ID: 929570805

View in Genome Browser
Species Human (GRCh38)
Location 2:43021883-43021905
Sequence AGCAAGCCTGGGAGGAGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929570805_929570814 0 Left 929570805 2:43021883-43021905 CCAGCCCTCCTCCCAGGCTTGCT No data
Right 929570814 2:43021906-43021928 GCAGCCGGCCCAGCTGCGAGGGG No data
929570805_929570813 -1 Left 929570805 2:43021883-43021905 CCAGCCCTCCTCCCAGGCTTGCT No data
Right 929570813 2:43021905-43021927 TGCAGCCGGCCCAGCTGCGAGGG No data
929570805_929570820 12 Left 929570805 2:43021883-43021905 CCAGCCCTCCTCCCAGGCTTGCT No data
Right 929570820 2:43021918-43021940 GCTGCGAGGGGGCCCGAGGACGG No data
929570805_929570818 8 Left 929570805 2:43021883-43021905 CCAGCCCTCCTCCCAGGCTTGCT No data
Right 929570818 2:43021914-43021936 CCCAGCTGCGAGGGGGCCCGAGG No data
929570805_929570815 1 Left 929570805 2:43021883-43021905 CCAGCCCTCCTCCCAGGCTTGCT No data
Right 929570815 2:43021907-43021929 CAGCCGGCCCAGCTGCGAGGGGG No data
929570805_929570823 25 Left 929570805 2:43021883-43021905 CCAGCCCTCCTCCCAGGCTTGCT No data
Right 929570823 2:43021931-43021953 CCGAGGACGGCACTGCACAAAGG No data
929570805_929570812 -2 Left 929570805 2:43021883-43021905 CCAGCCCTCCTCCCAGGCTTGCT No data
Right 929570812 2:43021904-43021926 CTGCAGCCGGCCCAGCTGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929570805 Original CRISPR AGCAAGCCTGGGAGGAGGGC TGG (reversed) Intergenic