ID: 929543794

View in Genome Browser
Species Human (GRCh38)
Location 2:42842557-42842579
Sequence GACAAACGCCATAGTGGGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929543794_929543801 3 Left 929543794 2:42842557-42842579 CCTCGCCCACTATGGCGTTTGTC No data
Right 929543801 2:42842583-42842605 TCCTCCCCTGGGAGTATCTGGGG No data
929543794_929543797 -9 Left 929543794 2:42842557-42842579 CCTCGCCCACTATGGCGTTTGTC No data
Right 929543797 2:42842571-42842593 GCGTTTGTCACTTCCTCCCCTGG No data
929543794_929543800 2 Left 929543794 2:42842557-42842579 CCTCGCCCACTATGGCGTTTGTC No data
Right 929543800 2:42842582-42842604 TTCCTCCCCTGGGAGTATCTGGG No data
929543794_929543798 -8 Left 929543794 2:42842557-42842579 CCTCGCCCACTATGGCGTTTGTC No data
Right 929543798 2:42842572-42842594 CGTTTGTCACTTCCTCCCCTGGG No data
929543794_929543806 15 Left 929543794 2:42842557-42842579 CCTCGCCCACTATGGCGTTTGTC No data
Right 929543806 2:42842595-42842617 AGTATCTGGGGCCCCAGCCTTGG No data
929543794_929543799 1 Left 929543794 2:42842557-42842579 CCTCGCCCACTATGGCGTTTGTC No data
Right 929543799 2:42842581-42842603 CTTCCTCCCCTGGGAGTATCTGG No data
929543794_929543807 16 Left 929543794 2:42842557-42842579 CCTCGCCCACTATGGCGTTTGTC No data
Right 929543807 2:42842596-42842618 GTATCTGGGGCCCCAGCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929543794 Original CRISPR GACAAACGCCATAGTGGGCG AGG (reversed) Intergenic
No off target data available for this crispr