ID: 929561624

View in Genome Browser
Species Human (GRCh38)
Location 2:42959949-42959971
Sequence CTCCTGGGCCAGAGGCCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929561624_929561630 25 Left 929561624 2:42959949-42959971 CCATCTGGCCTCTGGCCCAGGAG No data
Right 929561630 2:42959997-42960019 ATATTTCCATCATTTGCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929561624 Original CRISPR CTCCTGGGCCAGAGGCCAGA TGG (reversed) Intergenic
No off target data available for this crispr