ID: 929558057

View in Genome Browser
Species Human (GRCh38)
Location 2:42937686-42937708
Sequence TGGTGGGGGAGGAGGGCGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929558057_929558066 -8 Left 929558057 2:42937686-42937708 CCTCCCGCCCTCCTCCCCCACCA No data
Right 929558066 2:42937701-42937723 CCCCACCATGCTTGGCACTGAGG No data
929558057_929558068 -7 Left 929558057 2:42937686-42937708 CCTCCCGCCCTCCTCCCCCACCA No data
Right 929558068 2:42937702-42937724 CCCACCATGCTTGGCACTGAGGG No data
929558057_929558073 24 Left 929558057 2:42937686-42937708 CCTCCCGCCCTCCTCCCCCACCA No data
Right 929558073 2:42937733-42937755 TCCTTCTTGAAAGCCTGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929558057 Original CRISPR TGGTGGGGGAGGAGGGCGGG AGG (reversed) Intergenic
No off target data available for this crispr