ID: 929550262 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:42886039-42886061 |
Sequence | GACAACTCTTGGACTGTTAC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
929550258_929550262 | 16 | Left | 929550258 | 2:42886000-42886022 | CCCTGACATAATCTTCAGATAAT | No data | ||
Right | 929550262 | 2:42886039-42886061 | GACAACTCTTGGACTGTTACTGG | No data | ||||
929550259_929550262 | 15 | Left | 929550259 | 2:42886001-42886023 | CCTGACATAATCTTCAGATAATT | No data | ||
Right | 929550262 | 2:42886039-42886061 | GACAACTCTTGGACTGTTACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
929550262 | Original CRISPR | GACAACTCTTGGACTGTTAC TGG | Intergenic | ||
No off target data available for this crispr |