ID: 929556258

View in Genome Browser
Species Human (GRCh38)
Location 2:42927405-42927427
Sequence CTGGGCTCATTGTTGAACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929556258_929556266 18 Left 929556258 2:42927405-42927427 CCAGTGTTCAACAATGAGCCCAG No data
Right 929556266 2:42927446-42927468 ATGGGAACAAGTAGGGTGCCTGG No data
929556258_929556268 27 Left 929556258 2:42927405-42927427 CCAGTGTTCAACAATGAGCCCAG No data
Right 929556268 2:42927455-42927477 AGTAGGGTGCCTGGAGAGGTAGG No data
929556258_929556265 11 Left 929556258 2:42927405-42927427 CCAGTGTTCAACAATGAGCCCAG No data
Right 929556265 2:42927439-42927461 AGTAGAAATGGGAACAAGTAGGG No data
929556258_929556263 0 Left 929556258 2:42927405-42927427 CCAGTGTTCAACAATGAGCCCAG No data
Right 929556263 2:42927428-42927450 AAATGGTGCATAGTAGAAATGGG No data
929556258_929556269 28 Left 929556258 2:42927405-42927427 CCAGTGTTCAACAATGAGCCCAG No data
Right 929556269 2:42927456-42927478 GTAGGGTGCCTGGAGAGGTAGGG No data
929556258_929556262 -1 Left 929556258 2:42927405-42927427 CCAGTGTTCAACAATGAGCCCAG No data
Right 929556262 2:42927427-42927449 GAAATGGTGCATAGTAGAAATGG No data
929556258_929556267 23 Left 929556258 2:42927405-42927427 CCAGTGTTCAACAATGAGCCCAG No data
Right 929556267 2:42927451-42927473 AACAAGTAGGGTGCCTGGAGAGG No data
929556258_929556264 10 Left 929556258 2:42927405-42927427 CCAGTGTTCAACAATGAGCCCAG No data
Right 929556264 2:42927438-42927460 TAGTAGAAATGGGAACAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929556258 Original CRISPR CTGGGCTCATTGTTGAACAC TGG (reversed) Intergenic
No off target data available for this crispr