ID: 929536311

View in Genome Browser
Species Human (GRCh38)
Location 2:42786614-42786636
Sequence GTGCCCTGTCCAAGATCCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 93}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929536303_929536311 19 Left 929536303 2:42786572-42786594 CCCCATGTGCTTATGGAAACAGG 0: 1
1: 0
2: 0
3: 10
4: 174
Right 929536311 2:42786614-42786636 GTGCCCTGTCCAAGATCCCGGGG 0: 1
1: 0
2: 0
3: 7
4: 93
929536306_929536311 17 Left 929536306 2:42786574-42786596 CCATGTGCTTATGGAAACAGGCT 0: 1
1: 0
2: 1
3: 17
4: 144
Right 929536311 2:42786614-42786636 GTGCCCTGTCCAAGATCCCGGGG 0: 1
1: 0
2: 0
3: 7
4: 93
929536305_929536311 18 Left 929536305 2:42786573-42786595 CCCATGTGCTTATGGAAACAGGC 0: 1
1: 0
2: 0
3: 13
4: 105
Right 929536311 2:42786614-42786636 GTGCCCTGTCCAAGATCCCGGGG 0: 1
1: 0
2: 0
3: 7
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929536311 Original CRISPR GTGCCCTGTCCAAGATCCCG GGG Intronic
900087115 1:904037-904059 GTGCCCAGCCCAGCATCCCGGGG + Intergenic
900756696 1:4440335-4440357 CTGCCCTGTCCGAGTTCCCTGGG + Intergenic
901685506 1:10941341-10941363 GTGACCTGTGCAAGATCCGGGGG - Intergenic
902057699 1:13615971-13615993 GTGCCCTGTCCCTGAGCTCGTGG + Exonic
902479486 1:16704233-16704255 GTGGCTTGGCCAAGATCCCACGG - Intergenic
902695425 1:18137514-18137536 GTCACTTGCCCAAGATCCCGTGG + Intronic
903588797 1:24438527-24438549 CTGCCCTCTCCTAGATCGCGGGG - Intronic
904172292 1:28599776-28599798 GTGACCTGTCCAAGGTCACTAGG - Intronic
907368660 1:53982929-53982951 GTGCCCTATCCAATACCCCATGG - Intergenic
907955659 1:59225839-59225861 GAGCCCAGTCCTAGATCCAGAGG + Intergenic
911975378 1:104488328-104488350 GTGCCATGCCCAAGAGCCAGTGG + Intergenic
914676839 1:149912592-149912614 GAGACCTGTCCAAGACCCCATGG + Intronic
920372049 1:205485262-205485284 GTGACTTCTCCAAGATCCCACGG - Intergenic
922062116 1:222102923-222102945 CTGCCCTGTCCAAGGTCACCTGG + Intergenic
1071504651 10:86225215-86225237 GTGACTTGTCCAGGAGCCCGAGG + Intronic
1072668822 10:97414370-97414392 GTCACCTCTCCAAGATCCTGTGG + Intronic
1074944433 10:118267850-118267872 GTGTCTTGTCCAAGATCACAAGG + Intergenic
1075362845 10:121854917-121854939 CTTCCCTGTGCAAGTTCCCGTGG - Intronic
1075721245 10:124588833-124588855 GTGCCCTCTCCAGGACCCCCTGG - Intronic
1076136263 10:128047150-128047172 GTGACTTGTCCAAAATCCCTGGG - Intronic
1076577458 10:131479102-131479124 GTGCCCTGTTCAGGAGGCCGAGG - Intergenic
1077486094 11:2839047-2839069 CGGCTCTGTCCAAGAGCCCGAGG - Intronic
1078726973 11:13940435-13940457 GTGTGCTGTCCAAGACCCGGAGG - Intergenic
1078854322 11:15194397-15194419 GTGCCCTACCCAAGATTCCATGG + Intronic
1085510035 11:77083493-77083515 GTGACCTGCCCAAGCTCCCCTGG - Intronic
