ID: 929557120

View in Genome Browser
Species Human (GRCh38)
Location 2:42932384-42932406
Sequence CAGTGGGGACAGAGGGACGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929557120_929557131 -5 Left 929557120 2:42932384-42932406 CCATCGTCCCTCTGTCCCCACTG No data
Right 929557131 2:42932402-42932424 CACTGGGTCTTGGGGTGTCTCGG No data
929557120_929557133 10 Left 929557120 2:42932384-42932406 CCATCGTCCCTCTGTCCCCACTG No data
Right 929557133 2:42932417-42932439 TGTCTCGGCCTCCCTGAGCTGGG No data
929557120_929557132 9 Left 929557120 2:42932384-42932406 CCATCGTCCCTCTGTCCCCACTG No data
Right 929557132 2:42932416-42932438 GTGTCTCGGCCTCCCTGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929557120 Original CRISPR CAGTGGGGACAGAGGGACGA TGG (reversed) Intergenic
No off target data available for this crispr