ID: 929568885

View in Genome Browser
Species Human (GRCh38)
Location 2:43007218-43007240
Sequence GAGGACCCACACTGCTTTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929568875_929568885 21 Left 929568875 2:43007174-43007196 CCTCAGAGCCAGGGCTTCTGTGG No data
Right 929568885 2:43007218-43007240 GAGGACCCACACTGCTTTCTAGG No data
929568877_929568885 13 Left 929568877 2:43007182-43007204 CCAGGGCTTCTGTGGTGCGCAAC No data
Right 929568885 2:43007218-43007240 GAGGACCCACACTGCTTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929568885 Original CRISPR GAGGACCCACACTGCTTTCT AGG Intergenic
No off target data available for this crispr