ID: 929550706

View in Genome Browser
Species Human (GRCh38)
Location 2:42889540-42889562
Sequence TTCTTGCATTTTCAGTTGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929550704_929550706 -2 Left 929550704 2:42889519-42889541 CCTCCTCTTCTAGGAAAGGAATT No data
Right 929550706 2:42889540-42889562 TTCTTGCATTTTCAGTTGTATGG No data
929550705_929550706 -5 Left 929550705 2:42889522-42889544 CCTCTTCTAGGAAAGGAATTCTT No data
Right 929550706 2:42889540-42889562 TTCTTGCATTTTCAGTTGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929550706 Original CRISPR TTCTTGCATTTTCAGTTGTA TGG Intergenic
No off target data available for this crispr