546724 3:127639374-127639396 CAGCCCAGCTCCCAGGCCCATGG - Exonic
961820884 3:129575153-129575175 CACCCCAGATGCCACGCTCAAGG + Intronic
961825444 3:129596758-129596780 CAGCCCATATGCCTGGCCGCAGG + Intronic
965732246 3:171784539-171784561 CTGCACACATGCCATGTCCCAGG + Intronic
966834522 3:184038770-184038792 CAGGGCAGATGCCAGGCCCTGGG + Exonic
967335217 3:188336933-188336955 CAGCCCAGGTACCATTTCCCTGG + Intronic
968007248 3:195251410-195251432 CAGCCCAGAAGCCAGGCCCCCGG + Intronic
968496811 4:922894-922916 CAGCCCAGATGTCCTTCCACGGG + Intronic
968622606 4:1610609-1610631 AAGCCCAGATGCCCTGCCTGGGG - Intergenic
968649744 4:1755800-1755822 GGGCCAAGCTGCCATGCCCCTGG + Intergenic
969338838 4:6527945-6527967 GAGCCCAGACTCCAAGCCCCAGG + Intronic
969572893 4:8020419-8020441 CAGCCCAGATCCCCTGCCCAGGG + Intronic
969670612 4:8588050-8588072 CAGTCAAGATGCCAAACCCCTGG - Intronic
970849878 4:20589184-20589206 CACCCCAGAAGCCTTCCCCCCGG - Intronic
972820116 4:42691956-42691978 CATCCCTGAGGCCATGCCCTGGG + Intergenic
973981652 4:56313262-56313284 CAACTTAGATGCCATCCCCCTGG + Exonic
975561821 4:75715716-75715738 CAACCCATCAGCCATGCCCCGGG + Intronic
977410273 4:96653489-96653511 CAGCCAAGCTCCCATGCCTCCGG - Intergenic
979800345 4:124900157-124900179 TAGGCCAGAAGACATGCCCCAGG + Intergenic
982625456 4:157760558-157760580 CAGCCAAGCTCCCATGTCCCAGG + Intergenic
985534363 5:455252-455274 CAGCCTAGTGGCCATGGCCCGGG - Intronic
985951078 5:3221701-3221723 CAGCCCAGATGCCAGCCGCCAGG - Intergenic
986325447 5:6669963-6669985 CAGCCCAGATGTGAGGACCCAGG - Intergenic
986821676 5:11474018-11474040 CAGCATAGATGCCATGCTTCAGG - Intronic
988521231 5:31947254-31947276 CAGCCCAGAAACAAGGCCCCCGG - Intronic
992612294 5:78518027-78518049 TAGCCCAGATGCCATAAGCCGGG + Intronic
995988115 5:118205059-118205081 CAGCCCAGGTGCCATTCAACAGG + Intergenic
996316580 5:122167175-122167197 CAGACAAGATGCCATGCACGTGG + Intronic
997608068 5:135191183-135191205 CAGCCCAGATGGTCTGGCCCTGG + Intronic
998151302 5:139759017-139759039 CAGCTCACATTCCATGCTCCAGG + Intergenic
998174750 5:139894901-139894923 CAGCTGAGATGCCAGGCACCTGG - Intronic
998177139 5:139908826-139908848 GAGCCCAGCTGGCATGCCCCAGG - Intronic
998477373 5:142433129-142433151 CAGCCATGATGCCATGCTGCAGG + Intergenic
1000264220 5:159619457-159619479 CAGCCTACCTGCCCTGCCCCCGG + Intergenic
1003957151 6:11174529-11174551 CAGCCAAGAAGCCCTTCCCCGGG + Intergenic
1006861464 6:37174228-37174250 CATTCCAGATCCCAGGCCCCTGG + Exonic
1007779692 6:44245901-44245923 GAGCCCCTAGGCCATGCCCCTGG - Intergenic
1007905628 6:45457784-45457806 CAGCCAAGCTGCCATTGCCCTGG - Intronic
1011700688 6:89951560-89951582 CGGCCAAGATGGCTTGCCCCAGG - Exonic
1013012979 6:106136339-106136361 CAGCCCTGCTCCCATGCACCAGG + Intergenic
1015585545 6:134772579-134772601 CAGCCCAACTGCCAGGCCCAGGG - Intergenic
1016136824 6:140554538-140554560 CAGGCCTGATGCCATACCTCTGG - Intergenic
1016962150 6:149684190-149684212 TAGCCCTCTTGCCATGCCCCAGG + Exonic
1017909928 6:158783840-158783862 CAGCCCAGAAGCTATGCCTGGGG + Intronic
1018049553 6:159997138-159997160 CAGGCCACAAGCCATGCTCCTGG + Intronic
1018315741 6:162554689-162554711 CAGCCAAGCTGCCATTCCCATGG - Intronic
1019594707 7:1853107-1853129 CAGCCCAGATGCACTTCCTCGGG - Intronic
1019726715 7:2606800-2606822 CAGCCCAGCTGCCATTCCCCGGG - Intronic
1019747468 7:2708872-2708894 CAGCCCCTATGCCATTCCTCAGG - Intronic
1022331342 7:29382248-29382270 CCACCCAGATGCTCTGCCCCTGG - Intronic
1023882176 7:44326631-44326653 CAGCCCTGGTGCCAGGCCTCAGG - Intronic
1024059080 7:45685127-45685149 CAGCCCAGAAGCCAGGACCCAGG + Intronic
1024255671 7:47538230-47538252 CAGCCAAGATCCACTGCCCCGGG - Intronic
1026019569 7:66697025-66697047 CACCCCTGACCCCATGCCCCAGG + Intronic
