ID: 929550262

View in Genome Browser
Species Human (GRCh38)
Location 2:42886039-42886061
Sequence GACAACTCTTGGACTGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929550258_929550262 16 Left 929550258 2:42886000-42886022 CCCTGACATAATCTTCAGATAAT No data
Right 929550262 2:42886039-42886061 GACAACTCTTGGACTGTTACTGG No data
929550259_929550262 15 Left 929550259 2:42886001-42886023 CCTGACATAATCTTCAGATAATT No data
Right 929550262 2:42886039-42886061 GACAACTCTTGGACTGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929550262 Original CRISPR GACAACTCTTGGACTGTTAC TGG Intergenic
No off target data available for this crispr