ID: 929569002

View in Genome Browser
Species Human (GRCh38)
Location 2:43008110-43008132
Sequence CGGCAACCAGCACTAGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929569002_929569012 19 Left 929569002 2:43008110-43008132 CCTGCCACTAGTGCTGGTTGCCG No data
Right 929569012 2:43008152-43008174 GGTCACATGGAACTTTCTGTAGG No data
929569002_929569009 6 Left 929569002 2:43008110-43008132 CCTGCCACTAGTGCTGGTTGCCG No data
Right 929569009 2:43008139-43008161 GGCCTCTGCTCCTGGTCACATGG No data
929569002_929569008 -2 Left 929569002 2:43008110-43008132 CCTGCCACTAGTGCTGGTTGCCG No data
Right 929569008 2:43008131-43008153 CGGCAGGAGGCCTCTGCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929569002 Original CRISPR CGGCAACCAGCACTAGTGGC AGG (reversed) Intergenic
No off target data available for this crispr