1027047618 7:75001485-75001507 CACCCCAGATGCCGGGCCCCCGG - Intronic
1029385372 7:100240154-100240176 CACCCCAGATGCCAGGCCCCCGG + Intronic
1033658940 7:143390809-143390831 CATCCCAGGTGCCCTGACCCAGG + Exonic
1034874148 7:154710200-154710222 GGGCCCTGAAGCCATGCCCCTGG - Intronic
1035181982 7:157096258-157096280 CAGCCCATAAACCAAGCCCCAGG - Intergenic
1035221300 7:157407972-157407994 CAGCACACAGGCCATGCCCGCGG - Intronic
1035479337 7:159169618-159169640 CAGGCCTGATGCCATGCCTGGGG + Intergenic
1035598484 8:880463-880485 CAGCACGGATGCCATGTCGCAGG - Intergenic
1035598504 8:880546-880568 CAGCACGGATGCCATGTCGCAGG - Intergenic
1035598524 8:880629-880651 CAGCACGGATGCCATGTCGCAGG - Intergenic
1041090784 8:54299346-54299368 CAGCCCAGAAGCCCAGCCCTCGG - Intergenic
1041705848 8:60845347-60845369 CAACCCAGATGCCCTGTTCCAGG + Exonic
1042040269 8:64581723-64581745 CAGCCGAGATGGCCTGGCCCTGG - Exonic
1044730547 8:95225567-95225589 CAGCCCCCAGGCCAAGCCCCAGG - Intergenic
1045246004 8:100442206-100442228 CAGCTCAGATGTCATTCCTCAGG - Intergenic
1047869769 8:129069943-129069965 GAACCCAGATGCTATGCCCAAGG - Intergenic
1048873817 8:138821091-138821113 CAGCCCAGGTTCCAGGCCACCGG - Intronic
1048965158 8:139609564-139609586 CAGCCCACAGGCCTGGCCCCTGG - Intronic
1048994963 8:139788524-139788546 CTGAGCAGCTGCCATGCCCCAGG - Intronic
1049174417 8:141182825-141182847 CAGCCCTGAGGCCAGGCCACAGG + Intronic
1049594222 8:143476053-143476075 CAGCCCAGGTGCCAAGGGCCAGG - Intronic
1049599245 8:143499370-143499392 CCGCCCAGCAGCCAGGCCCCAGG + Intronic
1050505406 9:6342827-6342849 CAGCCCAGGTGCTATTTCCCTGG - Intergenic
1052066995 9:24034310-24034332 TAGCCCAGATGACATTCTCCAGG - Intergenic
1052770044 9:32679270-32679292 CAGTCCAGAAGCCATGGGCCTGG - Intergenic
1053294272 9:36901739-36901761 CAGCCCAGGTGGCATAACCCTGG + Intronic
1055005268 9:71498666-71498688 TAGCCCAGAAGACTTGCCCCTGG + Intergenic
1055596188 9:77867144-77867166 CATCCCAGCTACAATGCCCCTGG + Intronic
1056563193 9:87750862-87750884 CAGCCCAGATGCCACCCACATGG + Intergenic
1056811091 9:89764444-89764466 CAGCCCATGTGACATGCCCCAGG + Intergenic
1059312413 9:113397441-113397463 CAGCCCTGCTGCCACACCCCTGG + Intronic
1060114393 9:120928975-120928997 CAGCCGAGGTGCCAGGTCCCCGG + Intronic
1060170083 9:121453970-121453992 CAGACCAGATGTCATGCCTGCGG - Intergenic
1060280766 9:122214140-122214162 CAGTCCACAGGCCACGCCCCAGG + Intronic
1060730359 9:126033336-126033358 CATCCCAGTTGCCAGGCCCTTGG + Intergenic
1060743128 9:126112607-126112629 CAGCCAAGATTCCCTGCACCAGG + Intergenic
1061867413 9:133499987-133500009 CAAGACAGATCCCATGCCCCTGG - Intergenic
1061951294 9:133937752-133937774 CAGCCCAGCAGGCAAGCCCCTGG + Intronic
1062491547 9:136807460-136807482 CGGGCCAGGTGCCTTGCCCCAGG - Intronic
1062631719 9:137466091-137466113 CAGGCCGGGTGCCATGCACCAGG + Intronic
1062720948 9:138043687-138043709 CCTCCCAGCTCCCATGCCCCCGG - Intronic
1185456007 X:311260-311282 CAGCCCAGGGGCCAGGCCCTCGG - Intronic
1185534217 X:846688-846710 CAGCCCAGGAGACATTCCCCGGG + Intergenic
1186194727 X:7099001-7099023 TGGCCCAGATACCATGCCCTGGG + Intronic
1191640457 X:63426033-63426055 CAGCCCCAAGGCCAAGCCCCTGG - Intergenic
1192619434 X:72662562-72662584 TAGCCCAGCAGCCCTGCCCCTGG + Intronic
1195637896 X:107138894-107138916 CAGCCCAGATGTCCTGCAACAGG + Intronic
1199073540 X:143505418-143505440 CAGCCCAGATGTCCTTCACCTGG + Intergenic
1200068908 X:153518201-153518223 CGGCCCAGATCCCGCGCCCCCGG - Intronic
1202232808 Y:22672551-22672573 CAGGCCACATGCCCTGCCCATGG - Intergenic
1202310348 Y:23523607-23523629 CAGGCCACATGCCCTGCCCATGG + Intergenic
1202560454 Y:26146987-26147009 CAGGCCACATGCCCTGCCCATGG - Intergenic