ID: 929554590

View in Genome Browser
Species Human (GRCh38)
Location 2:42917762-42917784
Sequence TCGAAGATGAATAATGAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929554587_929554590 29 Left 929554587 2:42917710-42917732 CCTTTCTCTGTTGGAAAGACAAG No data
Right 929554590 2:42917762-42917784 TCGAAGATGAATAATGAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929554590 Original CRISPR TCGAAGATGAATAATGAGGT AGG Intergenic
No off target data available for this crispr