1091684659 12:2553139-2553161 GTGCTTTGGCCAAGATCCCAGGG - Intronic
1095620795 12:44251088-44251110 TTGTCTTGTCCAAGATGCCGTGG + Intronic
1103126989 12:118432303-118432325 GTGCGCTGTCCAAGGTACCCAGG - Intergenic
1104360921 12:128132509-128132531 GTGGCCTGTCCAAGATCACACGG + Intergenic
1104744792 12:131204021-131204043 GTGCCCTCTCCAGGCACCCGAGG - Intergenic
1104789620 12:131473397-131473419 GTGCCCTCTCCAGGCACCCGAGG + Intergenic
1107770744 13:43786288-43786310 GTGCGCTGTCCAAGGTGCAGGGG + Intronic
1108250983 13:48567712-48567734 GTGGACTGTACAAGATCACGAGG - Intergenic
1109716024 13:66223471-66223493 GTAACCTGTCCAAGATCACATGG - Intergenic
1119799340 14:77428916-77428938 ATTCTCTGTCCAAGATCCTGAGG - Intronic
1123005156 14:105317851-105317873 ATGCCCAGTTCAAGCTCCCGGGG - Intronic
1127054447 15:55117181-55117203 CTCCCCTGGCCAAGATCCCCAGG + Intergenic
1128364360 15:66986876-66986898 GTGCCCTGGCCAAGACCAGGTGG - Intergenic
1139719973 16:68844331-68844353 GTAACCTGTCCAAGATCACGTGG + Intronic
1145394543 17:22484896-22484918 GTGCCCTCTCCTACATCCCAGGG - Intergenic
1146505063 17:33397637-33397659 CTACCCTGTCCCAGATCCCCAGG - Intronic
1146730893 17:35193440-35193462 GTGCGCTGTCCTACATTCCGAGG - Exonic
1150281784 17:63933118-63933140 GTTCCCTGCCCAAGACCCCCTGG - Intergenic
1152997993 18:426055-426077 GTGACTTGTCCAAGATCACATGG + Intronic
1163690740 19:18736947-18736969 GTGCCCTGTGCAGGATTCCTGGG + Intronic
1166873849 19:45885709-45885731 GCGACCTGCCCAAGATGCCGTGG - Exonic
1167794483 19:51700654-51700676 GGGCCCTCTCCAGGATCCAGAGG + Intergenic
1202713525 1_KI270714v1_random:30139-30161 GTGGCTTGGCCAAGATCCCACGG - Intergenic
925571482 2:5316935-5316957 GTGCCCTTCCCAAGCTCCCTGGG + Intergenic
929536311 2:42786614-42786636 GTGCCCTGTCCAAGATCCCGGGG + Intronic
930171053 2:48252106-48252128 GTCCCCTCTCTAAGCTCCCGTGG - Intergenic
932281006 2:70491782-70491804 CTGCCCTGTGCAAGATTCCATGG + Intronic
933788922 2:85868084-85868106 GTGGCCTCTCCATGATCCCTTGG + Intronic
945254475 2:207792173-207792195 GTGGCTTGTCCAAGCTCCCTTGG + Intergenic
947536707 2:230944200-230944222 TTGCCCTGTCCAATGTCCAGTGG - Intronic
948484555 2:238272249-238272271 GTGCCATGTCCAAGACAGCGGGG - Intronic
1170388846 20:15850464-15850486 GTGCCCTGTTCATGTTCCCGTGG - Intronic
1170509445 20:17061361-17061383 GTGCCTTGGCCAAGATCCCAAGG + Intergenic
1172239217 20:33401227-33401249 GTGACCTGTCCAAGGTCACACGG + Intronic
1172523304 20:35582985-35583007 GTGCCCTGCCCAGGAACACGGGG + Intergenic
1173325733 20:42031675-42031697 ATGCCCTGTCCAAGGTCACATGG - Intergenic
1179930344 21:44567325-44567347 GTGCACTGTCCCAGAAACCGTGG + Intronic
1182478676 22:30591895-30591917 GTGCCCTGCCAAGGACCCCGAGG + Exonic
