ID: 929550033

View in Genome Browser
Species Human (GRCh38)
Location 2:42884342-42884364
Sequence ATCCATAGTTACCCTGGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929550033_929550039 7 Left 929550033 2:42884342-42884364 CCTTCACCAGGGTAACTATGGAT No data
Right 929550039 2:42884372-42884394 GAGGAAATAATCAAATTTTCAGG No data
929550033_929550042 23 Left 929550033 2:42884342-42884364 CCTTCACCAGGGTAACTATGGAT No data
Right 929550042 2:42884388-42884410 TTTCAGGGACTACTGGACACTGG 0: 64
1: 79
2: 146
3: 187
4: 262
929550033_929550043 24 Left 929550033 2:42884342-42884364 CCTTCACCAGGGTAACTATGGAT No data
Right 929550043 2:42884389-42884411 TTCAGGGACTACTGGACACTGGG No data
929550033_929550041 16 Left 929550033 2:42884342-42884364 CCTTCACCAGGGTAACTATGGAT No data
Right 929550041 2:42884381-42884403 ATCAAATTTTCAGGGACTACTGG No data
929550033_929550040 8 Left 929550033 2:42884342-42884364 CCTTCACCAGGGTAACTATGGAT No data
Right 929550040 2:42884373-42884395 AGGAAATAATCAAATTTTCAGGG No data
929550033_929550044 25 Left 929550033 2:42884342-42884364 CCTTCACCAGGGTAACTATGGAT No data
Right 929550044 2:42884390-42884412 TCAGGGACTACTGGACACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929550033 Original CRISPR ATCCATAGTTACCCTGGTGA AGG (reversed) Intergenic
No off target data available for this crispr