ID: 929556338

View in Genome Browser
Species Human (GRCh38)
Location 2:42927736-42927758
Sequence ACCAAGTAACGGTCTGTTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929556338_929556347 -2 Left 929556338 2:42927736-42927758 CCCTAAACAGACCGTTACTTGGT No data
Right 929556347 2:42927757-42927779 GTTTCCGTTGTTTGGGGAGGGGG No data
929556338_929556346 -3 Left 929556338 2:42927736-42927758 CCCTAAACAGACCGTTACTTGGT No data
Right 929556346 2:42927756-42927778 GGTTTCCGTTGTTTGGGGAGGGG No data
929556338_929556345 -4 Left 929556338 2:42927736-42927758 CCCTAAACAGACCGTTACTTGGT No data
Right 929556345 2:42927755-42927777 TGGTTTCCGTTGTTTGGGGAGGG No data
929556338_929556350 2 Left 929556338 2:42927736-42927758 CCCTAAACAGACCGTTACTTGGT No data
Right 929556350 2:42927761-42927783 CCGTTGTTTGGGGAGGGGGTGGG No data
929556338_929556342 -9 Left 929556338 2:42927736-42927758 CCCTAAACAGACCGTTACTTGGT No data
Right 929556342 2:42927750-42927772 TTACTTGGTTTCCGTTGTTTGGG No data
929556338_929556348 1 Left 929556338 2:42927736-42927758 CCCTAAACAGACCGTTACTTGGT No data
Right 929556348 2:42927760-42927782 TCCGTTGTTTGGGGAGGGGGTGG No data
929556338_929556343 -8 Left 929556338 2:42927736-42927758 CCCTAAACAGACCGTTACTTGGT No data
Right 929556343 2:42927751-42927773 TACTTGGTTTCCGTTGTTTGGGG No data
929556338_929556351 3 Left 929556338 2:42927736-42927758 CCCTAAACAGACCGTTACTTGGT No data
Right 929556351 2:42927762-42927784 CGTTGTTTGGGGAGGGGGTGGGG No data
929556338_929556344 -5 Left 929556338 2:42927736-42927758 CCCTAAACAGACCGTTACTTGGT No data
Right 929556344 2:42927754-42927776 TTGGTTTCCGTTGTTTGGGGAGG No data
929556338_929556341 -10 Left 929556338 2:42927736-42927758 CCCTAAACAGACCGTTACTTGGT No data
Right 929556341 2:42927749-42927771 GTTACTTGGTTTCCGTTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929556338 Original CRISPR ACCAAGTAACGGTCTGTTTA GGG (reversed) Intergenic
No off target data available for this crispr