ID: 929569770

View in Genome Browser
Species Human (GRCh38)
Location 2:43014842-43014864
Sequence GCTAGAGCAACCACCTTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929569766_929569770 10 Left 929569766 2:43014809-43014831 CCATCTGGCTGGAAGGTGGAAGT No data
Right 929569770 2:43014842-43014864 GCTAGAGCAACCACCTTGGAGGG No data
929569759_929569770 25 Left 929569759 2:43014794-43014816 CCTCTTTTTCCCTTTCCATCTGG No data
Right 929569770 2:43014842-43014864 GCTAGAGCAACCACCTTGGAGGG No data
929569764_929569770 15 Left 929569764 2:43014804-43014826 CCTTTCCATCTGGCTGGAAGGTG No data
Right 929569770 2:43014842-43014864 GCTAGAGCAACCACCTTGGAGGG No data
929569763_929569770 16 Left 929569763 2:43014803-43014825 CCCTTTCCATCTGGCTGGAAGGT No data
Right 929569770 2:43014842-43014864 GCTAGAGCAACCACCTTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929569770 Original CRISPR GCTAGAGCAACCACCTTGGA GGG Intergenic
No off target data available for this crispr