ID: 929539939

View in Genome Browser
Species Human (GRCh38)
Location 2:42811407-42811429
Sequence GCGCCCTGCCCCACATCGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929539932_929539939 17 Left 929539932 2:42811367-42811389 CCGGGGGCCGGGAAATCAGGCCA No data
Right 929539939 2:42811407-42811429 GCGCCCTGCCCCACATCGCCAGG No data
929539929_929539939 21 Left 929539929 2:42811363-42811385 CCTCCCGGGGGCCGGGAAATCAG No data
Right 929539939 2:42811407-42811429 GCGCCCTGCCCCACATCGCCAGG No data
929539937_929539939 -3 Left 929539937 2:42811387-42811409 CCAAGTGGTCGCCGGCGGATGCG No data
Right 929539939 2:42811407-42811429 GCGCCCTGCCCCACATCGCCAGG No data
929539934_929539939 10 Left 929539934 2:42811374-42811396 CCGGGAAATCAGGCCAAGTGGTC No data
Right 929539939 2:42811407-42811429 GCGCCCTGCCCCACATCGCCAGG No data
929539931_929539939 18 Left 929539931 2:42811366-42811388 CCCGGGGGCCGGGAAATCAGGCC No data
Right 929539939 2:42811407-42811429 GCGCCCTGCCCCACATCGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929539939 Original CRISPR GCGCCCTGCCCCACATCGCC AGG Intergenic
No off target data available for this crispr