ID: 929564993

View in Genome Browser
Species Human (GRCh38)
Location 2:42978640-42978662
Sequence CCCAGTGGATGGAGGGCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929564974_929564993 25 Left 929564974 2:42978592-42978614 CCCGCTGTCCAGCTGGATGGAGG No data
Right 929564993 2:42978640-42978662 CCCAGTGGATGGAGGGCACATGG No data
929564976_929564993 24 Left 929564976 2:42978593-42978615 CCGCTGTCCAGCTGGATGGAGGG No data
Right 929564993 2:42978640-42978662 CCCAGTGGATGGAGGGCACATGG No data
929564973_929564993 26 Left 929564973 2:42978591-42978613 CCCCGCTGTCCAGCTGGATGGAG No data
Right 929564993 2:42978640-42978662 CCCAGTGGATGGAGGGCACATGG No data
929564978_929564993 17 Left 929564978 2:42978600-42978622 CCAGCTGGATGGAGGGCACATGG No data
Right 929564993 2:42978640-42978662 CCCAGTGGATGGAGGGCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929564993 Original CRISPR CCCAGTGGATGGAGGGCACA TGG Intergenic
No off target data available for this crispr