ID: 929561630

View in Genome Browser
Species Human (GRCh38)
Location 2:42959997-42960019
Sequence ATATTTCCATCATTTGCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929561627_929561630 9 Left 929561627 2:42959965-42959987 CCAGGAGCCTCGACCAAAAAGTT No data
Right 929561630 2:42959997-42960019 ATATTTCCATCATTTGCAGATGG No data
929561629_929561630 -4 Left 929561629 2:42959978-42960000 CCAAAAAGTTACTTAAGTCATAT No data
Right 929561630 2:42959997-42960019 ATATTTCCATCATTTGCAGATGG No data
929561624_929561630 25 Left 929561624 2:42959949-42959971 CCATCTGGCCTCTGGCCCAGGAG No data
Right 929561630 2:42959997-42960019 ATATTTCCATCATTTGCAGATGG No data
929561625_929561630 17 Left 929561625 2:42959957-42959979 CCTCTGGCCCAGGAGCCTCGACC No data
Right 929561630 2:42959997-42960019 ATATTTCCATCATTTGCAGATGG No data
929561626_929561630 10 Left 929561626 2:42959964-42959986 CCCAGGAGCCTCGACCAAAAAGT No data
Right 929561630 2:42959997-42960019 ATATTTCCATCATTTGCAGATGG No data
929561628_929561630 2 Left 929561628 2:42959972-42959994 CCTCGACCAAAAAGTTACTTAAG No data
Right 929561630 2:42959997-42960019 ATATTTCCATCATTTGCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929561630 Original CRISPR ATATTTCCATCATTTGCAGA TGG Intergenic
No off target data available for this crispr