ID: 929542643

View in Genome Browser
Species Human (GRCh38)
Location 2:42834208-42834230
Sequence CTAGCTGGAGGCTTTGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929542634_929542643 1 Left 929542634 2:42834184-42834206 CCTTAATCCCAGGGCCAGGTGTC No data
Right 929542643 2:42834208-42834230 CTAGCTGGAGGCTTTGAGCTGGG No data
929542636_929542643 -7 Left 929542636 2:42834192-42834214 CCAGGGCCAGGTGTCCCTAGCTG No data
Right 929542643 2:42834208-42834230 CTAGCTGGAGGCTTTGAGCTGGG No data
929542632_929542643 6 Left 929542632 2:42834179-42834201 CCTCACCTTAATCCCAGGGCCAG No data
Right 929542643 2:42834208-42834230 CTAGCTGGAGGCTTTGAGCTGGG No data
929542635_929542643 -6 Left 929542635 2:42834191-42834213 CCCAGGGCCAGGTGTCCCTAGCT No data
Right 929542643 2:42834208-42834230 CTAGCTGGAGGCTTTGAGCTGGG No data
929542629_929542643 24 Left 929542629 2:42834161-42834183 CCAATTCTAGTTGTTGTTCCTCA No data
Right 929542643 2:42834208-42834230 CTAGCTGGAGGCTTTGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929542643 Original CRISPR CTAGCTGGAGGCTTTGAGCT GGG Intergenic
No off target data available for this crispr