1183343724 22:37295706-37295728 GGGCCCTGTGCAAGAAACCGGGG - Intronic
1184438778 22:44496445-44496467 CTGCCCTCTCCAAGCTCCCCTGG - Exonic
1185315760 22:50178471-50178493 GCGCCCTGGCCAGGCTCCCGTGG - Intronic
949826020 3:8166842-8166864 GTGCCCAATCCAAGAACCAGGGG + Intergenic
954826160 3:53375259-53375281 GTGACCTGTCCAAGGTCTCCCGG - Intergenic
961002666 3:123384510-123384532 GTGACCTGGGCAAGAGCCCGAGG - Intronic
971612828 4:28747196-28747218 GTGCTATGTCCAAGATGCCAGGG - Intergenic
972197810 4:36675459-36675481 GTGCCCTGTTCTAGATGCTGTGG + Intergenic
979742416 4:124167970-124167992 GTGCCCTGTCCATAAACCCCTGG - Intergenic
983381077 4:166994362-166994384 GTAACCTGTCCAAGATCACATGG + Intronic
990271498 5:54146448-54146470 GCGCCCTGCCCAATATCCCATGG + Intronic
1001019680 5:168172502-168172524 GTGGCTTGTCCAAGCTCCCACGG + Intronic
1001217880 5:169872802-169872824 GTGATCTGCCCAAGATCCCAGGG - Intronic
1001590026 5:172858799-172858821 GGGCCCTGCCCAAGATTCCAAGG + Intronic
1002424992 5:179169624-179169646 ATCCCCTGTCCCAGATCCCCAGG + Intronic
1002590908 5:180291505-180291527 GTGCCTTGGCCAAGGTCGCGGGG + Intronic
1019115726 6:169760472-169760494 TTGCCCTGACCAAGGGCCCGAGG - Intronic
1019613804 7:1949778-1949800 GTGCCATGTCCAAGAGCCGCGGG + Intronic
1020708168 7:11571551-11571573 GTAACCTGTCCAAGATCACATGG + Intronic
1026385962 7:69848084-69848106 GAGCCTTGTCATAGATCCCGTGG + Intronic
1037438281 8:18887983-18888005 GTGACTTGTCCAAGATCACACGG + Intronic
1038021961 8:23558369-23558391 ATGACTTGTCCAAGATCCTGTGG - Intronic
1047137326 8:122094589-122094611 GAGCCCTGTACAAGATTCTGTGG - Intergenic
1048428257 8:134342653-134342675 GTGCCCTGCCCGAGTTCCCTGGG + Intergenic
1048874715 8:138827795-138827817 GTGCCCTGTACATGATACAGAGG - Intronic
1050498445 9:6268561-6268583 GTGCTCTGTCCAAATTCCCTTGG + Intergenic
1053284071 9:36839264-36839286 GCTCCCTCTCCAAGTTCCCGTGG + Exonic
1056618589 9:88190987-88191009 GTGCTCTGCTCAAGATCCCATGG + Intergenic
1056683904 9:88743909-88743931 GCACCCTGTCCACAATCCCGAGG - Intergenic
1057815727 9:98292698-98292720 GTGTCCTGTCCAAGCACCCAGGG + Intronic
1060918922 9:127406894-127406916 GAGCACTGTCCAAGATACCGAGG - Intronic
1061718019 9:132533150-132533172 GTGCCCTGAACGAGATCCCACGG + Intronic
1061861114 9:133469258-133469280 GTGGCCTGTCCAAGGTTCCCAGG - Exonic
1062721440 9:138046357-138046379 GTGCCCTGTCCAGGCTCCCAGGG - Intronic
1192033884 X:67544022-67544044 GCGCCCCCTCCGAGATCCCGGGG + Intronic
1196815154 X:119659726-119659748 GTACCTTGTTCAAGATCCCTGGG + Intronic
1197936829 X:131748034-131748056 GAGCCAGGTCCAAGATCCCTGGG - Intergenic
1199732421 X:150649188-150649210 GTGCCTTGTCCCAGATCACATGG + Intronic