ID: 929550258

View in Genome Browser
Species Human (GRCh38)
Location 2:42886000-42886022
Sequence ATTATCTGAAGATTATGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929550258_929550260 5 Left 929550258 2:42886000-42886022 CCCTGACATAATCTTCAGATAAT No data
Right 929550260 2:42886028-42886050 TCCTTTTGAGAGACAACTCTTGG 0: 17
1: 200
2: 191
3: 170
4: 310
929550258_929550263 17 Left 929550258 2:42886000-42886022 CCCTGACATAATCTTCAGATAAT No data
Right 929550263 2:42886040-42886062 ACAACTCTTGGACTGTTACTGGG No data
929550258_929550262 16 Left 929550258 2:42886000-42886022 CCCTGACATAATCTTCAGATAAT No data
Right 929550262 2:42886039-42886061 GACAACTCTTGGACTGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929550258 Original CRISPR ATTATCTGAAGATTATGTCA GGG (reversed) Intergenic
No off target data available for this crispr