ID: 929547754

View in Genome Browser
Species Human (GRCh38)
Location 2:42866730-42866752
Sequence CTGGTGTTCTTGAGCGATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929547754_929547757 -10 Left 929547754 2:42866730-42866752 CCATCATCGCTCAAGAACACCAG No data
Right 929547757 2:42866743-42866765 AGAACACCAGGGAATCGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929547754 Original CRISPR CTGGTGTTCTTGAGCGATGA TGG (reversed) Intergenic
No off target data available for this crispr